ID: 960907995

View in Genome Browser
Species Human (GRCh38)
Location 3:122620781-122620803
Sequence TGCTCCTCAGGAGGGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 499}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960907986_960907995 1 Left 960907986 3:122620757-122620779 CCCTAGGGAGTGCCTGGTCATGG 0: 1
1: 0
2: 1
3: 12
4: 100
Right 960907995 3:122620781-122620803 TGCTCCTCAGGAGGGCAGGATGG 0: 1
1: 0
2: 2
3: 39
4: 499
960907983_960907995 10 Left 960907983 3:122620748-122620770 CCCGAGGGGCCCTAGGGAGTGCC 0: 1
1: 0
2: 1
3: 15
4: 141
Right 960907995 3:122620781-122620803 TGCTCCTCAGGAGGGCAGGATGG 0: 1
1: 0
2: 2
3: 39
4: 499
960907984_960907995 9 Left 960907984 3:122620749-122620771 CCGAGGGGCCCTAGGGAGTGCCT 0: 1
1: 0
2: 1
3: 12
4: 143
Right 960907995 3:122620781-122620803 TGCTCCTCAGGAGGGCAGGATGG 0: 1
1: 0
2: 2
3: 39
4: 499
960907988_960907995 0 Left 960907988 3:122620758-122620780 CCTAGGGAGTGCCTGGTCATGGG 0: 1
1: 0
2: 1
3: 12
4: 196
Right 960907995 3:122620781-122620803 TGCTCCTCAGGAGGGCAGGATGG 0: 1
1: 0
2: 2
3: 39
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960907995 Original CRISPR TGCTCCTCAGGAGGGCAGGA TGG Intronic