ID: 960914278

View in Genome Browser
Species Human (GRCh38)
Location 3:122680908-122680930
Sequence CTGCTGGTCGAGGGCTCCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960914265_960914278 23 Left 960914265 3:122680862-122680884 CCGGCGGAGAGCGGAGCTGAGGA 0: 1
1: 0
2: 3
3: 13
4: 156
Right 960914278 3:122680908-122680930 CTGCTGGTCGAGGGCTCCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 147
960914269_960914278 -8 Left 960914269 3:122680893-122680915 CCCGGCTCCTTCCCGCTGCTGGT 0: 1
1: 0
2: 5
3: 48
4: 508
Right 960914278 3:122680908-122680930 CTGCTGGTCGAGGGCTCCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 147
960914270_960914278 -9 Left 960914270 3:122680894-122680916 CCGGCTCCTTCCCGCTGCTGGTC 0: 1
1: 0
2: 2
3: 26
4: 344
Right 960914278 3:122680908-122680930 CTGCTGGTCGAGGGCTCCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960914278 Original CRISPR CTGCTGGTCGAGGGCTCCTG GGG Exonic