ID: 960914270

View in Genome Browser
Species Human (GRCh38)
Location 3:122680894-122680916
Sequence GACCAGCAGCGGGAAGGAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 344}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960914270_960914277 -10 Left 960914270 3:122680894-122680916 CCGGCTCCTTCCCGCTGCTGGTC 0: 1
1: 0
2: 2
3: 26
4: 344
Right 960914277 3:122680907-122680929 GCTGCTGGTCGAGGGCTCCTGGG 0: 1
1: 0
2: 1
3: 12
4: 215
960914270_960914278 -9 Left 960914270 3:122680894-122680916 CCGGCTCCTTCCCGCTGCTGGTC 0: 1
1: 0
2: 2
3: 26
4: 344
Right 960914278 3:122680908-122680930 CTGCTGGTCGAGGGCTCCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960914270 Original CRISPR GACCAGCAGCGGGAAGGAGC CGG (reversed) Exonic