ID: 960916353

View in Genome Browser
Species Human (GRCh38)
Location 3:122699037-122699059
Sequence ATTTCAACATAGATGGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960916353 Original CRISPR ATTTCAACATAGATGGATCT TGG Intronic
901292662 1:8136348-8136370 ATTTCGGCAGAGATGGAGCTTGG - Intergenic
902363896 1:15958523-15958545 ATTTCAATATAGAGGGATTCGGG + Intronic
902853665 1:19182752-19182774 ATAACAATATAGATGAATCTTGG + Intronic
905988022 1:42305560-42305582 TTTTCAACATGGATGGAACTGGG + Intronic
908695899 1:66841506-66841528 ATTTAAAAACAGATGGATCTTGG - Intronic
910410613 1:86940625-86940647 ATTTCAGCATATTTGGATATGGG + Intronic
910468263 1:87523583-87523605 TTTTGACCATACATGGATCTTGG + Intergenic
910538396 1:88326277-88326299 TTTTCAAGATAGATGGCTTTTGG + Intergenic
910704322 1:90110983-90111005 ATATCTACATAAATGGATCCTGG - Intergenic
912307021 1:108578636-108578658 ATTTCAACTTCGGTGAATCTGGG - Intronic
912673421 1:111653103-111653125 ACTTCAACATCGATGAACCTTGG + Intronic
913601298 1:120423908-120423930 ATTTCAACATGGAAAGAGCTAGG - Intergenic
914085746 1:144452687-144452709 ATTTCAACATGGAAAGAGCTAGG + Intronic
914191641 1:145416668-145416690 ATTTCAACATGGAAAGAGCTAGG + Intergenic
914362486 1:146947466-146947488 ATTTCAACATGGAAAGAGCTAGG - Intronic
914456235 1:147839624-147839646 ATTTAAAAATATATGTATCTGGG - Intergenic
914489184 1:148139631-148139653 ATTTCAACATGGAAAGAGCTAGG + Intronic
914589568 1:149094670-149094692 ATTTCAACATGGAAAGAGCTAGG + Intronic
917795561 1:178530365-178530387 AGTTTAAGAGAGATGGATCTGGG - Intronic
919538200 1:198814608-198814630 ATTTCAAGATAAATGAATCCAGG + Intergenic
920989089 1:210918998-210919020 ATTTGAACATAGCTGTAGCTTGG - Intronic
922164322 1:223102358-223102380 CTATCAACATAGATTGATTTTGG - Intergenic
922780345 1:228247370-228247392 ATTGCAACAAACATGGATCTAGG - Intronic
923103396 1:230835705-230835727 ACTTCAACATAAAGGAATCTGGG - Intergenic
924479994 1:244421312-244421334 ATTTAAACATAGTTGAACCTAGG - Intronic
1063725554 10:8633805-8633827 TCTACAACATAGATGGACCTTGG + Intergenic
1069298507 10:66877286-66877308 GTTTCTAAATAGATGGATCAGGG + Intronic
1071368984 10:84931767-84931789 ATTTCAACATTGCTGTGTCTCGG + Intergenic
1072172563 10:92880135-92880157 ATTTCAACATCCATGGATTTAGG - Intronic
1072566825 10:96623361-96623383 ATTGAAAAATAGAGGGATCTAGG - Intronic
1073786500 10:106896017-106896039 GTTAGAACATAGATGGAACTTGG + Intronic
1074010234 10:109471158-109471180 ATTTCAGAACAGATGGATGTAGG - Intergenic
1078088151 11:8247083-8247105 ATTTCAACAAAGAGAGACCTGGG - Intronic
1078966167 11:16346384-16346406 ATTTCCACATTCAAGGATCTTGG + Intronic
1080777520 11:35399849-35399871 ATTTCAACATAGGGTGATGTGGG + Intronic
1081165651 11:39806428-39806450 ATTTTAACATCTATGTATCTTGG - Intergenic
1086018139 11:82192255-82192277 ATTTGAACATAGAAGGATGAAGG - Intergenic
