ID: 960905199

View in Genome Browser
Species Human (GRCh38)
Location 3:122593995-122594017
Sequence AACATATAGCAATATGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 231}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960905196_960905199 16 Left 960905196 3:122593956-122593978 CCAGGCACTGTGCTTAGACTTTT 0: 1
1: 0
2: 16
3: 189
4: 1093
Right 960905199 3:122593995-122594017 AACATATAGCAATATGAGATAGG 0: 1
1: 0
2: 0
3: 26
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960905199 Original CRISPR AACATATAGCAATATGAGAT AGG Intronic
902828389 1:18993531-18993553 AGCATCTATCAATATGAGAATGG + Intergenic
906178803 1:43800188-43800210 AACATACACCCATTTGAGATTGG + Intronic
908449053 1:64232670-64232692 AACATATACCAAAAGGACATAGG - Intronic
908730255 1:67219069-67219091 AACATAAAGCAGTATGGGCTGGG + Intronic
908903425 1:68981848-68981870 AACAAAGATCAATTTGAGATTGG - Intergenic
908986138 1:70024126-70024148 AACTTATAGCAATTTTAGTTAGG - Intronic
909226044 1:73024087-73024109 AACGTATAGCAATATTTTATGGG - Intergenic
909942308 1:81624604-81624626 AACAAATAGAAGTATGAGATTGG + Intronic
910123616 1:83817208-83817230 TACATAGAGAAATATGAGTTTGG - Intergenic
910827071 1:91420439-91420461 AACATATAGCTTTATGACCTGGG - Intergenic
911439529 1:97908204-97908226 AACACATACCAAAATTAGATTGG - Intronic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
911509149 1:98790421-98790443 AACATACAGCAACAGGAGATTGG - Intergenic
914999215 1:152572912-152572934 CACATATAGAAAGAGGAGATGGG + Intronic
915917337 1:159948470-159948492 CAGATATAGAAATATGAGATGGG - Intergenic
916338729 1:163703755-163703777 AACATTTAGCAATACAAGATGGG + Intergenic
916807426 1:168272073-168272095 AATACATAGGAATATTAGATTGG + Intergenic
918258651 1:182773879-182773901 TACATAAAGCAAAATGTGATAGG - Intergenic
918476162 1:184927697-184927719 AGCAGATAGCAAGATGAGCTTGG + Intronic
921627455 1:217393019-217393041 AACATTTAGCAATTTGAGGCAGG + Intergenic
921739430 1:218666876-218666898 AACATATAACAAAATTAGGTAGG - Intergenic
1063858276 10:10279644-10279666 AACATATAAAAATATGCCATGGG - Intergenic
1064163482 10:12966186-12966208 ACCATATAGTAATATGAGTAAGG - Intronic
1064163485 10:12966222-12966244 ACCATATAGTAATATGAGTAAGG - Intronic
1064204263 10:13309919-13309941 TACATATAGTAATAGGACATTGG - Intergenic
1065517943 10:26543700-26543722 AACAAGGAGCAATATGAGGTAGG + Intronic
1066580831 10:36880364-36880386 AATGTATAGGAAAATGAGATAGG + Intergenic
1068704410 10:60057553-60057575 AACATATAGCTTTATGACTTTGG + Intronic
1069147617 10:64915490-64915512 CACATATAGAAAAATGACATTGG - Intergenic
1069416190 10:68202945-68202967 AACATATTGCATTGTTAGATTGG - Intronic
1071734605 10:88284141-88284163 AACATATAATAATATGCTATAGG + Intronic
1072478591 10:95787474-95787496 AAAATATAGAAGTATGAGACTGG + Intronic
1073088383 10:100911215-100911237 AACAGAAAGCACTAAGAGATAGG + Intergenic
1073714335 10:106085345-106085367 AAAATATAGGAGTATGAGGTCGG - Intergenic
1074247107 10:111705760-111705782 AAAATAAATCAATATGAGCTAGG + Intergenic
1074938556 10:118211924-118211946 AACAAATAAGAATATGAGACTGG + Intergenic
1076123649 10:127956414-127956436 AATATATAGACATATGAGAGGGG - Intronic
