ID: 960915107

View in Genome Browser
Species Human (GRCh38)
Location 3:122686954-122686976
Sequence ATAATGAAAAGGTCTGATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 284}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960915107_960915116 16 Left 960915107 3:122686954-122686976 CCCTTATCAGACCTTTTCATTAT 0: 1
1: 0
2: 1
3: 34
4: 284
Right 960915116 3:122686993-122687015 CCATCTCCAGGCTGGTCCCAGGG 0: 1
1: 0
2: 7
3: 31
4: 317
960915107_960915110 4 Left 960915107 3:122686954-122686976 CCCTTATCAGACCTTTTCATTAT 0: 1
1: 0
2: 1
3: 34
4: 284
Right 960915110 3:122686981-122687003 TCTATTTACCCTCCATCTCCAGG 0: 1
1: 0
2: 1
3: 28
4: 567
960915107_960915111 8 Left 960915107 3:122686954-122686976 CCCTTATCAGACCTTTTCATTAT 0: 1
1: 0
2: 1
3: 34
4: 284
Right 960915111 3:122686985-122687007 TTTACCCTCCATCTCCAGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 200
960915107_960915114 15 Left 960915107 3:122686954-122686976 CCCTTATCAGACCTTTTCATTAT 0: 1
1: 0
2: 1
3: 34
4: 284
Right 960915114 3:122686992-122687014 TCCATCTCCAGGCTGGTCCCAGG 0: 1
1: 0
2: 3
3: 41
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960915107 Original CRISPR ATAATGAAAAGGTCTGATAA GGG (reversed) Intronic
900040493 1:458615-458637 AGAATGAAAAGGGCTGAGAAGGG + Intergenic
900061923 1:693586-693608 AGAATGAAAAGGGCTGAGAAGGG + Intergenic
902713910 1:18259456-18259478 ATAAAGAAGAGGTCTGAAAAAGG + Intronic
905959368 1:42030899-42030921 ATAATGAAAAAGTTTTAAAAGGG + Intronic
906226308 1:44125107-44125129 ATAAGAAAAATTTCTGATAAGGG - Intronic
906529350 1:46514569-46514591 ATCATGAAAAGGTATGAAAATGG - Intergenic
908028992 1:59980169-59980191 ACACTGAACAGGTCTCATAATGG - Intergenic
908635335 1:66157533-66157555 ATTATGAGAAGGTCTGGTAGAGG - Intronic
909029549 1:70523587-70523609 ATAATGAAGATGTCTGGTGAAGG - Intergenic
910934616 1:92477239-92477261 ATAACGTAAATGTTTGATAAGGG + Intronic
911311933 1:96304041-96304063 TTTATGAAAAGCTCTGAAAATGG - Intergenic
911436290 1:97863286-97863308 ATAAAGTAAAGGTCTGAAAAAGG + Intronic
911956234 1:104238656-104238678 AGAATGAAATGGTCTGCCAAAGG - Intergenic
913019354 1:114771752-114771774 AAAATGAAAAAGTCTGGTACAGG - Exonic
913357573 1:117940346-117940368 CTACTGAAGAGGTTTGATAAGGG + Intronic
914374363 1:147060774-147060796 ATGAAGAAAAGCTCTGATATGGG - Intergenic
915161868 1:153926231-153926253 ATAATGCAATGGACTGATAATGG - Intergenic
916900716 1:169219553-169219575 ATAATTATAAGATATGATAAAGG - Intronic
917875549 1:179283542-179283564 AAAATGAAAAAGTCTGGGAAAGG + Intergenic
918365540 1:183804382-183804404 ATAATGGAAAGATCTGCTATAGG - Intronic
920156972 1:203960558-203960580 ATAAAGACAAGCTCTGAGAATGG - Intergenic
921724093 1:218505488-218505510 AGTTAGAAAAGGTCTGATAAGGG + Intergenic
922355940 1:224775119-224775141 ATAATGAATTGATTTGATAATGG - Intergenic
923294081 1:232576058-232576080 AAGATGAAGAGGTCTGAAAATGG + Intergenic
923782436 1:237037007-237037029 ATATTGAAAAGGTATGTTTAAGG + Intergenic