1087654725 11:100908535-100908557 ACAGCAACATAGATGGAACTGGG - Intronic
1087814135 11:102639911-102639933 ATTACAAAATAGAGAGATCTAGG - Intergenic
1088118957 11:106345143-106345165 ATTCCAACATATATGCATTTTGG + Intergenic
1090513633 11:127401319-127401341 ATTTCAATATAGATAAATCTGGG + Intergenic
1091138058 11:133210611-133210633 ATTTCAACTTTGATGGAACAGGG - Intronic
1091960101 12:4686629-4686651 ATTTCAACAGAAATAAATCTAGG - Intronic
1096296277 12:50386904-50386926 ATTTCATCCCAGATGGATATTGG + Intronic
1096906315 12:54939714-54939736 TTTACAAAATGGATGGATCTGGG + Intergenic
1099037987 12:77613988-77614010 CTTTCAACACATATGGATGTGGG + Intergenic
1099287253 12:80729629-80729651 ATTTGAACCTAGATGGATTGAGG - Intergenic
1103877215 12:124137487-124137509 TTTTCATCTTAGATGGATTTTGG + Intronic
1104451214 12:128869463-128869485 ATTTCAAAATAGATGGGGCTGGG - Intronic
1107216835 13:37931550-37931572 ATATAAACATAGATGCTTCTGGG + Intergenic
1107368707 13:39716639-39716661 ATTTAAACATATATGTATGTGGG + Intronic
1107420212 13:40239171-40239193 AATTCAACATAGTTGGATTTGGG - Intergenic
1107476703 13:40744046-40744068 GCTGCAACATAGATGGAGCTGGG + Intronic
1109964033 13:69668430-69668452 ATTTCAACCTTGGTGAATCTTGG - Intergenic
1110764942 13:79272200-79272222 ATTTTAACATAAATGTATTTAGG - Intergenic
1111543598 13:89700749-89700771 AATTCTACACAGATGGATGTGGG + Intergenic
1114851016 14:26382504-26382526 ATTGCAAAATGGATGGATCATGG + Intergenic
1115070520 14:29317028-29317050 ATTTAAACAAAGAAGAATCTAGG + Intergenic
1115759367 14:36562733-36562755 ATTTCAACAAATTTGGATTTTGG - Intergenic
1115846070 14:37536369-37536391 ATATCAAAATAGATGTATTTTGG - Intronic
1117312958 14:54546918-54546940 ATTTTAAGAGAGATAGATCTGGG - Intergenic
1120073446 14:80128839-80128861 GTAACAACATAGATGGAACTGGG - Intergenic
1121284180 14:92721929-92721951 GTTTCAAAATAGATGACTCTTGG + Intronic
1123101537 14:105805253-105805275 ACAACAACATAGATGAATCTTGG + Intergenic
1123903547 15:24899918-24899940 ATTTCCACAGAGATGAATCTGGG + Intronic
1127659902 15:61090659-61090681 ATTTCAGTATAGATGGATTTTGG - Intronic
1129863269 15:78880761-78880783 ATTTAAATATACTTGGATCTTGG + Intronic
1131210142 15:90487892-90487914 ACTTCAACATCTATGGATTTTGG - Intronic
1132757388 16:1492643-1492665 ATTTCAGCAGTGATGGATGTGGG - Intergenic
1134667731 16:16031350-16031372 CTTTCAACATGGATGCATCCGGG - Intronic
1135110253 16:19685334-19685356 ATACCAACACAGATGAATCTTGG - Intronic
1137839222 16:51624642-51624664 GTTTCTAGATAGATGTATCTAGG - Intergenic
1138089682 16:54164065-54164087 GCTTCAACATAGATGAACCTCGG + Intergenic
1140167628 16:72570231-72570253 ATATAAAAATAGAAGGATCTCGG + Intergenic
1140275962 16:73509255-73509277 TTTTCAAAACAGAGGGATCTGGG - Intergenic
1148138039 17:45308282-45308304 GTTTCAACAGAGAAGGCTCTTGG - Intronic