1077573869 11:3363189-3363211 AACAGACAGCAATATAATATTGG + Intronic
1077790570 11:5435071-5435093 AATATATAGCCTTTTGAGATGGG - Intronic
1082191902 11:49255784-49255806 AGCATTGAGCAATATGAGAGTGG + Intergenic
1085198266 11:74685068-74685090 AACATATAGCTATTTGAAAATGG - Intergenic
1086269175 11:85039544-85039566 AACATATATAACTATGAGATAGG - Intronic
1086665820 11:89480808-89480830 AATTTATAGTAATCTGAGATAGG + Intronic
1086674220 11:89585232-89585254 AGCATTGAGCAATATGAGAGTGG - Intergenic
1087644506 11:100792164-100792186 AAAATATAACAATATTAGATTGG - Intronic
1088248171 11:107839517-107839539 AACATATAACCATATGGGTTTGG - Intronic
1094146831 12:27237465-27237487 AACATGTGGCAATTTGAGAGTGG + Intergenic
1095330156 12:40950568-40950590 AAAATAGAGCAATTTGACATTGG - Intronic
1098393433 12:69993352-69993374 AACATTTAGCAATAGGAATTTGG - Intergenic
1099418006 12:82417776-82417798 AAAATAAAGCAATGTGAGTTTGG + Intronic
1099528393 12:83743457-83743479 GACCTATGGCAATATGACATAGG - Intergenic
1099605877 12:84800671-84800693 ACCATAAAGCAATATGATATTGG + Intergenic
1100100439 12:91097234-91097256 CACATATAGAAGAATGAGATTGG + Intergenic
1100728792 12:97440776-97440798 AACAGATAAAGATATGAGATGGG + Intergenic
1101047254 12:100821325-100821347 AACAAATAGCACTAAGAGAAAGG - Intronic
1102747971 12:115266683-115266705 AAGATACAGCACTATGAGATAGG - Intergenic
1103820787 12:123696721-123696743 AAAAGATTGAAATATGAGATTGG + Intronic
1104190272 12:126475392-126475414 AACATGTAGCCATTTCAGATTGG - Intergenic
1104798317 12:131535377-131535399 AACACATAGAATGATGAGATGGG - Intergenic
1105319316 13:19302666-19302688 AACATATAGAAATATTTTATGGG - Intergenic
1105731029 13:23215850-23215872 ATCATATAGCAATAAGATGTAGG + Intronic
1105954366 13:25266458-25266480 CACACATATCAATCTGAGATTGG + Intronic
1106273898 13:28184407-28184429 TACATAGGGCAATATGAGAAGGG + Intronic
1107152264 13:37125655-37125677 AACATCTTTCAATAAGAGATTGG - Intergenic
1107635382 13:42386984-42387006 ATCATATTTCAACATGAGATTGG + Intergenic
1108457795 13:50634083-50634105 AACATATAGAATTATCAGATGGG - Intronic
1108883324 13:55148175-55148197 GACATAAATCAATATGAGAAAGG - Intergenic
1109636190 13:65120731-65120753 AATGTATTGCATTATGAGATAGG - Intergenic
1109873693 13:68369562-68369584 ACCATATATCAATATGAGAAGGG + Intergenic
1110171887 13:72510922-72510944 AACAGATAGCAATACGTGAGAGG - Intergenic
1112673641 13:101672028-101672050 AACATATAGTAATCTCAGATTGG - Intronic
1112727464 13:102320786-102320808 AAAAAATAGCAACATGAGATAGG + Intronic
1113013460 13:105798311-105798333 ATCACAAAGCAATATGAGATGGG + Intergenic
1114388197 14:22277893-22277915 AATATATAGATATATGAGAGGGG + Intergenic
1114723377 14:24907846-24907868 AACATTTAGCAATCTAAGAGAGG - Intronic
1114769525 14:25412351-25412373 AACATATTCCAGAATGAGATAGG - Intergenic
1114963288 14:27921710-27921732 AACATATAGGTATTTGACATGGG - Intergenic
1116273634 14:42803777-42803799 AAATTATAGCAATATTATATTGG + Intergenic
1119935407 14:78587808-78587830 AAAATATAGAAATATGACAAAGG - Intronic
1120012176 14:79428642-79428664 AATATATAGCAAAATCAGCTGGG + Intronic