923936578 1:238767403-238767425 ATAATGAGGAGTTCTGCTAACGG + Intergenic
923970962 1:239202801-239202823 AAAATGAAAAGGTGGAATAAGGG + Intergenic
924254731 1:242170846-242170868 AGAATGAAAAGGAATGAAAAAGG + Intronic
924738027 1:246776834-246776856 ATAAAGAAAACGTTTGTTAAGGG + Intergenic
1064710202 10:18115320-18115342 ATAATGAAAAGGTCAGCCACTGG + Intergenic
1064740146 10:18424582-18424604 ATAATGATAAACTCTGATAGAGG - Intronic
1064893454 10:20207155-20207177 AGAATGGAAAGGACTGAGAATGG - Intronic
1066448259 10:35504033-35504055 AAAATGAAATGGTATAATAAGGG - Intronic
1068016616 10:51524741-51524763 AAAATGAATAGGGATGATAAAGG + Intronic
1069801596 10:71085132-71085154 TTAATAAAAATGTCTGAAAATGG - Intergenic
1071025470 10:81107920-81107942 ATAATGAAATGCTCAGAAAATGG - Intergenic
1071049421 10:81428448-81428470 ATATTGAAAAGATCTGATTGGGG + Intergenic
1071082333 10:81827154-81827176 AGAATGAATATGTCTAATAAGGG - Intergenic
1071157160 10:82704028-82704050 ATTATGCAAAGGTAAGATAAAGG - Intronic
1071320071 10:84446065-84446087 ATAATGAAAAGAAATGAGAAAGG - Intronic
1072053565 10:91730381-91730403 TTAGTGAAAAGATCAGATAAAGG - Intergenic
1076966766 11:94838-94860 AGAATGAAAAGGGCTGAGAAGGG + Intergenic
1077987206 11:7365129-7365151 GAAATGAAAGGCTCTGATAATGG + Intronic
1079175823 11:18139365-18139387 ATAATGAAAAGTTTTTAAAAGGG + Intronic
1079179378 11:18175423-18175445 ATAATGCAAAGTTCTTAAAAGGG + Intronic
1079265888 11:18932607-18932629 ATAATGAAAAATTCTTAAAAGGG - Intergenic
1079515495 11:21263147-21263169 ATAATGAAGTGTTCTGTTAATGG + Intronic
1080081975 11:28231825-28231847 ATGATGAAAAGCTTGGATAAAGG - Intronic
1080112792 11:28587444-28587466 ATAATAAAAAGGTGTGATAATGG + Intergenic
1080134628 11:28840388-28840410 ATAATGAAAAAGTAAAATAAAGG + Intergenic
1080487244 11:32722173-32722195 ATGATGAAAATCACTGATAATGG - Intronic
1081150956 11:39631066-39631088 ATAATGAATAAATCTGAAAAGGG + Intergenic
1082650422 11:55784465-55784487 ATAATTAAAAGGAGTGATGATGG + Intergenic
1085089771 11:73701505-73701527 AAAATTAAAATATCTGATAAAGG - Intronic
1086275652 11:85125223-85125245 TTTATGTAAAGGTCTTATAAAGG + Intronic
1086886341 11:92210382-92210404 AAAATGATAAGGACTAATAATGG + Intergenic
1087366402 11:97225308-97225330 ATAATGAAAAGATCTCCTAAAGG + Intergenic
1087523794 11:99281139-99281161 AGAATTAAAAGATCTGATTAAGG + Intronic
1087953995 11:104260974-104260996 ATAATTAAAAGTTCTGGAAATGG - Intergenic
1088365483 11:109036080-109036102 ATAGTCAAAAAGTCTGAGAAGGG - Intergenic
1088838243 11:113597536-113597558 ATAAGGAAAAGGAAAGATAATGG + Intergenic
1091570212 12:1678450-1678472 ATAGGGATAAGGTCTGACAAAGG + Intergenic
1092576844 12:9793793-9793815 AAAAGGAAAAGTTCTAATAAAGG + Intergenic
1093368657 12:18337324-18337346 CTAATGAAAAGTTCTTAGAATGG + Intronic
1093663377 12:21783475-21783497 AAAATGAAAAGGTCTGAACTAGG - Intergenic
1096380481 12:51153503-51153525 ATGATGAAAAGTTCTGAAAATGG - Intronic
1098444737 12:70554812-70554834 ATAATGAAGAGGACTGAATAAGG + Intronic