1148197209 17:45722599-45722621 ATTTCAACACATATAGAACTTGG - Intergenic
1149046504 17:52252248-52252270 CTTTGAAGATAGATGGACCTGGG + Intergenic
1149130956 17:53301887-53301909 ATTACAACATGGATAGAACTGGG + Intergenic
1150006721 17:61474515-61474537 ATTCCAATGTAGATAGATCTGGG + Intronic
1154459452 18:14566202-14566224 ATTTGAACATCCATGGATTTTGG + Intergenic
1155015877 18:21838829-21838851 GTATCAACACAGATGGTTCTTGG - Intronic
1156554117 18:38048095-38048117 ATCTCAACATGGATGGATTGGGG - Intergenic
1156575012 18:38304951-38304973 ATATCAACCTTGATGGCTCTTGG - Intergenic
1159381685 18:67667839-67667861 ATTTCAATATAGTTGGGACTAGG + Intergenic
1159797276 18:72860167-72860189 ATGTCAACATATATGTATCCCGG + Intronic
1163132114 19:15280918-15280940 ATTTCAGCAAAGATGTTTCTAGG - Intronic
1165086069 19:33348281-33348303 AATTCAACATGGATGGATATAGG + Intergenic
1166407860 19:42534645-42534667 GCTGCAACATAGATGGACCTTGG + Intronic
1167855468 19:52234826-52234848 ATTTCAAGATGGAGGGATATGGG + Intergenic
925610630 2:5697925-5697947 TTTTAATCATAGATGAATCTTGG + Exonic
926448909 2:12978414-12978436 AGTCCAACATAGATGTACCTTGG - Intergenic
926568027 2:14499229-14499251 ATTGAAACATAGATGAATGTTGG - Intergenic
926884104 2:17581390-17581412 ATATCTACATTGATGGATATGGG - Intronic
931187746 2:59969874-59969896 ATTTCATCATAGGTGTATATAGG - Intergenic
933223249 2:79715508-79715530 ATTTCATCATAGTTGGAGTTTGG - Intronic
933249375 2:80011759-80011781 CTTTCAACAAATATGGATTTAGG + Intronic
933384133 2:81588891-81588913 GTTTCCAGATTGATGGATCTGGG - Intergenic
935065549 2:99644130-99644152 ATTTCAATATAAATGGATCTTGG + Intronic
937523422 2:122738613-122738635 ATTTAAACAAAGATGAATTTGGG - Intergenic
937614073 2:123899217-123899239 ATTTCCACATGGTTTGATCTTGG + Intergenic
938888167 2:135675187-135675209 ATTTCATAATAGATGGTTTTAGG + Intronic
939292059 2:140208629-140208651 ATGTCAACATAGAATGATTTTGG + Intergenic
939431465 2:142114612-142114634 ACAGCAACATAGATGGAACTGGG + Intronic
939833986 2:147105682-147105704 ATTTAGACATAGCTAGATCTAGG - Intergenic
942282839 2:174384216-174384238 ATTACAACATATATGAACCTTGG + Intronic
943178030 2:184503273-184503295 ATAGCCACATAGATGGAACTGGG + Intergenic
943520816 2:188946962-188946984 GTTACAAAATAGATGGATTTGGG - Intergenic
945715746 2:213355891-213355913 AATTCAACATAGTTGGAAGTTGG - Intronic
946810486 2:223519102-223519124 GCTACAACATAGATGGACCTTGG - Intergenic
946957807 2:224950981-224951003 ATCTGAACAGAGATGGATGTAGG + Intronic
946984343 2:225255526-225255548 ATTTGAACAGAGCTGGAACTAGG + Intergenic
948182591 2:235994236-235994258 GTTTCAACAGAAATGGATGTAGG - Intronic
948579781 2:238978398-238978420 ATTGCACCATAGATAGTTCTTGG + Intergenic
1171064608 20:22002324-22002346 CTTGCAACACAGAAGGATCTCGG - Intergenic
1172802417 20:37585531-37585553 ATTTTAAAATAGCTGAATCTTGG + Intergenic
