ID: 960902286

View in Genome Browser
Species Human (GRCh38)
Location 3:122564655-122564677
Sequence CCGGCCCCCGGGTTTCCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960902274_960902286 3 Left 960902274 3:122564629-122564651 CCAGGCTGCGAAAGCCCTCTGGG 0: 1
1: 0
2: 1
3: 11
4: 127
Right 960902286 3:122564655-122564677 CCGGCCCCCGGGTTTCCAGGCGG 0: 1
1: 0
2: 1
3: 6
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960902286 Original CRISPR CCGGCCCCCGGGTTTCCAGG CGG Intronic
901700828 1:11044114-11044136 CCAGCCCCCTGGGTTCCTGGAGG + Intronic
901815477 1:11791154-11791176 CCTCCCCACGGTTTTCCAGGTGG + Intronic
905169078 1:36099116-36099138 AGGGCCCCCAGGATTCCAGGGGG - Exonic
905761646 1:40563439-40563461 CCGCCCCCAGTGTTGCCAGGTGG + Intergenic
907309228 1:53529844-53529866 CCAGCACCCGGGTTGCCAGAAGG - Exonic
908473779 1:64470002-64470024 CCGGCCCCCGGCGTCCCGGGGGG + Intergenic
908794358 1:67816577-67816599 CCCCACCCCAGGTTTCCAGGTGG + Intronic
911072893 1:93846616-93846638 GCGGCCGCGGGGTTTCCTGGTGG - Intronic
911392829 1:97268159-97268181 CCTGCCCCAGTGTGTCCAGGAGG - Intronic
912309621 1:108607222-108607244 CCAGCCACCTGGTGTCCAGGAGG - Intronic
913661544 1:121009913-121009935 CCGCCCACCAGGTTGCCAGGAGG + Intergenic
914012915 1:143793093-143793115 CCGCCCACCAGGTTGCCAGGAGG + Intergenic
914164912 1:145168092-145168114 CCGCCCACCAGGTTGCCAGGAGG - Intergenic
914651540 1:149701702-149701724 CCGCCCACCAGGTTGCCAGGAGG + Intergenic
915601231 1:156924344-156924366 CCGGCCCACGGGTGCCCGGGTGG - Intronic
921080573 1:211735826-211735848 CTGCCTCCCGGGTTCCCAGGAGG - Intergenic
1067116040 10:43436498-43436520 ACGCACCCCGGCTTTCCAGGAGG - Intergenic
1069918118 10:71799473-71799495 CCTGCCCCCTGGGCTCCAGGAGG + Exonic
1076336974 10:129713489-129713511 CAGGCCCGCGGGTTTCCAGGTGG + Intronic
1076353137 10:129832420-129832442 CTGGCCCCAGTCTTTCCAGGAGG + Intergenic
1076906867 10:133366840-133366862 TCCCACCCCGGGTTTCCAGGTGG + Intronic
1077420128 11:2446155-2446177 CTGGCCCCCCTGTTACCAGGTGG + Intronic
1081772539 11:45658847-45658869 CCGGAGCCCCGGTGTCCAGGGGG - Intronic
1083149916 11:60785512-60785534 CCGGTCCCCTGGCTTCAAGGGGG - Intronic
1084068959 11:66721428-66721450 CCGTCCCCAGGCTTCCCAGGTGG - Exonic
1089300804 11:117497664-117497686 CTGGGCCCCAGGTTTCCAGAGGG + Intronic
1091562993 12:1629083-1629105 CCCGCCCCGGGCTTTCCACGAGG - Intronic
1091594223 12:1864973-1864995 GCCGCTCCCGGGTCTCCAGGTGG + Intronic
1095961519 12:47837774-47837796 CCTGCCCCCTGGTGGCCAGGTGG + Intergenic
1101588766 12:106108311-106108333 CCTGCCCCTGGGTTTACAGCAGG - Intronic
1104222487 12:126798486-126798508 CCGGCCCACAGGTGTCCAGGTGG - Intergenic
1104982012 12:132577366-132577388 CCAGCCCCCGCTTTCCCAGGAGG + Intronic
1112329568 13:98466827-98466849 CTGGCCCCCGGGACTCCACGGGG - Intronic
1114306778 14:21430850-21430872 GTGGCCCCAGGGTTTCCAGCAGG + Exonic
1114615300 14:24065054-24065076 CCGGCCCCGGAGCTTCAAGGGGG + Exonic
1115705979 14:35998595-35998617 TCGGGCCTCGAGTTTCCAGGCGG - Intergenic
