ID: 960902286

View in Genome Browser
Species Human (GRCh38)
Location 3:122564655-122564677
Sequence CCGGCCCCCGGGTTTCCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960902274_960902286 3 Left 960902274 3:122564629-122564651 CCAGGCTGCGAAAGCCCTCTGGG 0: 1
1: 0
2: 1
3: 11
4: 127
Right 960902286 3:122564655-122564677 CCGGCCCCCGGGTTTCCAGGCGG 0: 1
1: 0
2: 1
3: 6
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960902286 Original CRISPR CCGGCCCCCGGGTTTCCAGG CGG Intronic