1174159737 20:48542327-48542349 ATTTCAACATATATGGAGTCAGG + Intergenic
1176814692 21:13587136-13587158 ATTTGAACATCCATGGATTTTGG - Intergenic
1177318437 21:19491366-19491388 ATTTGAGCATAGATGTCTCTGGG + Intergenic
1177320273 21:19512162-19512184 ATTTGAAAATAAATGTATCTGGG + Intergenic
1177380265 21:20331453-20331475 ATTTCAGTATAGATGAATTTGGG + Intergenic
1180640084 22:17291285-17291307 GCCTCAACTTAGATGGATCTTGG - Intergenic
949246283 3:1928486-1928508 ATTTCAAAATAGCTAGATTTTGG + Intergenic
951769151 3:26235562-26235584 AGTTGAACATATATGGATTTTGG - Intergenic
952128814 3:30335611-30335633 ATTTCAACATATTAAGATCTGGG + Intergenic
952985905 3:38782977-38782999 ATGTCAGCATAGTTGGGTCTGGG + Intronic
953436043 3:42878167-42878189 ATTTCAAAATAGCTGTGTCTTGG - Intronic
954842835 3:53527106-53527128 GTTTCATCATAGATTGTTCTAGG - Intronic
955424235 3:58770744-58770766 ATTTTAAGATAGAAGAATCTTGG + Intronic
956210475 3:66796644-66796666 GTTCCAACATAGATGAATTTTGG + Intergenic
957433778 3:80148532-80148554 ATTTTAACATGGAGGGATGTTGG + Intergenic
960026474 3:113016616-113016638 ATTTCATCAAAGAAAGATCTGGG - Intronic
960119144 3:113928441-113928463 ATTTAAAAATTGATGAATCTAGG - Intronic
960194470 3:114748243-114748265 ATTTGAAAAAAGATGGTTCTGGG + Intronic
960470560 3:118059809-118059831 ATTTGAACAAACATGAATCTAGG - Intergenic
960691936 3:120355536-120355558 GTTACAACATGGATGAATCTTGG + Intergenic
960916353 3:122699037-122699059 ATTTCAACATAGATGGATCTTGG + Intronic
964942178 3:162172091-162172113 ATTTCAATATTGTTGTATCTTGG - Intergenic
967749449 3:193096970-193096992 ATTTCAAGATTGGTGGATATGGG + Intergenic
970113507 4:12665101-12665123 ATTTAAAAATAGATGAATCCTGG - Intergenic
972908227 4:43778288-43778310 ATTTAAAGATGGATGCATCTAGG + Intergenic
972908726 4:43785991-43786013 ATTTCAAAATTGCTGGATATTGG + Intergenic
972933921 4:44107573-44107595 AGTTCTACATATAAGGATCTTGG - Intergenic
973615493 4:52673663-52673685 AATTCAACATTGATGGATTTGGG + Intergenic
974181624 4:58390996-58391018 TTATCAACATAGATGATTCTAGG - Intergenic
975477786 4:74843263-74843285 ATTTCAGCTGAGATTGATCTGGG - Intergenic
976525304 4:86080785-86080807 TTCTCAACATAAAAGGATCTTGG - Intronic
976716942 4:88133293-88133315 ATTTCTACTTAGATGTTTCTTGG - Intronic
978444906 4:108771246-108771268 ATTTCAAAAAACATGGATCTAGG + Intergenic
980501698 4:133663816-133663838 ATTTCAAGATAAATAAATCTAGG - Intergenic
981263489 4:142752087-142752109 ATTTCAACTTAGATGCCTCTAGG - Intronic
981893126 4:149763305-149763327 ATTTCACCATATCTGGATTTGGG - Intergenic
982344633 4:154344004-154344026 ATTTCAACATTGCTGTGTCTTGG + Intronic
982583485 4:157208413-157208435 ATTTAGACATAGATGAAGCTGGG + Intronic
982653990 4:158123239-158123261 ATTTCAACATTGAAGATTCTAGG + Intergenic
983003421 4:162449754-162449776 ATTTAAATAGAGATGCATCTAGG - Intergenic
983248635 4:165319465-165319487 ATTTCAAAATAAATGAATCCAGG + Intronic