1098515539 12:71372409-71372431 ATAATGCAGAAGTCTAATAATGG + Intronic
1100320833 12:93490703-93490725 AAAATGAAATGGTCTGACTAGGG - Intronic
1100830568 12:98513330-98513352 GTGATGAAAAGGACTGATCAGGG + Intergenic
1101363115 12:104046401-104046423 AGAATTAAGAGGTCTGCTAAGGG + Intronic
1101454979 12:104821991-104822013 AGAATGACATGGTCAGATAAGGG - Intronic
1101823261 12:108200622-108200644 AAAATGAAAAGGTGTTATAATGG - Intronic
1101986802 12:109453481-109453503 ATAAAGAAAAGGACTGAGCATGG - Intronic
1103732347 12:123036305-123036327 AGAGAGGAAAGGTCTGATAAAGG + Intronic
1104178905 12:126358829-126358851 AAAATGAAAAGGTATGTCAAGGG + Intergenic
1104508904 12:129357982-129358004 CTGATGAAAAGGTCAGAAAAAGG - Intronic
1106772424 13:32974731-32974753 ATGATGAAAAGTTCTGGAAATGG - Intergenic
1107340586 13:39400892-39400914 GTAGTGAAAAGGAATGATAAAGG - Intronic
1109189077 13:59304233-59304255 TTAATGAACAGGGCTGATATAGG - Intergenic
1109381369 13:61565108-61565130 ATCATGAAAATTTCAGATAATGG + Intergenic
1110945898 13:81416209-81416231 ATAATAACAAGGTTTGATGAGGG - Intergenic
1111133136 13:84001387-84001409 ATGATGAAAAGTTATTATAAAGG - Intergenic
1112607063 13:100916875-100916897 ATGATGAAAATGTCTGGGAATGG + Intergenic
1113080807 13:106517817-106517839 ATGGTGAAAAGATCTGATATTGG + Intronic
1113349905 13:109519115-109519137 ATAATGTAAAGATGTCATAATGG + Intergenic
1114679032 14:24468034-24468056 ATAATAAAACGGTCTTATAAAGG + Intergenic
1115470171 14:33760350-33760372 GCAATGAAAAGGACAGATAAAGG - Intronic
1116070885 14:40043868-40043890 ATCATGAAAAGGTCTTAAAAGGG - Intergenic
1116089618 14:40288260-40288282 ATTATGAAAAAGTCAGAAAATGG - Intergenic
1116226289 14:42156822-42156844 AAAATGAAAAGGTTTTAGAAAGG - Intergenic
1116799273 14:49426388-49426410 AAGATGAAAAGCTGTGATAATGG + Intergenic
1118174324 14:63422783-63422805 ATAGTGAATAAGCCTGATAAGGG - Intronic
1118361005 14:65056495-65056517 AAAAGGAAAAGGTCTGACTATGG - Intronic
1119707083 14:76789630-76789652 AAAATCAAAAGATCTTATAATGG - Intronic
1121080698 14:91105753-91105775 ATAAGGATAAGTTCTGAGAAAGG + Intronic
1122549786 14:102543719-102543741 AAAATAAAAAGGTCTGGGAAAGG - Intergenic
1129343176 15:74899432-74899454 GGAAAGAAAAGGTCTGCTAAAGG + Exonic
1130329990 15:82914607-82914629 ATGATGAAAAGTTCTGGAAATGG + Intronic
1130682175 15:86006487-86006509 ATAAGGAGAAGGACTGATGAAGG + Intergenic
1130801583 15:87269363-87269385 AAAAGCAAAAGATCTGATAATGG - Intergenic
1132441413 15:101869008-101869030 AGAATGAAAAGGGCTGAGAAGGG - Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133255893 16:4515526-4515548 ATAATTCATAGATCTGATAAAGG + Intronic
1133471759 16:6082572-6082594 ATAAAGAGAAGGTCTGCTAAGGG - Intronic
1134651884 16:15915920-15915942 ATAATCAAAAGGTGTGATACTGG - Intergenic
1136134513 16:28247037-28247059 GTAATGCAAAGGACAGATAAGGG - Intergenic
1137066170 16:35846365-35846387 ATAATGAAAAGTTCTGGAAATGG + Intergenic
1137658889 16:50186145-50186167 ATGATGAAAAGTTCTGGCAATGG - Intronic
