ID: 960914277

View in Genome Browser
Species Human (GRCh38)
Location 3:122680907-122680929
Sequence GCTGCTGGTCGAGGGCTCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960914265_960914277 22 Left 960914265 3:122680862-122680884 CCGGCGGAGAGCGGAGCTGAGGA 0: 1
1: 0
2: 3
3: 13
4: 156
Right 960914277 3:122680907-122680929 GCTGCTGGTCGAGGGCTCCTGGG 0: 1
1: 0
2: 1
3: 12
4: 215
960914269_960914277 -9 Left 960914269 3:122680893-122680915 CCCGGCTCCTTCCCGCTGCTGGT 0: 1
1: 0
2: 5
3: 48
4: 508
Right 960914277 3:122680907-122680929 GCTGCTGGTCGAGGGCTCCTGGG 0: 1
1: 0
2: 1
3: 12
4: 215
960914263_960914277 30 Left 960914263 3:122680854-122680876 CCTGCAGTCCGGCGGAGAGCGGA 0: 1
1: 0
2: 0
3: 1
4: 45
Right 960914277 3:122680907-122680929 GCTGCTGGTCGAGGGCTCCTGGG 0: 1
1: 0
2: 1
3: 12
4: 215
960914270_960914277 -10 Left 960914270 3:122680894-122680916 CCGGCTCCTTCCCGCTGCTGGTC 0: 1
1: 0
2: 2
3: 26
4: 344
Right 960914277 3:122680907-122680929 GCTGCTGGTCGAGGGCTCCTGGG 0: 1
1: 0
2: 1
3: 12
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960914277 Original CRISPR GCTGCTGGTCGAGGGCTCCT GGG Exonic