ID: 960920466

View in Genome Browser
Species Human (GRCh38)
Location 3:122741846-122741868
Sequence GCCCCTTTTTGCCAATTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960920466_960920468 -5 Left 960920466 3:122741846-122741868 CCATGAAATTGGCAAAAAGGGGC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 960920468 3:122741864-122741886 GGGGCCTGATAGTTCCAAGTGGG 0: 1
1: 0
2: 0
3: 2
4: 80
960920466_960920467 -6 Left 960920466 3:122741846-122741868 CCATGAAATTGGCAAAAAGGGGC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 960920467 3:122741863-122741885 AGGGGCCTGATAGTTCCAAGTGG 0: 1
1: 0
2: 1
3: 8
4: 122
960920466_960920471 28 Left 960920466 3:122741846-122741868 CCATGAAATTGGCAAAAAGGGGC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 960920471 3:122741897-122741919 ACAAAAGTCTTATACACTAATGG 0: 1
1: 0
2: 1
3: 21
4: 227
960920466_960920472 29 Left 960920466 3:122741846-122741868 CCATGAAATTGGCAAAAAGGGGC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 960920472 3:122741898-122741920 CAAAAGTCTTATACACTAATGGG 0: 1
1: 0
2: 1
3: 8
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960920466 Original CRISPR GCCCCTTTTTGCCAATTTCA TGG (reversed) Intronic
903257012 1:22109134-22109156 GCCCCTTAGTGCCCCTTTCAGGG - Intergenic
907250865 1:53138247-53138269 TCCACTTTTTGGTAATTTCATGG + Intronic
909932317 1:81510705-81510727 GGTCCTTTTTGTCATTTTCAAGG + Intronic
910135384 1:83962381-83962403 TGCCCTTCTTGCCAATTTTACGG + Intronic
910872972 1:91851949-91851971 GGCCCTTTTTATCATTTTCAAGG - Intronic
918585368 1:186181386-186181408 TCCTTTTTTTGCCATTTTCATGG + Intronic
919555126 1:199043072-199043094 ACTTCTTTTTGCCTATTTCATGG + Intergenic
1063044968 10:2382561-2382583 GCCCCATTATGCCAAGTGCAGGG + Intergenic
1064862212 10:19839101-19839123 GCCCCTGCTTCCCAAGTTCAAGG - Intronic
1067251387 10:44589804-44589826 GGCCCTTTTTGACAATTTCCAGG + Intergenic
1068458901 10:57300023-57300045 TCCCCTTTTAGCCAATTCCATGG + Intergenic
1069876062 10:71563513-71563535 GCCCATTTGTCCCAAGTTCATGG + Intronic
1070487915 10:76948303-76948325 GCCCCTGTTTCTCAGTTTCAGGG + Intronic
1071104042 10:82073604-82073626 TCTCTTTTTTGCCATTTTCATGG + Intronic
1074546028 10:114403366-114403388 GTCCCTTTATGTCAGTTTCAGGG + Intronic
1074799244 10:116982512-116982534 GCTCCTTTTTGGCAATGTTACGG + Intronic
1075181061 10:120212355-120212377 GCCCCTTTTAGCCATATTAAAGG + Intergenic
1080228669 11:29990455-29990477 GGCCCATTTTGCCACTTTGATGG - Intergenic
1083415210 11:62521147-62521169 GGCCTTTTATGTCAATTTCAGGG + Exonic
1084504919 11:69559497-69559519 GCCTCTTTTTGCCCATTTTAGGG - Intergenic
1089218416 11:116850134-116850156 TCCCTTTGTTGCCAATCTCATGG + Intronic
1089325965 11:117657203-117657225 GGGCCCTTTTGCAAATTTCAAGG - Intronic