1146406189 17:32540623-32540645 ATAATCAAAAAGACAGATAATGG + Intronic
1152668229 17:81584604-81584626 AGAATGAGAAGGGCTGATGATGG + Intronic
1153459201 18:5315187-5315209 AGAAAGAAAAGGCCTGACAATGG + Intergenic
1153609287 18:6866454-6866476 ATAATGAAAAGGACTTCCAAAGG - Intronic
1154047343 18:10918459-10918481 ATTATGAAAAGAACTGATAAAGG - Intronic
1154938649 18:21088728-21088750 ATGATGAACAGGTTTGATTAGGG + Intronic
1156811236 18:41254847-41254869 ATAATAATAAGGTATGCTAAAGG + Intergenic
1156942984 18:42793498-42793520 TTAAGGAAAAGGTCTCATTAAGG + Intronic
1157634113 18:49132225-49132247 AAAATAAAAAGCTCAGATAAAGG + Intronic
1158378951 18:56906880-56906902 ATAATGAAAAAGTCTAAGATTGG + Intronic
1158702254 18:59758813-59758835 ATAATGAAAAGTTCTGGAAATGG + Intergenic
1159101197 18:63961251-63961273 ATTATGAAAATGAATGATAATGG + Exonic
1159424412 18:68266316-68266338 ATTTGGAAAAGGTTTGATAATGG - Intergenic
1160643569 19:164461-164483 AGAATGAAAAGGGCTGAGAAGGG + Intergenic
1162595083 19:11622246-11622268 ATAATAAAAAGTTCTGATTGAGG + Intergenic
1168214705 19:54917028-54917050 ATAATGAGAAGGGCTGAAAAGGG - Intergenic
925227310 2:2194697-2194719 TTAATGAAAGGATCTGATGAGGG - Intronic
926745796 2:16156763-16156785 ACAATGAAAATGTTTGTTAAAGG + Intergenic
928909169 2:36401365-36401387 CTAAGGAAGAAGTCTGATAAAGG + Intronic
930449163 2:51512441-51512463 ATAATAAGAAGGTCTAAAAAAGG + Intergenic
930593797 2:53360970-53360992 ATATGGAAAACATCTGATAAAGG - Intergenic
930781285 2:55226615-55226637 ATAGTGAAAATATCTGACAATGG - Intronic
931156488 2:59637739-59637761 AAAATGAAAAAGACTGACAATGG - Intergenic
932388572 2:71362535-71362557 ATGATGAAAAGGAATTATAAAGG - Intronic
932918988 2:75888419-75888441 AAAATGAAGAGGTAGGATAAGGG - Intergenic
933110134 2:78387738-78387760 ATAATGAATAAGTGTAATAAAGG - Intergenic
933338631 2:80993428-80993450 CTAAAGAGAAGGTCTGGTAAAGG + Intergenic
933571201 2:84015048-84015070 AAAATGGAAATGACTGATAATGG + Intergenic
934650312 2:96087342-96087364 ATAAGGGACAGATCTGATAAGGG + Intergenic
935496562 2:103789342-103789364 ATTCTGAAAAGTTCTGATATTGG - Intergenic
935732351 2:106074453-106074475 ATAATGAAAAGAGATGAAAAGGG + Intronic
938507238 2:131899062-131899084 TTAATGGAAAGTCCTGATAAAGG + Intergenic
939396268 2:141633702-141633724 ATCATGAAAAGTTCTGGAAATGG - Intronic
939655884 2:144824539-144824561 ATAATAAAAAAGTCAGATAATGG + Intergenic
939831486 2:147077583-147077605 ATAATCAAAAAGAATGATAATGG + Intergenic
940589004 2:155696968-155696990 CTAATAAAAATGTGTGATAAAGG - Intergenic
941032540 2:160529009-160529031 ATAATTAAAAGGACAGATGATGG + Intergenic
941475708 2:165949735-165949757 ATAATGAAAAAATGTTATAAAGG + Intronic
942359896 2:175161128-175161150 ATACAGAAAATGTCTGAGAAGGG + Intronic
943398955 2:187380345-187380367 ATTATGAAAAGGCTTTATAAGGG + Intronic
944963013 2:204897996-204898018 ATAATGAAAAGCTCTGAAGGTGG + Intronic
945845337 2:214937708-214937730 ATAAAGAAAAGGTGATATAATGG - Intronic