1120484815 14:85099815-85099837 AACATATATATATCTGAGATAGG - Intergenic
1122168464 14:99850372-99850394 AGGATAAAGCAATATGAGTTTGG - Intronic
1124838280 15:33216860-33216882 ACCATAAAAGAATATGAGATAGG + Intergenic
1124864565 15:33476572-33476594 ACCATATAGCAATATGGAACTGG - Intronic
1127183649 15:56453160-56453182 AAAATATGACAAAATGAGATAGG - Intronic
1127404594 15:58628995-58629017 AACATAAAGCAAGATAATATTGG - Intronic
1131823179 15:96293505-96293527 AACAGATACAAATATTAGATGGG + Intergenic
1133950570 16:10388189-10388211 ATGATATAAAAATATGAGATAGG - Intronic
1137470346 16:48749535-48749557 AAGATATAGTAATATGAAAAAGG + Intergenic
1138504012 16:57467996-57468018 AAAATAAAGAAATATGAAATGGG - Intronic
1138866094 16:60822006-60822028 AACATACAGCAATATGAAAATGG + Intergenic
1140379990 16:74478313-74478335 TAGATATAACATTATGAGATAGG + Intronic
1140420017 16:74811746-74811768 GACATTTTGTAATATGAGATGGG - Intergenic
1141272890 16:82557021-82557043 TACTTATAGCAATGTGAGAATGG - Intergenic
1146496675 17:33328928-33328950 AAAATATAGCAAGAGGAGAAAGG - Intronic
1147222991 17:38950807-38950829 GGCAAAAAGCAATATGAGATTGG - Intronic
1147344198 17:39777073-39777095 AAAATACAGCAGAATGAGATGGG - Intronic
1148032848 17:44633940-44633962 AAATTAAAGCAATATGAGATTGG + Intergenic
1149186604 17:54005147-54005169 TACATGGAGAAATATGAGATTGG - Intergenic
1149394710 17:56228032-56228054 AAAATGCAGCAATGTGAGATGGG - Intronic
1149681382 17:58509747-58509769 AACATGTGGCAATATGCTATGGG - Intronic
1149819878 17:59765921-59765943 AATATATATAAATATTAGATTGG + Intronic
1149949734 17:60972841-60972863 AACATATAGAAATATAAAAAAGG - Intronic
1150197118 17:63311225-63311247 AACATACAACAATAAGATATTGG + Intronic
1151036103 17:70801968-70801990 AACAAATAGCAATATGTGAAAGG + Intergenic
1153026249 18:675582-675604 AAAATATAGCAATGTGAGGTGGG + Intronic
1153149263 18:2071522-2071544 AAAATCTAGCAATTTGACATTGG - Intergenic
1155145796 18:23082391-23082413 GAATTATAGCAATATGATATTGG - Intergenic
1155856560 18:30841648-30841670 AACAAATGGCAAAAAGAGATGGG - Intergenic
1156862867 18:41858710-41858732 TCCTTATAGCAACATGAGATTGG - Intergenic
1157910205 18:51610364-51610386 TCTATATAGCAATATGAGAATGG - Intergenic
1158373354 18:56833682-56833704 ACTATATAGCAAAATGAGGTGGG - Intronic
1158678024 18:59540323-59540345 TACATATAGAAATATTACATAGG + Intronic
1158749499 18:60242613-60242635 AACAAAAAGCAAGATGAGGTAGG + Intergenic
1159036813 18:63285534-63285556 AACATATGCAAATATGAGATGGG + Intronic
1159420149 18:68207888-68207910 TCCATAAGGCAATATGAGATTGG + Intergenic
1159873192 18:73781771-73781793 AATATATAGTAATATGACCTGGG + Intergenic
1167404956 19:49300639-49300661 AACAAATAGCAAAGTAAGATGGG + Intronic
925583777 2:5442065-5442087 ACAATATAACAAAATGAGATTGG - Intergenic
927429069 2:23011647-23011669 AACATATAGCAGTAGTAGAAGGG + Intergenic
929078815 2:38101554-38101576 AATATTCAGCAATATGGGATTGG + Intronic
929301471 2:40308592-40308614 AAAGTATAGCACTATGATATTGG - Intronic
931232199 2:60384321-60384343 AACAAAGAGAAATAGGAGATAGG + Intergenic
931451143 2:62368764-62368786 AAGACATAGCAGTATGAGACTGG + Intergenic
932507106 2:72245554-72245576 AACATATAGCCTTTTCAGATTGG - Intronic
