ID: 960914265

View in Genome Browser
Species Human (GRCh38)
Location 3:122680862-122680884
Sequence TCCTCAGCTCCGCTCTCCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 156}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960914265_960914278 23 Left 960914265 3:122680862-122680884 CCGGCGGAGAGCGGAGCTGAGGA 0: 1
1: 0
2: 3
3: 13
4: 156
Right 960914278 3:122680908-122680930 CTGCTGGTCGAGGGCTCCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 147
960914265_960914268 7 Left 960914265 3:122680862-122680884 CCGGCGGAGAGCGGAGCTGAGGA 0: 1
1: 0
2: 3
3: 13
4: 156
Right 960914268 3:122680892-122680914 GCCCGGCTCCTTCCCGCTGCTGG 0: 1
1: 0
2: 4
3: 21
4: 259
960914265_960914271 13 Left 960914265 3:122680862-122680884 CCGGCGGAGAGCGGAGCTGAGGA 0: 1
1: 0
2: 3
3: 13
4: 156
Right 960914271 3:122680898-122680920 CTCCTTCCCGCTGCTGGTCGAGG 0: 1
1: 0
2: 0
3: 9
4: 169
960914265_960914272 14 Left 960914265 3:122680862-122680884 CCGGCGGAGAGCGGAGCTGAGGA 0: 1
1: 0
2: 3
3: 13
4: 156
Right 960914272 3:122680899-122680921 TCCTTCCCGCTGCTGGTCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 100
960914265_960914267 -10 Left 960914265 3:122680862-122680884 CCGGCGGAGAGCGGAGCTGAGGA 0: 1
1: 0
2: 3
3: 13
4: 156
Right 960914267 3:122680875-122680897 GAGCTGAGGATGGCTGTGCCCGG 0: 1
1: 2
2: 3
3: 44
4: 364
960914265_960914276 21 Left 960914265 3:122680862-122680884 CCGGCGGAGAGCGGAGCTGAGGA 0: 1
1: 0
2: 3
3: 13
4: 156
Right 960914276 3:122680906-122680928 CGCTGCTGGTCGAGGGCTCCTGG 0: 1
1: 0
2: 1
3: 13
4: 181
960914265_960914277 22 Left 960914265 3:122680862-122680884 CCGGCGGAGAGCGGAGCTGAGGA 0: 1
1: 0
2: 3
3: 13
4: 156
Right 960914277 3:122680907-122680929 GCTGCTGGTCGAGGGCTCCTGGG 0: 1
1: 0
2: 1
3: 12
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960914265 Original CRISPR TCCTCAGCTCCGCTCTCCGC CGG (reversed) Exonic