ID: 960925330

View in Genome Browser
Species Human (GRCh38)
Location 3:122790291-122790313
Sequence CTGCTCTTCTCTGGATTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 213}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960925325_960925330 11 Left 960925325 3:122790257-122790279 CCCTCTTCGTCACTTCAGCATTT 0: 1
1: 0
2: 1
3: 15
4: 200
Right 960925330 3:122790291-122790313 CTGCTCTTCTCTGGATTCAATGG 0: 1
1: 0
2: 2
3: 18
4: 213
960925324_960925330 20 Left 960925324 3:122790248-122790270 CCATGATTTCCCTCTTCGTCACT 0: 1
1: 0
2: 0
3: 19
4: 260
Right 960925330 3:122790291-122790313 CTGCTCTTCTCTGGATTCAATGG 0: 1
1: 0
2: 2
3: 18
4: 213
960925326_960925330 10 Left 960925326 3:122790258-122790280 CCTCTTCGTCACTTCAGCATTTC 0: 1
1: 0
2: 1
3: 23
4: 204
Right 960925330 3:122790291-122790313 CTGCTCTTCTCTGGATTCAATGG 0: 1
1: 0
2: 2
3: 18
4: 213
960925323_960925330 21 Left 960925323 3:122790247-122790269 CCCATGATTTCCCTCTTCGTCAC 0: 1
1: 0
2: 0
3: 3
4: 126
Right 960925330 3:122790291-122790313 CTGCTCTTCTCTGGATTCAATGG 0: 1
1: 0
2: 2
3: 18
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960925330 Original CRISPR CTGCTCTTCTCTGGATTCAA TGG Intronic
904453620 1:30632966-30632988 CTGTTCTTCTCTGGCTCCATGGG + Intergenic
906102741 1:43273500-43273522 CAGCTCTTCTGTGGATTGCATGG + Exonic
906649533 1:47502961-47502983 CTGCCCTTCGCTGGCTTCAGAGG + Intergenic
906785081 1:48608504-48608526 CTGTTCTTGTCTGTATTCACAGG - Intronic
907509265 1:54946217-54946239 CTGCTCTTCCCTGGACCCACTGG - Intergenic
908011061 1:59777743-59777765 CTGCTCTGCTCTGTATTTCAGGG - Intergenic
908556799 1:65264586-65264608 CTCCTCATCTCTGAATTGAAAGG - Intronic
909145085 1:71920003-71920025 CTGCTCCTCTCAGTATTGAATGG + Intronic
910770441 1:90825583-90825605 CTGCTCTCATCTGGACTCACAGG + Intergenic
911062579 1:93760904-93760926 TTGCTCCTCTCTGGCCTCAAAGG - Intronic
912497449 1:110100682-110100704 CTGCTACTCTCTGGGTTCCAGGG + Intergenic
915934229 1:160081491-160081513 CTGCTCCTCTCTTGTTTCCACGG - Intergenic
917031984 1:170702953-170702975 CTGTTCTTCTCTTGATCAAATGG - Intronic
917189849 1:172403439-172403461 CTGCTCTTCTTTGGATTAGCTGG - Intronic
918590373 1:186234442-186234464 CTGCTCTTGTCTGGGTTGAAAGG + Intergenic
919911316 1:202112771-202112793 CTGCCCTTCTCTGGAGTTGATGG - Intergenic
924709851 1:246522912-246522934 CTCCTCATCTCTGGAATCACAGG - Intergenic
1065788795 10:29241391-29241413 CTGATCTGCTCTGGCTCCAATGG - Intergenic
1065833207 10:29633311-29633333 CTGCTCTTCTTTGGAGACAGAGG + Intronic
1068192079 10:53666006-53666028 CTCCGCTTCCCTGGGTTCAAGGG + Intergenic
1068739045 10:60448097-60448119 CTGTTCTTCTCTGGATTCTCAGG - Intronic
1070018849 10:72563740-72563762 CTCATCGTCTCTGGTTTCAATGG - Intronic
1071310756 10:84341550-84341572 CTGTTCTTCACTGGAGTCTATGG - Intronic
1071950995 10:90702382-90702404 CTGGTCTCCTCTGCTTTCAAGGG + Intergenic
1073047753 10:100650836-100650858 CTGCTCTTATTTGGATTAATTGG + Intergenic
1073135604 10:101218458-101218480 TTTCCCATCTCTGGATTCAAAGG - Intergenic
1075317388 10:121463928-121463950 CAGCTCTACTCAGGAGTCAAGGG + Intergenic
1075572803 10:123557729-123557751 CTGCTCTTCACCTGAGTCAAGGG + Intergenic
1075905049 10:126073740-126073762 GTGCTCCTCTGTGGATGCAAAGG + Intronic
1077459836 11:2703545-2703567 CGGCTTTTCTCTTGATTCCAAGG + Intronic
1077478179 11:2800770-2800792 CTGCTCTTCTCCGTGCTCAATGG - Intronic
1077542215 11:3152119-3152141 CTGCTCATCTCTCTATTTAAGGG + Intronic
1078141440 11:8696114-8696136 CTCCTTTTCTCTGGATAGAAGGG + Intronic
1078526630 11:12106424-12106446 TTGCCCTTCTCTGGAATCTATGG + Intronic
1079248178 11:18768720-18768742 CTGCTCTTCCCTGTAGTCGAAGG + Intronic