983737172 4:171076006-171076028 ATTACAACAGAGATAGAGCTTGG + Intergenic
983981046 4:173997684-173997706 CTTACAACATTAATGGATCTTGG - Intergenic
985206711 4:187545958-187545980 ATATCACCATAAATCGATCTCGG - Intergenic
988625310 5:32868855-32868877 GTTTCAACATGGATGTAACTGGG + Intergenic
989492135 5:42069972-42069994 ATTTCTTCATAGTTCGATCTTGG + Intergenic
990652494 5:57917869-57917891 ATGGCAACATGGATGGAACTGGG - Intergenic
994441518 5:99811830-99811852 ATTTCAAGATAAAGGAATCTAGG + Intergenic
995050872 5:107701894-107701916 TTTTCAACATAGAAGCTTCTTGG + Intergenic
996063068 5:119053064-119053086 ATTTCAACATATACGGTTTTTGG - Intronic
997305695 5:132834531-132834553 TTTTCAATAGAGATGGAGCTAGG + Intergenic
997777199 5:136621129-136621151 ATCTCTACATAGATGCTTCTAGG + Intergenic
998832702 5:146176620-146176642 ATCTCAACATATATGAATCTGGG + Intronic
999046447 5:148474732-148474754 TTCTCAACATAGACAGATCTAGG + Intronic
1000149682 5:158487342-158487364 ATTTCCACATAGCTGCATTTTGG - Intergenic
1000905104 5:166956661-166956683 GCTACAACATAGATGAATCTTGG + Intergenic
1001230995 5:169988286-169988308 TTTGCAACAGTGATGGATCTCGG - Intronic
1001332836 5:170774198-170774220 TTTCCAACATGGATGGAACTGGG + Intronic
1003393141 6:5730473-5730495 TTTTCTACATAAATAGATCTAGG - Intronic
1007136619 6:39528256-39528278 GTGACAACATAGATGGAACTGGG - Intronic
1007156101 6:39745525-39745547 ATTTCAACATTGAAGGACATAGG + Intergenic
1007936428 6:45736817-45736839 ATTTCCAAATAGAAGGATCAAGG - Intergenic
1008026029 6:46636937-46636959 ATTTCAACATATAAAGATTTGGG - Intronic
1010645438 6:78382217-78382239 TTTACAACATGGATGGACCTGGG + Intergenic
1011071219 6:83386703-83386725 ATTTCAAAATACATGAATTTTGG - Intronic
1012500356 6:99881367-99881389 ATTTGAACAAACATGGATCATGG - Intergenic
1012687058 6:102264549-102264571 ATATCAGCATAGATGTATTTTGG - Intergenic
1017024497 6:150169453-150169475 AGTCCAACATAGTTGGATATTGG - Intronic
1018605619 6:165595123-165595145 ATTTCCACATGGCTGGACCTGGG - Intronic
1021712681 7:23431702-23431724 ATTCTAACATAGGTGGTTCTCGG - Intronic
1021987879 7:26114772-26114794 AGTTCAAGATAGATGGATCTAGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1024710965 7:52014329-52014351 AACTCAACATGGATGCATCTAGG + Intergenic
1026420305 7:70229785-70229807 ATTTCAACACAGATTGATCCAGG - Intronic
1027909571 7:84232090-84232112 ATTTAAACATTGATACATCTTGG - Intronic
1028368236 7:90060154-90060176 ATTTACAAATAGATGCATCTGGG - Intergenic
1028694635 7:93694341-93694363 ATTTCAACATAGAGGTCACTGGG - Intronic
1028989104 7:97030954-97030976 GTTTCAACATAGCAGGCTCTTGG + Intergenic
1029502196 7:100938766-100938788 ATGGCAACATATATGGATTTCGG - Intergenic
1030990656 7:116295711-116295733 ATTTCTTCATAGATCAATCTTGG - Intronic
1033734674 7:144209734-144209756 GTAACAACAGAGATGGATCTTGG - Intergenic