946511999 2:220367911-220367933 AGGATGAAAAAGTCTGATTATGG - Intergenic
1173674065 20:44818512-44818534 ATAATGGAAAAGTCTGGAAAAGG + Intergenic
1173776210 20:45708661-45708683 ATATTAAAAAGGTATTATAAAGG + Exonic
1176156039 20:63621295-63621317 ATGATGAAAAGCTCTGGAAATGG + Intronic
1176786392 21:13261264-13261286 TTAATGAAAAGTCCTGATAAAGG - Intergenic
1178168070 21:30005488-30005510 ATAATGGAAAGGAATGAGAATGG + Intergenic
1182730031 22:32480964-32480986 AAAATTAAAAGGGCGGATAAAGG - Intronic
1182930227 22:34166705-34166727 ATAATGAAAAGGAGAGATATTGG - Intergenic
949767568 3:7543937-7543959 ATAGTGAAAAGCTCTGATTAAGG - Intronic
950133842 3:10566540-10566562 ATAATGAGACAGTCAGATAATGG + Intronic
950741382 3:15054782-15054804 ATAATGCATATATCTGATAAAGG + Intronic
951089324 3:18553903-18553925 ATAAAGATAAGGTCAGAAAATGG - Intergenic
951328160 3:21331017-21331039 ACAATGATAAGGTATGTTAAAGG + Intergenic
951412924 3:22387031-22387053 AAAGTATAAAGGTCTGATAAAGG + Intergenic
952944587 3:38469489-38469511 ATAATGAAATTGTCTGAGACTGG + Intronic
955516576 3:59731971-59731993 AAAATGAAAATGTCTGTTAGAGG + Intergenic
955999673 3:64715740-64715762 ATAGTGCAAAGGTGTGATCACGG + Intergenic
959251675 3:103956153-103956175 ATAATGGAAAGGGTTGATATTGG + Intergenic
959814257 3:110657030-110657052 ATAGTGAAAATTACTGATAAAGG + Intergenic
959820751 3:110732545-110732567 AAAAAGGAAAGGTCTGGTAACGG + Intergenic
959989126 3:112611367-112611389 ATAATGTCAACGTCTGTTAATGG - Intronic
960915107 3:122686954-122686976 ATAATGAAAAGGTCTGATAAGGG - Intronic
961436736 3:126924266-126924288 ATAGAGAAAATGTCTGAAAAAGG + Intronic
961507535 3:127380406-127380428 ATAATGAAAATGACAGAAAAAGG + Intergenic
963398757 3:144769616-144769638 ATAGTGAAAATGCCTGTTAATGG + Intergenic
963447349 3:145429332-145429354 ATATTGAACAGCTCTGATGATGG + Intergenic
964250250 3:154707254-154707276 ATAATAAAAATGTCTGTTTAGGG - Intergenic
964496537 3:157296965-157296987 ATAATAAAAAGTAGTGATAATGG + Intronic
964969810 3:162545590-162545612 ATATTGAAAAAGTCAGAAAAGGG - Intergenic
965005958 3:163023947-163023969 ATAATGAGAATGATTGATAACGG + Intergenic
965050447 3:163640507-163640529 ATAAAGAAAAAGGATGATAATGG + Intergenic
965606173 3:170499588-170499610 ATAAAGAAAAGGTTTGGGAATGG - Intronic
966742418 3:183246285-183246307 ATGATGAAAAAGTCTGGAAATGG - Intronic
967637419 3:191819637-191819659 AAAATGAATAGGTATGAGAAAGG - Intergenic
970769118 4:19588874-19588896 ATAATGAAAAAATGAGATAATGG + Intergenic
971141065 4:23925362-23925384 AAAATGAAAACATCTGATGAAGG + Intergenic
974365547 4:60944449-60944471 ATAATGAAAATTTTTGAAAAGGG + Intergenic
974436875 4:61867922-61867944 ATAAAGAGAAGGGCTTATAATGG + Intronic
974870205 4:67633302-67633324 ATTAAGAAAAGGTCTGATCTTGG - Intronic
975102772 4:70533532-70533554 ATAATTAAAAGTGCTAATAAAGG + Intergenic
975293380 4:72703707-72703729 ATCATAAAAAGGTCTGCTGATGG - Intergenic
975677459 4:76841368-76841390 ATAAGTAAAAGGTATGACAAAGG - Intergenic
977278898 4:95014631-95014653 ATAATGATAAAGTCAGATAAAGG - Intronic