934908559 2:98228796-98228818 AACATATAAGAATATAGGATGGG - Intronic
936363894 2:111833490-111833512 AAAATTTAGCAAAAAGAGATTGG - Intronic
936814042 2:116437426-116437448 AATACATAGCAATATCTGATGGG + Intergenic
937827331 2:126381157-126381179 AACATCAAGAAATAGGAGATAGG + Intergenic
939233244 2:139458265-139458287 AAAATATAGCATACTGAGATGGG - Intergenic
940205831 2:151200704-151200726 AACTTATAGAAAAATGAGAAAGG + Intergenic
941305938 2:163867616-163867638 AGCATATAGCAGCATGAGAAGGG - Intergenic
943238666 2:185356322-185356344 TATTTATAGCAATATGAGAATGG + Intergenic
943339317 2:186659257-186659279 AACATCTATCAATATGATAAAGG - Intronic
943856380 2:192798542-192798564 AACATACAGCAATTAGATATTGG + Intergenic
944303337 2:198150379-198150401 AAAATCTAGCAATAGGAGATTGG - Intronic
947916669 2:233836691-233836713 AATATATGGCCATATGAGTTTGG - Exonic
948380853 2:237549063-237549085 AACTTTTAGCAATATGAGAATGG - Intronic
1169749584 20:8977893-8977915 AACAGATAGAAATAAGAGATTGG + Intergenic
1169884017 20:10377615-10377637 AACAGATAGCAATGAAAGATTGG + Intergenic
1173259845 20:41424208-41424230 AAAGAAAAGCAATATGAGATGGG - Intronic
1173348277 20:42221340-42221362 TACTTATAGCAGTATGAGAATGG - Intronic
1174945817 20:54984076-54984098 AATATAAAACAATATGAGAGGGG + Intergenic
1177420451 21:20849875-20849897 ATCAGATTTCAATATGAGATTGG + Intergenic
1177602835 21:23337270-23337292 TATTTATAGCAATATGAGAACGG + Intergenic
1177613980 21:23492324-23492346 AAAATATAGAAATATGACAGTGG - Intergenic
1177646001 21:23900318-23900340 TACTTATAGCAATGTGAAATTGG - Intergenic
1181768162 22:25107052-25107074 AACATATAGAAAAATTATATAGG + Intronic
1182327868 22:29527947-29527969 AAAACAAAGCAATATGAAATGGG + Intronic
1182829526 22:33293736-33293758 AACAAAGAGTATTATGAGATTGG + Intronic
950326101 3:12111081-12111103 AACACATGGGAAGATGAGATTGG - Intronic
951321158 3:21247725-21247747 AACATATAGAAATATGGCAAAGG + Intergenic
951874618 3:27408241-27408263 ATCAAATAGCAAGATTAGATGGG + Intronic
952732012 3:36648547-36648569 AAATTATAGCAATAAGGGATGGG + Intergenic
953091970 3:39736933-39736955 TATATATAGCAATGTGAGAATGG + Intergenic
955006952 3:54977847-54977869 AACATAAAGCAATAAAAGAATGG + Intronic
956134546 3:66086117-66086139 AACCTAAATCAATAAGAGATTGG - Intergenic
959492025 3:107001613-107001635 CACATATGGGAATATGTGATTGG - Intergenic
960184882 3:114626145-114626167 AACATTTAGGAATATGTGGTGGG - Intronic
960905199 3:122593995-122594017 AACATATAGCAATATGAGATAGG + Intronic
961180528 3:124872898-124872920 ATCATAAAGCAATATGGGCTGGG - Intronic
962017817 3:131460804-131460826 AACATATAGCAATATTTTATGGG - Intergenic
964439471 3:156691334-156691356 AACATGCAGCAATATGGGAGAGG - Intronic
965389127 3:168082949-168082971 AACATATTTCTATAAGAGATTGG - Intronic
966765927 3:183462454-183462476 AACACATAGAACTTTGAGATAGG + Intergenic
967378754 3:188834227-188834249 AACATATAGAAATGTGCTATTGG + Intronic
967474127 3:189895809-189895831 AAAATATAAAATTATGAGATTGG + Exonic
969107865 4:4821488-4821510 TCCTTATAGCAATATGAGAATGG + Intergenic
970132394 4:12885840-12885862 AACATTTAGCCAGATGAAATAGG + Intergenic