1089820512 11:121221508-121221530 GCTCCATTTTGCCTATGTCATGG - Intergenic
1090591228 11:128271925-128271947 GCTGCTTTCTGCCAATTTTATGG + Intergenic
1091304333 11:134527976-134527998 GTCCCTCTTTGCCAACTGCATGG + Intergenic
1091578126 12:1758561-1758583 GTCCCTTGCTGCCAATTTCACGG + Intronic
1094237684 12:28187263-28187285 AATCCTTTCTGCCAATTTCATGG + Intronic
1097722576 12:63039350-63039372 TCTGCTTTTTGCCATTTTCATGG + Intergenic
1099953271 12:89327461-89327483 GAGCCTTTTTGGTAATTTCAGGG + Intergenic
1107024092 13:35782037-35782059 GCCTCCTTTTGCCATTTTGATGG - Intronic
1107134545 13:36929572-36929594 TTGCCTTTTTGCCATTTTCATGG + Intergenic
1110909767 13:80943025-80943047 GCACATTTTTTCCAATTTTAAGG - Intergenic
1111342626 13:86907902-86907924 GTCACTTTTTCCTAATTTCATGG + Intergenic
1114653786 14:24303776-24303798 GCCTCTCTTTGCCACTTTGATGG + Exonic
1116643425 14:47495565-47495587 CCCCCTATTTGCCATCTTCATGG + Intronic
1118361007 14:65056509-65056531 TTTCCTTTTTGCCAATTTGATGG + Intronic
1118552640 14:66972566-66972588 GCCCCATTTTGTCACATTCAAGG + Intronic
1119867672 14:77987665-77987687 TACCCTTTGTGGCAATTTCAGGG - Intergenic
1120532125 14:85644570-85644592 GCCACCTTTTGCAAATTTCTGGG + Exonic
1121941358 14:98073927-98073949 CCCTCCTTTTGCAAATTTCAAGG - Intergenic
1122266736 14:100550201-100550223 GCCCCTTCTGGCCACTTGCAGGG + Intronic
1122516004 14:102309035-102309057 TTCCCTATTTGCCAATGTCAAGG + Intergenic
1122753263 14:103955458-103955480 TGCTCTTTTTGCCAATTTGATGG + Intronic
1123196963 14:106626313-106626335 GTCCCTGTTGGCCAATTTCTGGG - Intergenic
1123198305 14:106638184-106638206 GTCCCTGTTGGCCAATTTCTGGG - Intergenic
1128995352 15:72290736-72290758 GCCCCTTCCTGCTAATATCAAGG + Intronic
1130065284 15:80597623-80597645 CCTCCATTTTGCCACTTTCAAGG - Exonic
1130096420 15:80859539-80859561 GGCCCTTGTTTCCAGTTTCAAGG + Intronic
1130157047 15:81359826-81359848 GCACCATTTTGAGAATTTCAAGG + Intronic
1131400300 15:92119897-92119919 ACCCCTTCTTGCCATCTTCATGG - Intronic
1131704061 15:94973298-94973320 CCCCCTTTTTGCCTGTTTCTTGG - Intergenic
1133190569 16:4130725-4130747 GCCCCTTTCAGCTAATTCCAGGG - Intergenic
1134884333 16:17776335-17776357 GCCCTTATAGGCCAATTTCATGG - Intergenic
1135094270 16:19551537-19551559 GACCCTTTTTGTAAATGTCAAGG + Exonic
1142386295 16:89767034-89767056 GCCGCTTTGTGCCCATCTCAGGG - Intronic
1144085450 17:11804577-11804599 GCCAATCTTTGCCAATTTAATGG - Intronic
1144192391 17:12858528-12858550 GCCCCCTTTTGCTACTTTCAAGG - Intronic
1146949700 17:36897359-36897381 GCCCCATTTTTCTAATTACAGGG - Intergenic
1149485178 17:57036972-57036994 GCTCCTTTCTGCCATTTTCCAGG - Intergenic
1151179151 17:72313181-72313203 TCCTCCTCTTGCCAATTTCAAGG + Intergenic