1116249799 14:42466189-42466211 CCTGCCCACTGGTTTCCAGATGG + Intergenic
1120155489 14:81088650-81088672 CAGGCCCCCTGGATACCAGGTGG + Intronic
1121930321 14:97966306-97966328 CAGGCCCCCAGGGTTCCAGTAGG - Intronic
1122132452 14:99612766-99612788 CTGGCCCCCGGGTTGCCCTGGGG + Intergenic
1123023881 14:105414696-105414718 TCTGCCCCCGGGTTTCCTGCCGG - Intronic
1202905418 14_GL000194v1_random:68808-68830 CCCGCCCCACGGTTGCCAGGAGG - Intergenic
1127921946 15:63501473-63501495 CCCGCCCCCGGATGTCCAGAGGG + Intergenic
1132750615 16:1455792-1455814 CCGGCCGCCTGCCTTCCAGGTGG - Exonic
1132759574 16:1502211-1502233 CCGGGCCCAGGGCTTCCCGGTGG - Intronic
1132803044 16:1763514-1763536 CCGGCCACCGGGTGCCCAGCTGG - Intronic
1133020597 16:2965147-2965169 CCGCCCCCAGGTTCTCCAGGAGG - Intronic
1133056316 16:3147248-3147270 CCCACCCCAGGCTTTCCAGGAGG + Exonic
1134267486 16:12704592-12704614 CCGGGCCACGGGTTTCAGGGAGG - Intronic
1136222273 16:28836137-28836159 CAGGCGCCTGGATTTCCAGGAGG + Exonic
1136787875 16:32946371-32946393 CCTGACCCCGGGTCACCAGGGGG - Intergenic
1136881909 16:33907418-33907440 CCTGACCCCGGGTCACCAGGGGG + Intergenic
1137556756 16:49475062-49475084 CCTCCCCCACGGTTTCCAGGAGG - Intergenic
1139776784 16:69321388-69321410 CTGGCCCTCGGCTCTCCAGGAGG - Intronic
1141331635 16:83116428-83116450 TCAGCCCCCTGGCTTCCAGGTGG - Intronic
1142027179 16:87820691-87820713 GAGGCCCCCAGGCTTCCAGGAGG + Intergenic
1142150700 16:88511365-88511387 CCGGGCCCCAGGCTTCCTGGTGG + Intronic
1203090102 16_KI270728v1_random:1208028-1208050 CCTGACCCCGGGTCACCAGGGGG - Intergenic
1146492422 17:33292381-33292403 CCGGCCCCTGGTCTTCCTGGAGG + Exonic
1147148238 17:38498489-38498511 CCTGACCCCGGGTCGCCAGGGGG - Exonic
1147740305 17:42667619-42667641 CCAGCCTCAGGGATTCCAGGAGG + Intergenic
1149491074 17:57085502-57085524 CCCGCCCCCGGGGTACCTGGAGG - Intronic
1149905803 17:60525742-60525764 GCGGCCCCCGGGGTTGCTGGAGG + Intronic
1151522715 17:74641644-74641666 CCGGACCCAGGATGTCCAGGAGG + Intergenic
1152570374 17:81118995-81119017 CCGGCCCCACGGTGCCCAGGTGG - Intronic
1152739732 17:82013638-82013660 CCGGCCCCCGGCTTCCGAGAGGG + Intronic
1153935329 18:9914919-9914941 CCGGCCCTCGGGTTCCGCGGAGG + Intronic
1153948795 18:10039751-10039773 TCTGCCCCCAGGTTTCCAGTGGG + Intergenic
1158150009 18:54357630-54357652 CCGGCCCCGGGGTCTGCGGGAGG - Intronic
1159798210 18:72868158-72868180 CCAGGCTCCGGGCTTCCAGGAGG - Intergenic
1161108576 19:2456288-2456310 CCGGCTCGGGGGTCTCCAGGAGG - Intronic
1162022952 19:7876198-7876220 GAGGCCCCCTGATTTCCAGGAGG - Intergenic
1163574269 19:18101386-18101408 CCAGCCCCAGGGCTTCCAGGAGG - Intronic
1164989649 19:32674890-32674912 CCAGCCCCCGCGTCCCCAGGTGG - Intronic
1165437934 19:35806854-35806876 CAGGGCCCCGGGTGTCCAGCAGG + Intronic
925398874 2:3557958-3557980 TCGGCCGGCGGGGTTCCAGGAGG - Intronic
926139923 2:10362450-10362472 CCGGCCCCCTGCATTCCGGGGGG - Intronic
926284914 2:11481575-11481597 CAGGCCCCTGTGTTTTCAGGAGG - Intergenic