977369595 4:96118922-96118944 ATAATGAATAAATCAGATAAAGG + Intergenic
977392312 4:96427397-96427419 AAAATGAAAACCTCTCATAATGG - Intergenic
977963664 4:103117005-103117027 ATAATGAAAAGGGTGGAAAAAGG + Intronic
978646168 4:110934366-110934388 ATAATTAAAAGTACTTATAATGG - Intergenic
978697670 4:111602060-111602082 AGAATGGAGAGCTCTGATAAAGG + Intergenic
979205925 4:118037906-118037928 ATAATGAAAAAATATGATATAGG - Intronic
979589127 4:122458189-122458211 ATGAAGAAAAGGTCAGATTAGGG + Intergenic
979753396 4:124307748-124307770 ATAATGATTAGCTCTCATAAAGG + Intergenic
980271947 4:130595373-130595395 AGTATGAAAATGTCAGATAATGG + Intergenic
981300065 4:143177436-143177458 AGAATGAAAAGTTCTGTAAATGG - Intergenic
981419726 4:144535306-144535328 ATGAAGAAAAGGTGTGCTAAGGG + Intergenic
981465856 4:145071034-145071056 ATGATGAAAAGTTCTGAAGATGG + Intronic
982155738 4:152518654-152518676 ATAATTAAAATTTCTGAAAAGGG + Intronic
982264291 4:153524207-153524229 AGAATGCAAAGCTCTGAGAATGG - Intronic
982568230 4:157014427-157014449 ATAATTAAAAGGTATTTTAAGGG + Intergenic
983152128 4:164297273-164297295 AGTATGAGAAGGTCTGAGAAAGG + Intronic
983270147 4:165551569-165551591 ATAAACAAAAGGCCTGGTAATGG + Intergenic
983501593 4:168505761-168505783 ATAATGATAATGGCTAATAATGG - Intronic
983555033 4:169052411-169052433 AAAATGAGAAGGTCTGGGAAAGG + Intergenic
984390735 4:179128618-179128640 AAAATGAAAAGGTCTCTAAATGG + Intergenic
985264582 4:188145939-188145961 ATAATGAAAAAGGCTGATTAGGG + Intronic
985929369 5:3044643-3044665 AGAAGGGGAAGGTCTGATAATGG - Intergenic
986087851 5:4470024-4470046 ATAATAAAAAGATGTGATAGTGG + Intergenic
986678456 5:10211258-10211280 AAAAAAAAAAAGTCTGATAAAGG + Intergenic
988146270 5:27312740-27312762 ATAATGTAAAACTCTCATAAAGG + Intergenic
988330120 5:29826641-29826663 ATATTGAAAAAGTCTGATATAGG - Intergenic
988884529 5:35541333-35541355 ATAATAAAAAGGTGTGCTGATGG + Intergenic
988892705 5:35636627-35636649 ATAATGACAAGGCCTGAAAATGG + Intronic
989001102 5:36761699-36761721 ATAATGAAAAAGTATGAAATAGG + Intergenic
990602012 5:57368517-57368539 ATAAAGAAATGATTTGATAAGGG + Intergenic
991175446 5:63682337-63682359 ATAATGCATCTGTCTGATAATGG + Intergenic
992099115 5:73389314-73389336 ATATTGGAGAGGACTGATAAAGG + Intergenic
992703995 5:79369474-79369496 ATGATGAAAAGTTCTGGAAAGGG + Intergenic
992745711 5:79818614-79818636 ATAATGATAAGCTCTGGGAAAGG + Intergenic
993118880 5:83750788-83750810 ATAATGAAAAGCCCTGCGAATGG + Intergenic
993414768 5:87613121-87613143 ATAATGCATAGTTCTAATAACGG - Intergenic
994133435 5:96258239-96258261 ATCATGTCCAGGTCTGATAATGG - Intergenic
994415142 5:99460071-99460093 TTAATAAAAAGGTCACATAAAGG - Intergenic
994796085 5:104301576-104301598 ATAATGCAAAGGCCTAATATGGG + Intergenic
995471015 5:112502276-112502298 ATGATGAAATGTTCTGATAGTGG - Intergenic
995748244 5:115426492-115426514 GTAATGAAAAGGTATGCTAGAGG - Intergenic
995997175 5:118315292-118315314 ATAATAAAAAGATATGGTAAAGG + Intergenic