970916021 4:21336230-21336252 AATATATATCAATAGGAAATAGG - Intronic
971131570 4:23816787-23816809 AATGTATAGTAATATGTGATTGG - Intronic
972418379 4:38864705-38864727 AACATTTAGAAATATGAGTGAGG + Intergenic
974598858 4:64050029-64050051 AACATGTAACAATAGGAGAATGG - Intergenic
974975164 4:68882367-68882389 AACACAAAGAAATAAGAGATGGG + Intergenic
976311011 4:83613573-83613595 AAACTATAGCAAGAAGAGATGGG - Intergenic
976615099 4:87068564-87068586 AACATACAGCTTTATGAAATGGG - Intronic
978793994 4:112690797-112690819 AATATGTAGCCATCTGAGATTGG - Intergenic
980193919 4:129562899-129562921 AACATATAAAATAATGAGATTGG - Intergenic
980477693 4:133339599-133339621 AACATATAGAATTAAGAGAATGG - Intergenic
981478807 4:145214505-145214527 AACATTTACCAGTATGATATAGG - Intergenic
986863371 5:11953845-11953867 AAAAGATAGCAATTTCAGATGGG - Intergenic
986921549 5:12689614-12689636 CACATAAAACAATATCAGATTGG - Intergenic
987177490 5:15330058-15330080 AATAAATAAGAATATGAGATTGG + Intergenic
988379638 5:30483378-30483400 AACATATTGCACCATGTGATAGG + Intergenic
990114735 5:52375134-52375156 AACATATTGTAGTATGATATGGG - Intergenic
991022036 5:61989405-61989427 AACAGATAGCAAAATAAGAGAGG - Intergenic
993646458 5:90469586-90469608 AGCATAAAGCAATTTGAGAGTGG - Intronic
994577837 5:101603324-101603346 AACATATAGCCATATTAGTCAGG + Intergenic
995194812 5:109354771-109354793 TAAATATATCAATATTAGATAGG + Intronic
998766584 5:145494926-145494948 AACATATAAGAATATCAGAGAGG - Intronic
999929982 5:156421399-156421421 AACCAATACTAATATGAGATCGG - Intronic
1000766876 5:165302910-165302932 AGCATATAAAAATAGGAGATGGG - Intergenic
1000836333 5:166159299-166159321 AACATATAGTAACATTATATAGG + Intergenic
1001242725 5:170082355-170082377 AACAAGTAACAATAGGAGATGGG - Intronic
1001538604 5:172520361-172520383 AATATATAGCATTTTCAGATTGG - Intergenic
1003326681 6:5097338-5097360 AACATATAGGTATATTAGACTGG - Intergenic
1004453867 6:15772894-15772916 CACACAAAGCAATATGAGTTTGG - Intergenic
1004652149 6:17620262-17620284 CATATATAGCTATATGAGACTGG + Intronic
1005313460 6:24581542-24581564 ATCATAGAACAATATGTGATAGG + Intronic
1005762537 6:28980600-28980622 AACATAGAGCAAAATGGAATGGG + Intergenic
1005767376 6:29026022-29026044 AACATAAAAAAATATGAGAGAGG - Intergenic
1005817934 6:29572021-29572043 AACAAATAAAAAGATGAGATGGG + Intronic
1007333441 6:41133137-41133159 AAAATATAGAAATATGTAATAGG + Intergenic
1008006645 6:46416994-46417016 AAAGTCTAGCAATATGAGAATGG - Intronic
1009265484 6:61549581-61549603 AACATATAGCAATAGAAGGCAGG - Intergenic
1010249508 6:73693522-73693544 AACATGTAACAATAAGATATTGG - Intergenic
1011181260 6:84623897-84623919 AACATAAAGCAATATTATAAAGG - Intergenic
1011489535 6:87876137-87876159 GCCACATAGCAACATGAGATTGG - Intergenic
1011781506 6:90794908-90794930 AACATATTACAAAATGAAATTGG - Intergenic
1011816775 6:91200848-91200870 AATATGTATCAATATGAGGTAGG + Intergenic
1012707428 6:102549679-102549701 AAGAAAGAGAAATATGAGATGGG - Intergenic
1013206363 6:107949603-107949625 AACAAATAGCAAAATGACAGAGG + Intronic
1013902061 6:115168800-115168822 ATCATATAGGAGTATAAGATGGG + Intergenic
1014389170 6:120839685-120839707 AACATTGATCAGTATGAGATTGG + Intergenic