934738147 2:96700390-96700412 CCAGCCCCTGGGTGTGCAGGAGG - Intergenic
934761899 2:96861135-96861157 CCAGCCCCAGGTTTTCCAGGGGG + Exonic
937274104 2:120673179-120673201 TTGGCCCTCGGGGTTCCAGGGGG + Intergenic
937294014 2:120798929-120798951 CCTGCCCCAGGGTTTTCAGCGGG + Intronic
938077266 2:128346421-128346443 CCGGCCCCTGAGGTGCCAGGAGG + Intergenic
938176775 2:129140553-129140575 CCAGCCCCAGGTTTTACAGGTGG + Intergenic
938243089 2:129758041-129758063 CTTGCCCCAGGGTTTGCAGGAGG + Intergenic
939838983 2:147164752-147164774 CTGGCCCTTAGGTTTCCAGGTGG + Intergenic
940639535 2:156332533-156332555 CCGGCGCCCGGGCTCCCAGAGGG - Exonic
947741381 2:232486536-232486558 CCTGCCCCCGGGCTTCCCGTTGG - Exonic
948430323 2:237914331-237914353 GCGGCCCCCGGGCCCCCAGGTGG + Intergenic
1172004529 20:31809734-31809756 CCTGTCCCTGGGTTTCCATGTGG + Intergenic
1173497965 20:43532778-43532800 CCCACCCCTGGGCTTCCAGGTGG + Exonic
1174610427 20:51793755-51793777 TCCACCCACGGGTTTCCAGGAGG + Intronic
1175725047 20:61312488-61312510 CCAGCCCCCGGGTGCACAGGTGG + Intronic
1175936248 20:62515462-62515484 CCCACCTGCGGGTTTCCAGGTGG - Intergenic
1178954016 21:37007029-37007051 CCGGCAGCCGGGTTCCCGGGAGG + Intronic
1179225065 21:39445775-39445797 CCCGCGCGCGGGTTTCCATGGGG - Intronic
1179480958 21:41678361-41678383 CCAGCTCCCAGATTTCCAGGTGG - Intergenic
1179718323 21:43301508-43301530 CCGGGCCCCAGGTTCCAAGGCGG - Intergenic
1180080870 21:45487014-45487036 GCAGCCCCCGGCTCTCCAGGGGG - Intronic
1180086976 21:45512074-45512096 CCAGCCCTGGGGTTACCAGGGGG - Intronic
1181179259 22:21055561-21055583 CCTTCCCCTGGGTTTGCAGGTGG + Intronic
1183345158 22:37303428-37303450 CTGGCCCCGGGGAATCCAGGAGG + Intronic
1183701498 22:39453782-39453804 CCTGGCCCTGGGTCTCCAGGTGG - Intergenic
1183702316 22:39457483-39457505 GCGGCCCCCGGGGTCCCCGGCGG - Exonic
1185057675 22:48589426-48589448 ACCGACCCTGGGTTTCCAGGTGG - Intronic
1185057701 22:48589510-48589532 ACCGACCCTGGGTTTCCAGGTGG - Intronic
952130368 3:30354821-30354843 CAGGCTCCCAGGGTTCCAGGAGG + Intergenic
952945069 3:38473544-38473566 GAGGCCCCTGGGTCTCCAGGTGG + Intronic
953645165 3:44746996-44747018 CCCGCCCCAGTGTGTCCAGGAGG - Intronic
954367613 3:50154890-50154912 CCGGGCTCAGGGTTCCCAGGCGG - Intergenic
955924108 3:63989116-63989138 CAGGCACCTGGGTTTCCACGAGG - Intronic
960902286 3:122564655-122564677 CCGGCCCCCGGGTTTCCAGGCGG + Intronic
961040558 3:123675281-123675303 CCTGCCCCAGGTTTCCCAGGAGG - Intronic
961867387 3:129963637-129963659 CAGGACCCCGGGTTTCCAAGGGG - Intergenic
966453257 3:180086127-180086149 CCTGCCCCAGTGTGTCCAGGAGG + Intergenic
968476130 4:809722-809744 CCAGCCCTCGGGTTTCATGGTGG + Intronic
983077455 4:163343767-163343789 CCGGCCCCCGGCTTTGGAAGAGG + Intronic
992444096 5:76819160-76819182 CCGGCGTCGGGGCTTCCAGGAGG + Exonic
992828141 5:80569709-80569731 CCGGCCGCGGGGTGTCGAGGAGG - Intronic
997978472 5:138454187-138454209 CCGGCTGCTGTGTTTCCAGGGGG - Intergenic
1002196302 5:177503494-177503516 CGGGCCTCCGGGTCTCCAGTTGG + Intronic
