ID: 960906461

View in Genome Browser
Species Human (GRCh38)
Location 3:122606590-122606612
Sequence GTCAACTATAGGAGGAATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 158}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960906461_960906469 21 Left 960906461 3:122606590-122606612 CCTATATTCCTCCTATAGTTGAC 0: 1
1: 0
2: 0
3: 9
4: 158
Right 960906469 3:122606634-122606656 CTGCAGATCATAATCATCCGGGG 0: 1
1: 0
2: 2
3: 15
4: 174
960906461_960906464 -2 Left 960906461 3:122606590-122606612 CCTATATTCCTCCTATAGTTGAC 0: 1
1: 0
2: 0
3: 9
4: 158
Right 960906464 3:122606611-122606633 ACATCCATCGTGCTCAATCCTGG 0: 1
1: 0
2: 0
3: 3
4: 57
960906461_960906467 19 Left 960906461 3:122606590-122606612 CCTATATTCCTCCTATAGTTGAC 0: 1
1: 0
2: 0
3: 9
4: 158
Right 960906467 3:122606632-122606654 GGCTGCAGATCATAATCATCCGG 0: 1
1: 1
2: 6
3: 97
4: 484
960906461_960906470 22 Left 960906461 3:122606590-122606612 CCTATATTCCTCCTATAGTTGAC 0: 1
1: 0
2: 0
3: 9
4: 158
Right 960906470 3:122606635-122606657 TGCAGATCATAATCATCCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 79
960906461_960906468 20 Left 960906461 3:122606590-122606612 CCTATATTCCTCCTATAGTTGAC 0: 1
1: 0
2: 0
3: 9
4: 158
Right 960906468 3:122606633-122606655 GCTGCAGATCATAATCATCCGGG 0: 1
1: 0
2: 2
3: 27
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960906461 Original CRISPR GTCAACTATAGGAGGAATAT AGG (reversed) Intronic
902204604 1:14858742-14858764 TGCAAATATAGGAGGAATTTGGG - Intronic
904934095 1:34114395-34114417 CTCAACTAAAGGAAGAAAATAGG + Intronic
905331604 1:37205435-37205457 ATCAATAATAGGAGGAATCTTGG + Intergenic
906764470 1:48414860-48414882 GTCAGATATGGCAGGAATATTGG + Intronic
908279345 1:62515020-62515042 ATCCACTATAGAAGGAAGATTGG - Intronic
909597687 1:77424222-77424244 GTCATATATAGCAGGAATGTGGG + Intronic
909823393 1:80094937-80094959 ATCAACAATAGGAGGAATTTTGG - Intergenic
911241105 1:95467887-95467909 ATCAACAAGAGGAGGAATTTTGG - Intergenic
911500850 1:98682654-98682676 GTAAAATAAAGGAGGAATCTTGG - Intronic
911539078 1:99136982-99137004 GTTATCTATAGGAGGAATTGGGG - Intergenic
912024224 1:105146769-105146791 CTCAACGATAGGAGGAAGAGGGG + Intergenic
918418019 1:184332451-184332473 GTGAACCAAAGGAGGAATAAAGG - Intergenic
921795944 1:219344964-219344986 GTCACATATAGGATAAATATGGG - Intergenic
922805795 1:228388398-228388420 GTCAACAATAGAAGGAAACTTGG + Intergenic
1065287420 10:24199594-24199616 GTCAACTGTAGGCTGAATTTGGG - Intronic
1065415266 10:25478153-25478175 TTCAACTAAAGGAAGATTATTGG - Intronic
1067273561 10:44814155-44814177 ATCAAGTATAGGAGGAATGCAGG - Intergenic
1071786138 10:88902403-88902425 GTCATCAAGAGGAGGAAAATGGG - Intronic
1073170638 10:101504904-101504926 GTCAAATATTTGAAGAATATGGG - Intronic
1075176161 10:120163061-120163083 GCCAACTATCGGAGGCAGATTGG - Intergenic
1075600427 10:123763637-123763659 TTCAACAATAGGATGAATCTGGG - Intronic
1078488474 11:11746462-11746484 GTCTATTTTATGAGGAATATTGG - Intergenic
1083230048 11:61311497-61311519 GTCGAATAGAGGAGGAACATGGG - Intronic
1083400909 11:62422926-62422948 GTCAACTCTAGGAGGAACTAAGG - Intronic
1087638561 11:100730964-100730986 GTCAACAATAGGCTGCATATAGG - Intronic
1087932496 11:103994019-103994041 GTCAATTTTAAGTGGAATATTGG - Intronic
1092921280 12:13233677-13233699 GTAAAGTATAGCAGGAATAGTGG - Intergenic
