ID: 960914276

View in Genome Browser
Species Human (GRCh38)
Location 3:122680906-122680928
Sequence CGCTGCTGGTCGAGGGCTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 181}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960914269_960914276 -10 Left 960914269 3:122680893-122680915 CCCGGCTCCTTCCCGCTGCTGGT 0: 1
1: 0
2: 5
3: 48
4: 508
Right 960914276 3:122680906-122680928 CGCTGCTGGTCGAGGGCTCCTGG 0: 1
1: 0
2: 1
3: 13
4: 181
960914265_960914276 21 Left 960914265 3:122680862-122680884 CCGGCGGAGAGCGGAGCTGAGGA 0: 1
1: 0
2: 3
3: 13
4: 156
Right 960914276 3:122680906-122680928 CGCTGCTGGTCGAGGGCTCCTGG 0: 1
1: 0
2: 1
3: 13
4: 181
960914263_960914276 29 Left 960914263 3:122680854-122680876 CCTGCAGTCCGGCGGAGAGCGGA 0: 1
1: 0
2: 0
3: 1
4: 45
Right 960914276 3:122680906-122680928 CGCTGCTGGTCGAGGGCTCCTGG 0: 1
1: 0
2: 1
3: 13
4: 181
960914261_960914276 30 Left 960914261 3:122680853-122680875 CCCTGCAGTCCGGCGGAGAGCGG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 960914276 3:122680906-122680928 CGCTGCTGGTCGAGGGCTCCTGG 0: 1
1: 0
2: 1
3: 13
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960914276 Original CRISPR CGCTGCTGGTCGAGGGCTCC TGG Exonic