1155249870 18:23944277-23944299 TCCCCTTATGGCCAATTTCCAGG + Intronic
1158393742 18:57063788-57063810 TTGCCTTTCTGCCAATTTCAGGG - Intergenic
1164158679 19:22612216-22612238 TCCCCTTATTGCCAATGCCAGGG + Intergenic
1164699233 19:30271134-30271156 GCCCCTCTTTGCCTATTGCATGG - Intronic
926631768 2:15143138-15143160 ACCCCTTTTTGCCACCTACAGGG + Intergenic
927266823 2:21161566-21161588 GCCCCTTTTTGCCATGTTGCAGG - Intergenic
929822944 2:45287981-45288003 GCTCCCTTTTGCCTATGTCATGG - Intergenic
936720556 2:115247481-115247503 TCCTCTTTTTGCTCATTTCAGGG - Intronic
937636586 2:124162973-124162995 CCCCTTTTTTGTCAACTTCAAGG - Intronic
940565856 2:155358913-155358935 GCCCCTTTTAGGAAATTTAAGGG - Intergenic
942734853 2:179097641-179097663 TCACCTTGTTGCCACTTTCAGGG + Intergenic
944474734 2:200092179-200092201 GCCCTGTTTTGCCAATTCAATGG - Intergenic
945167800 2:206964721-206964743 GCTCCTTTTTCCCAGTTTCAGGG + Intronic
947009702 2:225552148-225552170 GCCTCATTTGTCCAATTTCATGG + Intronic
1169929115 20:10812819-10812841 GCCCCTTCTTGCTGATATCAGGG - Intergenic
1170024332 20:11872709-11872731 CCCCCTTCATCCCAATTTCAAGG + Intergenic
1172680615 20:36711597-36711619 GCCCCTTTGTGCTCATGTCAGGG - Intronic
1174927378 20:54775223-54775245 GCCTCATTTTGCAAGTTTCATGG - Intergenic
1177125675 21:17191122-17191144 GTGCCTTTTAGCCAATTTAATGG + Intergenic
1181756577 22:25028722-25028744 GCCCGTGTCTGCCATTTTCACGG + Exonic
1184862146 22:47178429-47178451 GCCCATTTTTATCAATTTCCAGG - Intergenic
956626237 3:71269631-71269653 GCTCTATTTTGCAAATTTCACGG + Intronic
959410837 3:106019143-106019165 GCCCCTCATTGCCAAGGTCATGG - Intergenic
960920466 3:122741846-122741868 GCCCCTTTTTGCCAATTTCATGG - Intronic
963601368 3:147381467-147381489 GCCCCTGTATGCCTATTTCAGGG + Intergenic
966616361 3:181917605-181917627 GCCCATTTTTTCCAATATCATGG - Intergenic
969206405 4:5650262-5650284 TCCCCTTTTTGCCTCTTCCAGGG - Intronic
970733186 4:19133179-19133201 GCCCCTCTTTTACTATTTCAAGG + Intergenic
970971215 4:21986446-21986468 GCCCCTTCTTGCCAGATTTAAGG + Intergenic
986478056 5:8156028-8156050 GCAACTCTTTGCCAATTTAAGGG - Intergenic
987551030 5:19381805-19381827 GGCCCCTTTTTCAAATTTCATGG + Intergenic
989275052 5:39579114-39579136 GCCCTTTTTTTCCACTTTGATGG - Intergenic
989991243 5:50769367-50769389 TCCCATCTTTGCCAATTTTATGG - Intronic
991225320 5:64264093-64264115 TCCCCTTTTTCACAATTTGATGG + Intronic
991426073 5:66493166-66493188 GCCCCTTATTGCCAAGCTGAGGG - Intergenic
991448286 5:66723960-66723982 ACCCCTCTTTGCCAAATACATGG + Intronic
992089387 5:73303785-73303807 CCCCCTCTTGGCCAATTTCCGGG - Intergenic
993038898 5:82789517-82789539 GGCCCCTTTTGCCATCTTCAAGG - Intergenic
1000908616 5:166994274-166994296 GCCCCTTTCTGGGAATTTGAAGG - Intergenic