1093612559 12:21180195-21180217 TTCATCAAAAGGAGGAATATAGG - Intronic
1094370614 12:29733593-29733615 GTTAATTCTAGAAGGAATATTGG - Intronic
1094726319 12:33120668-33120690 ATCAATTACAAGAGGAATATTGG - Intergenic
1095325023 12:40879311-40879333 CTTAACTGTAGGAAGAATATTGG - Intronic
1095389672 12:41690427-41690449 GTCAGATATAGCAGGAATGTTGG + Intergenic
1096964664 12:55616547-55616569 GTGAAGTATAGAAGGAACATTGG - Intergenic
1097690836 12:62733222-62733244 ATCAACTATGAGAGGAAAATAGG - Intronic
1097754582 12:63395533-63395555 GTCACTTATAGGAGGAAGTTTGG - Intergenic
1098207139 12:68123161-68123183 ATCAATAATAGGAGGAATTTTGG - Intergenic
1098291909 12:68964562-68964584 GTTATCTATAGGAGCAATAGGGG - Intronic
1098711134 12:73763808-73763830 ATCAACAATAGGAGGAATACTGG - Intergenic
1100398586 12:94206761-94206783 GCCAAGAATAGGAGGAAAATTGG - Intronic
1103413738 12:120730550-120730572 CTCATCTGTAAGAGGAATATGGG + Intronic
1107269444 13:38597602-38597624 GTTAACTATAGGATGTAGATAGG + Intergenic
1111272711 13:85908134-85908156 GTCAACTTTAGGACAACTATAGG - Intergenic
1111691887 13:91574474-91574496 GTCAACAATAGGAACAATAAGGG + Intronic
1115876338 14:37865953-37865975 GTCATCTATAGGGAGAAAATTGG + Intronic
1116140616 14:40989197-40989219 ATCAACAACAAGAGGAATATTGG - Intergenic
1118573804 14:67221376-67221398 GTCAACTATGTTGGGAATATAGG - Intronic
1119139825 14:72256408-72256430 GTTATCTATAGGAGCAATTTGGG + Intronic
1120698670 14:87673442-87673464 GTAAACTATAGAAAGAATCTGGG + Intergenic
1123830473 15:24131024-24131046 GGCATCTATAGTAGAAATATGGG + Intergenic
1123841334 15:24250479-24250501 GGCATCTATAGCAGAAATATGGG + Intergenic
1123850725 15:24353628-24353650 GGCATCTATAGCAGAAATATGGG + Intergenic
1123855604 15:24407862-24407884 GGCATCTATAGCAGAAATATGGG + Intergenic
1126049728 15:44674994-44675016 GTCAACTATAGTCTGAAAATAGG - Intronic
1127042027 15:54987802-54987824 GTTAACTATAGGAGCAATTGGGG + Intergenic
1127982094 15:64042706-64042728 GTCAACTTTGGCTGGAATATAGG - Intronic
1128203385 15:65829292-65829314 GTCAGCTATAGGATAAACATGGG - Intronic
1131657157 15:94473571-94473593 CTCTACAATAGAAGGAATATGGG - Intronic
1131699874 15:94923047-94923069 GTCAATTCTAGCAGGTATATGGG - Intergenic
1133708182 16:8375607-8375629 GTCAACTAAAGGAGAAGTAAAGG + Intergenic
1135794863 16:25432136-25432158 GCCCACTATTGGAGGAATTTGGG + Intergenic
1143627228 17:8117592-8117614 GTCAATTATGGGAGGAGTTTAGG + Intronic
1144416655 17:15054170-15054192 GTAAAGTATAGAAGGAACATTGG - Intergenic
1146013905 17:29217418-29217440 GTCAACTGCAGGAGGAAACTGGG + Intergenic
1153297768 18:3564043-3564065 GTCAAATATGGCAGGAATGTTGG - Intronic
1156040810 18:32820112-32820134 GTCAATCTTAGGAGGACTATAGG + Intergenic
1158971350 18:62669891-62669913 ATCAACTACAGGAGGAAAACTGG - Intergenic
1159141702 18:64403927-64403949 TTCACCTTTAGGAGGGATATAGG + Intergenic
1159411905 18:68088252-68088274 GTGTAATATAGGAGAAATATGGG - Intergenic
1168592166 19:57646394-57646416 GTCAACTATGTGAGGTATAGGGG - Intergenic
925239247 2:2308377-2308399 GTGAAGTATAGGTGGAGTATGGG - Intronic
928696002 2:33850995-33851017 GTCAGCTATAGGGGGAAGAGGGG - Intergenic
928847546 2:35695896-35695918 ATCAACAATAAGAGGAATTTTGG - Intergenic
931488646 2:62720322-62720344 GACAACTATGGCAGTAATATAGG - Intronic
932088780 2:68786332-68786354 GTCAAATTTAGGAGCAATATGGG + Intronic