996319074 5:122193669-122193691 AGAAGGAAAAGTTCTGAAAAGGG + Intergenic
999036030 5:148350726-148350748 CTAAGGAAAAGGTCACATAAAGG + Intergenic
1000020864 5:157318356-157318378 ATAATGAAGATGTCTCAGAATGG - Intronic
1000910131 5:167012168-167012190 AGAATGAAAAGCTCTCACAAAGG + Intergenic
1001795283 5:174497125-174497147 ATGATGAAAAGTTCTGGAAATGG - Intergenic
1002272757 5:178083554-178083576 ATGTAGAAAAGGGCTGATAAGGG + Intergenic
1002733354 5:181360330-181360352 AGAATGAAAAGGGCTGAGAAGGG - Intergenic
1002751187 6:113788-113810 AGAATGAAAAGGGCTGAGAAGGG + Intergenic
1003181727 6:3797841-3797863 ATGATGAAAAGGTCTGTCATTGG - Intergenic
1003904414 6:10686004-10686026 ATATTTAAAATGTCAGATAAGGG + Intronic
1004084939 6:12437769-12437791 ATAATGAACAGGTCTTGAAATGG - Intergenic
1004462180 6:15847916-15847938 ATAATAAAAAGGTGTGATGGGGG + Intergenic
1004745850 6:18508376-18508398 ATCATGAAAAGGTGTCATCAAGG + Intergenic
1004775037 6:18834671-18834693 TTAATAAAAAGGTCTTATATTGG + Intergenic
1005810663 6:29513108-29513130 ATAGTGAAAAGGCCTAATGAAGG + Intergenic
1006806217 6:36791416-36791438 ATAATGATAAAGTATCATAATGG - Intronic
1008040224 6:46789642-46789664 ATAATGTAAAGGTGTGAACATGG - Intergenic
1008124910 6:47657089-47657111 AACATGACAAGGTCTGATGAGGG - Intronic
1008703263 6:54127238-54127260 AGAATGAAAAGGAATTATAATGG - Intronic
1008899854 6:56599288-56599310 AGAATGAAAATGCATGATAAAGG - Intronic
1010333903 6:74658427-74658449 ATAACTAAAAAGTCTGATAATGG + Intergenic
1010610134 6:77944438-77944460 AAAAGGAAAAGGTCTGAACAAGG - Intergenic
1010695043 6:78962206-78962228 ATAATGTAAAGTTGAGATAAAGG - Intronic
1010984514 6:82408241-82408263 ATAAGGAAAAGGCCTGAATATGG + Intergenic
1011164305 6:84429158-84429180 AGAATGGAAAGGTCTGAAATAGG - Intergenic
1013656584 6:112253260-112253282 AGAATGTAGAGGTCTGGTAAAGG - Intronic
1014168051 6:118248219-118248241 ATAATGGAAAGTTCTTTTAAGGG - Intronic
1016250132 6:142031019-142031041 ATAATGGTATGGTCAGATAATGG - Intergenic
1018034370 6:159868741-159868763 ATGATGAAAAGTTCTGGAAATGG + Intergenic
1019237604 6:170632652-170632674 AGAATGAAAAGGGCTGAGAAGGG - Intergenic
1020518717 7:9159089-9159111 ACAATGAAAAGAGCTAATAATGG + Intergenic
1020543995 7:9500293-9500315 ATAATGTAAAGGTCTGCCATGGG - Intergenic
1020697535 7:11432942-11432964 ACAATGAAAAGTTCTGAAAGTGG + Intronic
1020756559 7:12211007-12211029 AAAAGGAAATGGTCTGATATGGG + Intergenic
1021886939 7:25148432-25148454 ATAATTAATAGATCTGAGAAAGG + Intronic
1022022460 7:26413953-26413975 ACCATGGAAAGCTCTGATAAGGG - Intergenic
1022652625 7:32290975-32290997 ATTATGAAAATATCTTATAATGG + Intronic
1022825286 7:34005110-34005132 ATAATGACAAGTTCTGAGAGTGG + Intronic
1023632403 7:42177395-42177417 AAACTGAAAAGGTCATATAAGGG + Intronic
1024347854 7:48331034-48331056 ATAAGAAAAAGGTCTGAATAAGG + Intronic
1024556535 7:50608003-50608025 ATGATGCAAAGGTCTAATACAGG + Intronic
1025262903 7:57432403-57432425 ATAATGAAATAGGCTGATCATGG - Intergenic