1014781912 6:125574490-125574512 AATATATGGCAAGAAGAGATAGG - Intergenic
1018738020 6:166703875-166703897 AAATTATAGAAATATGAAATGGG + Intronic
1021221747 7:17982448-17982470 AACATATTGAAAACTGAGATAGG - Intergenic
1021695416 7:23271430-23271452 AACATATTACCTTATGAGATAGG - Intronic
1022871297 7:34482807-34482829 AGGATATGGCAATAGGAGATGGG - Intergenic
1022964603 7:35460952-35460974 AACATATAAGAAGATGAGCTTGG + Intergenic
1027305395 7:76890314-76890336 AACAAATAGCAATATAATAAAGG - Intergenic
1027565028 7:79780756-79780778 AATAGATAGCCCTATGAGATAGG + Intergenic
1030307403 7:108033009-108033031 AACACATAAAAATATTAGATTGG - Intronic
1031818161 7:126466474-126466496 TACATATATCAATAGGAAATTGG - Intronic
1032774234 7:135093895-135093917 AACATATAGATAAATGAAATAGG + Intronic
1036387289 8:8293490-8293512 AACCTATAGCTATATGCAATGGG - Intergenic
1039624452 8:39033440-39033462 AAGGTAAAGCAATATCAGATTGG - Intronic
1042145009 8:65719082-65719104 AACATACAGCAATATGAATTTGG - Exonic
1042194083 8:66216837-66216859 AACATATATACATATGTGATAGG + Intergenic
1042228626 8:66535108-66535130 AACCTATGGTAATCTGAGATAGG - Intergenic
1043255233 8:78127660-78127682 AAAATATTGAAATATAAGATTGG + Intergenic
1044079915 8:87870497-87870519 TATATATAGCATTTTGAGATTGG + Intergenic
1044476173 8:92628984-92629006 AACATATAACAATGTGATATAGG - Intergenic
1044966717 8:97580957-97580979 AGCATATAGCCATATTTGATTGG - Intergenic
1044972841 8:97636707-97636729 AAAATATGGCAAAAGGAGATGGG - Intergenic
1046544296 8:115629001-115629023 GACATAAAGCCAAATGAGATTGG - Intronic
1047736851 8:127773272-127773294 CACATATATAAATATGAAATGGG + Intergenic
1055213298 9:73826009-73826031 AAAATATAAAAATATGAAATAGG - Intergenic
1057786416 9:98091218-98091240 AACATCCAACATTATGAGATTGG + Intronic
1058333590 9:103796895-103796917 AACATATATCAATATGCCAGAGG + Intergenic
1058511198 9:105719307-105719329 AACATATCACAAAATGAGAGAGG - Intronic
1059233123 9:112739955-112739977 ATCACATTTCAATATGAGATTGG - Intergenic
1059536947 9:115089806-115089828 CACAAAGAGCAATAAGAGATAGG - Intronic
1185965997 X:4603642-4603664 AACAATTAGCAATATCAGAAGGG - Intergenic
1188183395 X:27084350-27084372 AAATTATAGCAATGTGATATTGG - Intergenic
1188252451 X:27914340-27914362 AAGATATAGCAATAAAAGATTGG + Intergenic
1191113149 X:56823140-56823162 AACATATGGCAGTAAGAAATAGG + Intergenic
1192888277 X:75360755-75360777 GAAATAAAGCAAGATGAGATAGG - Intergenic
1193350669 X:80461273-80461295 AATATATATATATATGAGATTGG + Intergenic
1193508435 X:82371182-82371204 AACATTTGGCAACATGTGATGGG - Intergenic
1194585830 X:95733143-95733165 AAAATATAACAATTTGAGATGGG + Intergenic
1194667794 X:96694704-96694726 AACATATAGAAAGTTAAGATGGG + Intronic
1194681205 X:96855806-96855828 AAAATATATAAATCTGAGATTGG + Intronic
1194989997 X:100537093-100537115 ATCATATAGCACTATGACAGAGG + Intergenic
1198759693 X:140018389-140018411 AACATACACCACTATGACATGGG - Intergenic
1198982986 X:142420434-142420456 AAAAAATAGAAATATGAGAAAGG - Intergenic
1200871725 Y:8107068-8107090 AAAATATAAAAATATGAGACTGG + Intergenic
1201386188 Y:13441924-13441946 AAGATATAGAAATAGGGGATTGG + Intronic