937460022 2:122077588-122077610 GGCAATTATATGAGGACTATGGG - Intergenic
937492854 2:122388055-122388077 GTTATCTCTAGGAGCAATATGGG - Intergenic
938035437 2:128030917-128030939 GCCTACTCCAGGAGGAATATGGG - Intergenic
938453104 2:131441483-131441505 GACAACTATGGGAAGAATTTGGG + Intergenic
940049301 2:149445046-149445068 ATCAACTACAGGAGGGATGTTGG + Intronic
941798398 2:169627011-169627033 ATTAACTATAAGAGGAAAATAGG - Intronic
947093902 2:226544672-226544694 GTGACCTATAGGAGCAATCTGGG - Intergenic
947300678 2:228684963-228684985 GTTAAATATGGCAGGAATATTGG + Intergenic
947494737 2:230626630-230626652 GTCAGCCATGGTAGGAATATTGG + Intergenic
948052311 2:234987997-234988019 GTCAACTCTAGGAGAACTCTGGG - Intronic
1168977046 20:1974575-1974597 ATCAAAGATTGGAGGAATATGGG + Intergenic
1169882087 20:10357792-10357814 GTCAAATATAGCTTGAATATAGG + Intergenic
1170733328 20:18992568-18992590 GTTATCTATAGGAGCAATCTGGG - Intergenic
1174643987 20:52070018-52070040 GTAAACTATAGATGGAATCTGGG + Intronic
1175673198 20:60923985-60924007 GCCAACTAAAGGAGCAATAAAGG - Intergenic
1180571475 22:16725684-16725706 GTCATCTATAGAAAGATTATGGG - Intergenic
1184085014 22:42256116-42256138 ATCAAGTATGGGAAGAATATTGG - Intronic
950785711 3:15433376-15433398 ATCAGATATTGGAGGAATATCGG - Intronic
950820714 3:15755219-15755241 GTCAACTATATGAGAAATCAGGG + Intronic
952992202 3:38841446-38841468 TTTAAGTATAGGAGGTATATTGG - Intergenic
953193123 3:40708248-40708270 GTCAGATATAGCAGAAATATTGG - Intergenic
953386907 3:42511827-42511849 CTCAAGTATAGGGGGAATAGTGG - Intronic
957106719 3:75898783-75898805 GTCATCTATAGAAAGATTATGGG + Intergenic
960906461 3:122606590-122606612 GTCAACTATAGGAGGAATATAGG - Intronic
961256304 3:125556506-125556528 GTCAGCTACAGGAGGAATGTGGG - Intronic
964398132 3:156269297-156269319 GTCAACAACAAGAGGAATTTTGG - Intronic
967310268 3:188099292-188099314 GTCAATTATAGGAGGATTAATGG - Intergenic
967775671 3:193383536-193383558 CTCCACTATAGGAGGAATAATGG + Intergenic
970540470 4:17073325-17073347 GGCAACTATTGGAGGGATATTGG - Intergenic
971814023 4:31463973-31463995 GTCAACTATAGCATTAATAGTGG - Intergenic
974320812 4:60347232-60347254 TTCAACTCTAGTAGGAATAGAGG + Intergenic
976364046 4:84213539-84213561 ATAAACTATAGGATCAATATTGG - Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
976965617 4:91036776-91036798 GTGAACTATAGTGGGAAAATAGG + Intronic
978371182 4:108030683-108030705 GTCAACTTTAGGAGGTTCATTGG - Intronic
978732836 4:112050150-112050172 GTTAACTTTAGGAGGCATACAGG + Intergenic
979974733 4:127182995-127183017 GTCAATAATAAGAGGAATTTTGG + Intergenic
981217720 4:142191163-142191185 GTAGACTAAAGGAGGTATATTGG + Intronic
984422284 4:179538906-179538928 GTAGACTATAGAAGGAATCTTGG - Intergenic
984902014 4:184593870-184593892 GTCAACTATAGGTTGAAAATTGG - Intergenic
987706450 5:21466129-21466151 GTCTACTAGATGAGGAACATTGG + Intergenic
988029865 5:25750383-25750405 GTCAAGTATTGGAATAATATTGG - Intergenic
995322370 5:110850782-110850804 GTCAACAACAAGAGGAATTTTGG - Intergenic
995636105 5:114192749-114192771 ATCTACTATGGGAAGAATATAGG - Intergenic
997029011 5:130100553-130100575 TTCAACTTTAGGTGGAATCTAGG - Intronic
998961470 5:147491457-147491479 GTCAGCTATGGCAGGAATGTTGG + Intronic
1007188500 6:39993794-39993816 GTCAACTATAGAAGCAATTGTGG - Intergenic