1033748379 7:144341235-144341257 GTAACAACAGAGATGGATCTTGG + Intergenic
1035643968 8:1204363-1204385 ATTTAAAGAAAGATGGATTTTGG + Intergenic
1038912138 8:31977122-31977144 ATTTGAACATAGATGGTTTGCGG - Intronic
1039123118 8:34170978-34171000 AGTGAAACATAGATGGATGTGGG + Intergenic
1039202365 8:35110132-35110154 AGTACAAAATATATGGATCTTGG - Intergenic
1041336175 8:56787001-56787023 ATTTTAACATAGATTAAGCTTGG + Intergenic
1042421405 8:68594168-68594190 AGTTCTATATAGCTGGATCTTGG + Intronic
1044270088 8:90231619-90231641 ACTACAACACGGATGGATCTTGG - Intergenic
1044824439 8:96182860-96182882 ATTTCTTCATAGATGGACATTGG + Intergenic
1044898588 8:96919969-96919991 ATTTTAACATAGATGAATTGAGG - Intronic
1045172961 8:99691054-99691076 GTTTCAACATGGATGAACCTTGG + Intronic
1046384738 8:113494484-113494506 TTCACAAGATAGATGGATCTTGG + Intergenic
1046881644 8:119315756-119315778 AGTTCTATATACATGGATCTTGG - Intergenic
1049912205 9:280022-280044 TTTTCAACAGATATGGTTCTGGG + Intronic
1052568014 9:30183480-30183502 ATTTGATCAAACATGGATCTTGG - Intergenic
1053067786 9:35080275-35080297 ATTTCAAATTAAATGGAGCTAGG + Intergenic
1053325318 9:37140866-37140888 ATTTAAACATAGAAGGAGATAGG + Intronic
1055257136 9:74384849-74384871 ACTTGAACATTGATTGATCTTGG - Intergenic
1058023920 9:100119245-100119267 ATTTCTACAAAGATTGCTCTGGG + Intronic
1060384200 9:123208149-123208171 ATTCCAACATAGAATTATCTAGG + Intronic
1061827703 9:133271974-133271996 ACTACAACATACATGAATCTCGG + Intronic
1203532666 Un_GL000213v1:162304-162326 ATTTGAACATCCATGGATTTTGG + Intergenic
1186382249 X:9073182-9073204 ATTTCAACATATCTGCATCAAGG - Intronic
1186615224 X:11178858-11178880 CTTTCAACATAGCTGCTTCTGGG - Intronic
1187299050 X:18030369-18030391 ATTTCAGCAAAGGTTGATCTTGG + Intergenic
1187543368 X:20221995-20222017 ATTTAAACAGAGATGGACATGGG - Intronic
1187827828 X:23350363-23350385 ACTTCAAGATAATTGGATCTGGG + Intronic
1188175360 X:26982642-26982664 ATTACAACATAGTTGAATATAGG + Intergenic
1188627206 X:32299290-32299312 ATGTCATCATGGATGGATTTTGG - Intronic
1188895136 X:35658640-35658662 TTTTCAACCCAGATGGACCTGGG + Intergenic
1189582080 X:42416929-42416951 ATTTAAAAATAGATGCAACTGGG - Intergenic
1190443135 X:50495631-50495653 ATTTCAAAAAGGATGGAACTTGG - Intergenic
1193252373 X:79307308-79307330 GCTTCAACATAGATGAACCTTGG + Intergenic
1193981897 X:88191635-88191657 ATTTCTTCATAGTTCGATCTTGG - Intergenic
1195521629 X:105837122-105837144 ATTTTAACATAGCTGTAACTGGG - Intronic
1197013985 X:121602002-121602024 TTTTCAACATGGATGGATGTTGG + Intergenic
1197334247 X:125192492-125192514 ATGAGAACAAAGATGGATCTAGG + Intergenic
1197359190 X:125477544-125477566 TTTTCAACACAGATGGGTTTCGG - Intergenic
1199909158 X:152267208-152267230 CTTTCATCATAAATGGATGTTGG + Intronic
1199983563 X:152934571-152934593 ACTTCAACATGCATGGATTTTGG - Intronic