1006389326 6:33749182-33749204 CTGGCCCCCAGGTCTCCAGGAGG + Intergenic
1007182203 6:39937487-39937509 CCTGACCTCTGGTTTCCAGGTGG + Intergenic
1008010792 6:46465703-46465725 CTGGCCCTCTGGTTTCCAGCTGG - Intronic
1010244828 6:73653581-73653603 GCGGCCCCCGGGGTTCCCGAGGG + Intronic
1018669345 6:166166853-166166875 CCCGCCCCGTGTTTTCCAGGAGG - Exonic
1018790249 6:167142992-167143014 TGGGCCCCCAGGTGTCCAGGTGG + Intergenic
1019183988 6:170210147-170210169 CCAGCCCCCGGGATTCCCCGTGG + Intergenic
1021969075 7:25950374-25950396 CCCGCCCCCAGCTTTCCAGATGG - Intergenic
1022095609 7:27139398-27139420 TGGGCCCCCGGGTTGCAAGGTGG - Intronic
1024189656 7:46993184-46993206 CCAGCCCCAGGGTTTCCACTGGG - Intergenic
1026208599 7:68280851-68280873 CCAGCCCCCAGGCTTGCAGGTGG - Intergenic
1026999652 7:74643603-74643625 CCAGGCCCTCGGTTTCCAGGTGG - Intergenic
1027145763 7:75693358-75693380 CGGGGCGCCTGGTTTCCAGGAGG + Intronic
1032174499 7:129612144-129612166 CCGGGCCCCGGGTTCCACGGCGG - Intronic
1032229201 7:130059734-130059756 CCAGCCTCAGGGTTTCCTGGAGG + Intergenic
1034441705 7:151088944-151088966 CCGGCTCCCGGGATTTCACGAGG - Intronic
1036186151 8:6624130-6624152 CCCGCCCGTGGGTTTTCAGGAGG + Intronic
1036210191 8:6834986-6835008 CCGACCCCCGGCCGTCCAGGGGG - Intronic
1037529206 8:19757303-19757325 CCCGCCCCCGGGGTCCCTGGAGG - Intronic
1037985440 8:23288190-23288212 CCGACCCCCGGGCTCCCGGGTGG + Intronic
1040008451 8:42640819-42640841 CCTGCCCTCTGGTTTCCAGCTGG - Intergenic
1044973757 8:97644274-97644296 CCGCCTCCCGGGTCTCCTGGCGG + Exonic
1049267023 8:141673494-141673516 CCGGCCCCGAGCTGTCCAGGAGG + Intergenic
1049850500 8:144827706-144827728 GCGTCCCCCGGGCCTCCAGGCGG + Intronic
1052362167 9:27573229-27573251 CCGGGCCCCGGGCTTCCCGGCGG - Intronic
1053415937 9:37946758-37946780 CCAGCCACGGGGATTCCAGGAGG + Intronic
1060208012 9:121693908-121693930 GGGGCTCCCGGGTGTCCAGGTGG + Intronic
1060477317 9:123996592-123996614 CCGTCCCCAGGGTCCCCAGGGGG - Intergenic
1061903482 9:133684822-133684844 TCGGCCCTCCCGTTTCCAGGAGG + Intronic
1061931335 9:133834586-133834608 CCGGGCTCCGGGTGTCCAGTGGG + Intronic
1061970027 9:134039912-134039934 CCATCACCCTGGTTTCCAGGTGG + Intronic
1062466635 9:136684541-136684563 CCTCCCCACGGGGTTCCAGGCGG - Intronic
1062493863 9:136822360-136822382 CCGTCCTCCACGTTTCCAGGAGG - Intronic
1062543794 9:137053032-137053054 CTGGTCCCCAGCTTTCCAGGTGG - Intronic
1062652822 9:137587067-137587089 CGTGGCCCCGGGCTTCCAGGTGG - Exonic
1203776248 EBV:74773-74795 CCTGCCCCCTGGTGTGCAGGTGG + Intergenic
1203561774 Un_KI270744v1:63978-64000 CCCGCCCCACGGTTGCCAGGAGG + Intergenic
1190107506 X:47570620-47570642 TAGGCCCACGGGTTTCTAGGAGG - Intronic
1190304013 X:49072340-49072362 CCGGTCCCCGGGTTGAGAGGGGG - Intronic
1191815618 X:65241381-65241403 CCGGCTCCAGGGAGTCCAGGTGG - Intergenic
1197742481 X:129905922-129905944 CCTGGCCCCTGGTTTCCACGTGG - Intergenic
1201161297 Y:11168989-11169011 CCCGCCCCACGGTTGCCAGGAGG - Intergenic