1010512918 6:76742993-76743015 GTTATCTATAGGAGGAATTATGG - Intergenic
1011531852 6:88331650-88331672 TTAAAATATTGGAGGAATATGGG + Intergenic
1012314080 6:97763237-97763259 GCAAGCTATAGGAGGAGTATGGG - Intergenic
1014338161 6:120166011-120166033 GAAAACTGTAGGAGAAATATAGG - Intergenic
1014834440 6:126145057-126145079 GGTAACTATAGGAAGAAAATAGG + Intergenic
1015257373 6:131194340-131194362 GTCAATAATAAGAGGAATTTGGG - Intronic
1015887841 6:137938279-137938301 CTCAATTATAGGAAGAAAATTGG - Intergenic
1016710650 6:147167676-147167698 ATCAATTATTTGAGGAATATTGG - Intergenic
1020705329 7:11537096-11537118 GTTAGCACTAGGAGGAATATGGG - Intronic
1020919916 7:14250459-14250481 GTCAATAACAGGAAGAATATTGG - Intronic
1021124005 7:16829503-16829525 ATCAACAACAGGAGGAATTTTGG + Intronic
1021190529 7:17614243-17614265 ATCAATAATAGGAGGAAAATTGG + Intergenic
1024695820 7:51855726-51855748 GTTACCTATAGGAGCAATAAAGG + Intergenic
1026657743 7:72272077-72272099 GTCATCTAGAGGAGGCAAATAGG + Intronic
1033612325 7:142975752-142975774 TTCAGCTATATGAGGATTATTGG - Intergenic
1035183411 7:157107462-157107484 GTTATCTATAGGAGCAATTTGGG - Intergenic
1036464647 8:8985255-8985277 GTCAACTACAGAAGGAATTATGG + Intergenic
1037671683 8:21020494-21020516 GCCAACTATAAGAGGAAAAATGG - Intergenic
1042798890 8:72696057-72696079 GTCATCTATTGGAGGCAGATTGG + Intronic
1043320134 8:78974243-78974265 TTCAACTATAGGAGGAAGGAAGG + Intergenic
1043499951 8:80843088-80843110 GCCAAATATATGAGAAATATTGG - Intronic
1044177194 8:89141838-89141860 GTCTACTTTATGAGGGATATTGG + Intergenic
1046447637 8:114344050-114344072 TTTAACTATTGGAGCAATATCGG - Intergenic
1046833478 8:118774030-118774052 GACAACTATAATGGGAATATTGG + Intergenic
1047669172 8:127126003-127126025 GTCAACTAGAGTCGGAATCTTGG - Intergenic
1047933898 8:129756737-129756759 ATCAACAATAAGAGGAATTTTGG + Intronic
1048233941 8:132672752-132672774 TTCAACTAAAGGAGAAATTTGGG - Intronic
1050062189 9:1721050-1721072 GACACCTATAGGATGAATCTTGG + Intergenic
1050220410 9:3382361-3382383 GTCAACTATAATATGAATTTGGG + Intronic
1053570707 9:39302540-39302562 GTCAAGTATGGCAGGAATGTTGG + Intergenic
1054092329 9:60861558-60861580 GTCAAGTATGGCAGGAATGTTGG + Intergenic
1054113742 9:61137151-61137173 GTCAAGTATGGCAGGAATGTTGG + Intergenic
1054126438 9:61316472-61316494 GTCAAGTATGGCAGGAATGTTGG - Intergenic
1054593953 9:67045037-67045059 GTCAAGTATGGCAGGAATGTTGG - Intergenic
1055790057 9:79914068-79914090 GTCAAGTATTCCAGGAATATTGG + Intergenic
1058512420 9:105734250-105734272 ATCAACAACAGGAGGAATTTTGG - Intronic
1058537165 9:105973746-105973768 GTAAATTATAGAAGGAACATTGG + Intergenic
1062701981 9:137911717-137911739 GTCAAAAATAGGATAAATATCGG - Intronic
1188594930 X:31888319-31888341 GTCAACTACAGAAGCAATACAGG - Intronic
1192251807 X:69419948-69419970 GTCAGATATGGCAGGAATATTGG - Intergenic
1192388576 X:70699972-70699994 TTTAACTATAGGAGGAAACTGGG - Intronic
1193756403 X:85414530-85414552 GTCAATAACAAGAGGAATATTGG - Intergenic
1195214195 X:102681621-102681643 ATCAACAACAGGAGGAATCTTGG - Intergenic
1195823769 X:108974625-108974647 ATCAACAACAGGAGGAATTTTGG + Intergenic
1197100965 X:122654645-122654667 ATCAATAATAGGAGGAATTTTGG + Intergenic
1197364072 X:125542577-125542599 GTCAACAATTTGAGGAAAATTGG + Intergenic
1200467578 Y:3539073-3539095 ATCAATAACAGGAGGAATATTGG + Intergenic