1001779069 5:174351963-174351985 TCCCCTCTTTGCCATTTCCATGG - Intergenic
1002795831 6:470545-470567 GCACCTTGGTGCCATTTTCAAGG + Intergenic
1005324886 6:24690367-24690389 GCCCCCTTTTCCCAGGTTCAAGG + Intronic
1005732762 6:28714608-28714630 TCCCCTTCTTTACAATTTCAAGG + Intergenic
1010504665 6:76642458-76642480 GCCCCTTTTGTCCATTTTCAAGG - Intergenic
1010591343 6:77716576-77716598 CCCCTTTTTTGCCAATCCCAGGG - Intronic
1011824109 6:91286509-91286531 ACCTCTTTTTGTCATTTTCAGGG + Intergenic
1013237649 6:108212131-108212153 GCCCCTTCTTGCCAAATTTCAGG + Exonic
1013854161 6:114551924-114551946 CTCCATTTTTACCAATTTCAAGG + Intergenic
1026180489 7:68035176-68035198 GCCAATTTTTGTCATTTTCATGG + Intergenic
1027484712 7:78746997-78747019 CTCCCTTTTTGACAATTTGAAGG - Intronic
1027859761 7:83562580-83562602 GTCCATGTCTGCCAATTTCAGGG - Intronic
1028158970 7:87464402-87464424 GTCCCTTTGTGACAATTTTAGGG - Intronic
1029032122 7:97479506-97479528 GCCCCTTTTTTCAAGTTTCCAGG - Intergenic
1032633790 7:133683699-133683721 GTCTCTTTTTTCCAATTTCGGGG + Intronic
1036577768 8:10044620-10044642 GGTCCTTTTTGCCAACTTTAGGG - Intergenic
1037805348 8:22055534-22055556 GCCCCTTTCTGCCACATTGAAGG + Intronic
1038186401 8:25278741-25278763 GCCCCTTATTGCTGACTTCATGG + Intronic
1042936304 8:74062048-74062070 GATACTTTTTGCCAATTTTATGG + Intergenic
1042977357 8:74484664-74484686 GCCCATTTTTGCCAGTTCCCAGG - Intronic
1044998997 8:97864013-97864035 ACCACTTTGTGCCAATTTCTAGG + Intergenic
1046858708 8:119066158-119066180 GTCCTTCTTTTCCAATTTCAAGG + Intronic
1051435711 9:17028958-17028980 GCACATTTTTGCCTATTTCCTGG + Intergenic
1052212326 9:25920435-25920457 TGCTCTTTTTACCAATTTCAAGG - Intergenic
1053025589 9:34725892-34725914 GTCCCTGGTTGCCACTTTCATGG - Exonic
1053037117 9:34834954-34834976 GTCCCTGGTTGCCACTTTCATGG - Intergenic
1056115999 9:83441860-83441882 GCCTTTTTTTGGCAGTTTCAAGG - Intronic
1056700039 9:88895793-88895815 ACCCCTTTTGGCCAATTTGCTGG + Intergenic
1059749518 9:117234807-117234829 GCCCCTTGGTGGCCATTTCAAGG + Intronic
1060551055 9:124485620-124485642 GCACCTTTATGCCAATTACATGG + Intronic
1186858647 X:13649506-13649528 GCCCCTTATTACCCATTCCATGG - Intergenic
1187094910 X:16137566-16137588 TCCTCTTTTTGACAATTTTAAGG - Intronic
1192065279 X:67878697-67878719 GCTGCTTTTTGCCATTTGCAAGG - Intergenic
1194013277 X:88587594-88587616 GCCCCTTCTTCTCAATTTCTTGG - Intergenic
1201685580 Y:16698158-16698180 GCTCCTTTCTGCACATTTCATGG - Intergenic
1202279530 Y:23166640-23166662 TCACCTTTTTCCCAATTTTATGG + Intronic
1202284902 Y:23230192-23230214 TCACCTTTTTCCCAATTTTATGG - Intronic
1202432662 Y:24802711-24802733 TCACCTTTTTCCCAATTTTATGG + Intronic
1202437305 Y:24855427-24855449 TCACCTTTTTCCCAATTTTATGG - Intronic