1028946549 7:96586360-96586382 ATATTGAAAATGTGTGAAAATGG + Intronic
1031160020 7:118155298-118155320 ATAGTGAGAAGGTCTAAGAAAGG - Intergenic
1031408857 7:121419313-121419335 ATAGTGCAAAGTTCTGATAGGGG - Intergenic
1035510164 8:173959-173981 AGAATGAAAAGGGCTGAGAAGGG + Intergenic
1035829733 8:2682028-2682050 ATAATAAAAAGGTGTGTTCAAGG - Intergenic
1036076533 8:5508360-5508382 ATGGGGAAGAGGTCTGATAAAGG - Intergenic
1037084968 8:14837295-14837317 TCCATGAAAAGGTCTGAGAAAGG + Intronic
1037152592 8:15655907-15655929 ATAATTAAAAGTTGTGGTAAAGG + Intronic
1037637288 8:20711377-20711399 AAAATGAAAAGCTCTTAGAATGG - Intergenic
1038601213 8:28944826-28944848 ATAATTAAAAGGTTTGTTAGAGG + Intronic
1040620752 8:49090064-49090086 AGAATGAATAGGTCAGACAATGG + Intergenic
1040885104 8:52254414-52254436 ATATTGAGAAGGTCTGAATAGGG - Intronic
1041746892 8:61217104-61217126 ATCATGAAAAAGTCTCAGAAAGG - Intronic
1042963839 8:74330099-74330121 ATAATGGAATGGTCTCCTAAAGG + Intronic
1043116742 8:76265021-76265043 AAAATGAAAATTTCTGATTAGGG + Intergenic
1044288831 8:90443616-90443638 ATAATGAAAATGTCTTATGGTGG - Intergenic
1044367476 8:91366182-91366204 TTAATGAAAATGTGTTATAAAGG - Intronic
1045697510 8:104826570-104826592 TAATTGAAAAGGACTGATAATGG - Intronic
1045805280 8:106152583-106152605 ATAATACAATGGTTTGATAAAGG - Intergenic
1045954239 8:107888374-107888396 ATAAGGAAAAGATAAGATAATGG + Intergenic
1052116782 9:24658243-24658265 ATACTGAAGAGCTCTGAAAATGG - Intergenic
1052394197 9:27918024-27918046 ATAATAAAAAGTTCAGAAAATGG - Intergenic
1053339904 9:37316388-37316410 ACAATGAAAGGGTCTTTTAATGG + Intronic
1054725757 9:68648292-68648314 AGAATGAAAGGGCCTGATATAGG - Intergenic
1055198261 9:73624251-73624273 ATAATGCAAAACTCTGTTAAGGG + Intergenic
1055456556 9:76477725-76477747 ATAATGAAAAGTTCTAGGAATGG - Intronic
1059690322 9:116678611-116678633 AAAGTGAAAAGGGCTTATAAAGG + Intronic
1059758399 9:117315669-117315691 ATAATGAAAAGTTCTGCTCATGG - Intronic
1060047121 9:120349863-120349885 ATAATGGAGAGCTCTGAAAATGG + Intergenic
1060306309 9:122416052-122416074 AAAATAAAAAAGTATGATAAAGG - Intergenic
1062757758 9:138312642-138312664 AGAATGAAAAGGGCTGAGAAGGG - Intergenic
1186923519 X:14307334-14307356 ATAATGAAATAGGCTGAGAAAGG - Intergenic
1188275659 X:28197297-28197319 ATAACTAAAAGGTATTATAAAGG - Intergenic
1188288574 X:28360485-28360507 AGAATAAAAAGGTCAAATAAGGG - Intergenic
1190407255 X:50100535-50100557 ATTAAGAGAATGTCTGATAAAGG - Intergenic
1191697274 X:64003184-64003206 AAAATCAAAAGTCCTGATAATGG - Intergenic
1194490856 X:94547391-94547413 ATTCTGAAAGGGTATGATAAAGG + Intergenic
1195699239 X:107690009-107690031 CTAATGAATAGGTGTGCTAATGG + Intergenic
1196851482 X:119943046-119943068 AAAATGAAAAGGACGAATAAAGG + Intronic
1197252148 X:124227522-124227544 ATATTGAAAAAGTTTTATAACGG - Intronic
1198555394 X:137787809-137787831 ATAGTGAAATGGTTGGATAATGG - Intergenic
1202025803 Y:20521988-20522010 ATAATAAAAAAGTATGATATAGG - Intergenic