ID: 960914269

View in Genome Browser
Species Human (GRCh38)
Location 3:122680893-122680915
Sequence ACCAGCAGCGGGAAGGAGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 562
Summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 508}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960914269_960914277 -9 Left 960914269 3:122680893-122680915 CCCGGCTCCTTCCCGCTGCTGGT 0: 1
1: 0
2: 5
3: 48
4: 508
Right 960914277 3:122680907-122680929 GCTGCTGGTCGAGGGCTCCTGGG 0: 1
1: 0
2: 1
3: 12
4: 215
960914269_960914278 -8 Left 960914269 3:122680893-122680915 CCCGGCTCCTTCCCGCTGCTGGT 0: 1
1: 0
2: 5
3: 48
4: 508
Right 960914278 3:122680908-122680930 CTGCTGGTCGAGGGCTCCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 147
960914269_960914276 -10 Left 960914269 3:122680893-122680915 CCCGGCTCCTTCCCGCTGCTGGT 0: 1
1: 0
2: 5
3: 48
4: 508
Right 960914276 3:122680906-122680928 CGCTGCTGGTCGAGGGCTCCTGG 0: 1
1: 0
2: 1
3: 13
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960914269 Original CRISPR ACCAGCAGCGGGAAGGAGCC GGG (reversed) Exonic