1080814363 11:35739678-35739700 CAGCTATTCTGTGGAGTCAAAGG - Intronic
1083051412 11:59780083-59780105 CTGCTCTTCTCTGTATCACAGGG + Intronic
1084024540 11:66439733-66439755 TTGCTCTCCTCATGATTCAAAGG - Intronic
1086188166 11:84044795-84044817 GTGCTCTTCTCTGGATTTAATGG + Intronic
1086501813 11:87461497-87461519 CTGCTCTTCTGTGTACCCAAAGG + Intergenic
1087018586 11:93579141-93579163 CTGCTCTTATCAGGGTTAAATGG + Intergenic
1087059797 11:93966467-93966489 CTGCTTCTCTCTGACTTCAATGG + Intergenic
1088744996 11:112797754-112797776 AGGCTTTTCTCTGGACTCAAAGG - Intergenic
1090427755 11:126620917-126620939 CTTCTCTTCTCTGGACTCATAGG + Intronic
1091173751 11:133541624-133541646 CTACTCTTCTCTGAATGAAAAGG + Intergenic
1091594843 12:1870554-1870576 ATGCAGTTCTCTTGATTCAAGGG + Intronic
1091912395 12:4242959-4242981 CTGTTTTCCTCTGGTTTCAATGG + Intergenic
1092309699 12:7339121-7339143 TTGCTCTTCTCTGGTCTCCAAGG + Intergenic
1092892986 12:12986595-12986617 CTGCTATTCTCTACAGTCAAGGG + Intronic
1094771251 12:33662761-33662783 CTGCTTCCCTCTGGATTCACTGG - Intergenic
1095195553 12:39311416-39311438 CTCCTCTTCACTGGATCAAAAGG - Exonic
1096490995 12:52012964-52012986 CTGCTCTTCCCTGAATTGACTGG + Intronic
1096806072 12:54141766-54141788 CTTCTCTTCTCTGGATGTGAAGG - Intergenic
1099384366 12:81997154-81997176 CTGCCCTTCTCAGGATGGAAAGG - Intergenic
1101286781 12:103322230-103322252 CTTCCCTTCTCTGGCTGCAATGG + Intronic
1103071533 12:117947628-117947650 CTTTTCTTCCCTGGATTCCATGG - Intronic
1103331528 12:120157811-120157833 CTGCTCTCCTCTTGGTTTAAAGG - Intronic
1106546799 13:30737801-30737823 GGGCTCTTCTGTGGTTTCAAAGG - Intronic
1107102509 13:36609464-36609486 CTGCCCTTCTTGGGATTCTAGGG - Intergenic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1107903675 13:45043031-45043053 CTGCTCTTCTCTGGGTTTGGAGG - Intergenic
1108453621 13:50590979-50591001 CTGCTCTTCTCTGACTTCGCTGG - Intronic
1108571648 13:51757501-51757523 CTGCTCTTATCATGCTTCAAGGG - Intronic
1109207192 13:59495683-59495705 CTGCTTCTCTCTTGATTCTAGGG + Intergenic
1109784503 13:67156347-67156369 GTGCTCCTCTCTCGCTTCAACGG - Intronic
1110687475 13:78392154-78392176 CCTTTCTCCTCTGGATTCAATGG - Intergenic
1114715341 14:24818412-24818434 ATGCCCTTCTCTGGATTCAGGGG + Intronic
1115201742 14:30861266-30861288 TTTCTCTTCCCTGGATTTAAAGG - Intergenic
1117343073 14:54808123-54808145 CTGCTCCTCCCCGGAATCAAGGG + Intergenic
1117968328 14:61228197-61228219 CTTCTCTCCTCGGGATTCAATGG - Intronic
1118598965 14:67458093-67458115 CAGCTCTCCTCAGGTTTCAAGGG - Intronic
1118727029 14:68636212-68636234 CTCCTGTTCTCTGGAATCAGAGG - Intronic
1119010174 14:70977418-70977440 ATGCTTTTCTCTGCTTTCAAAGG - Exonic
1119830407 14:77697099-77697121 CTGCTCTTCTTTGGGGTCCATGG - Intronic
1120547022 14:85824700-85824722 GTGCTCCTCTTTGTATTCAAAGG + Intergenic
1123926109 15:25113019-25113041 CTGCTCTCTTCTGGATTCGCTGG - Intergenic
1128705510 15:69835038-69835060 CTGCTCTTTTGTGGCTGCAAAGG + Intergenic
1130393322 15:83478984-83479006 CTACTCTTCTCTGGGTTCCTGGG + Intronic
1130828728 15:87577576-87577598 ATGCTCCTCTCTGGTTTCAGAGG + Intergenic
1130931233 15:88429494-88429516 CTGCTCTTCTCTGGGACAAAGGG + Intergenic
1133530453 16:6650715-6650737 TTGTTCCACTCTGGATTCAAAGG + Intronic
1133535396 16:6697646-6697668 TTGCTCACCTCTGGATTAAAAGG + Intronic
1134174494 16:11994768-11994790 GTACTCTCCACTGGATTCAAAGG + Intronic
1138315754 16:56068596-56068618 CTGCTCTTCTCTGAATCACAGGG - Intergenic
1138938322 16:61758514-61758536 CTTCTGCCCTCTGGATTCAAGGG + Intronic
1145289476 17:21531871-21531893 CTGCTTTTCTATGGTTTCCATGG - Exonic
1150006183 17:61470375-61470397 CTGCTCTTCTCTGAAGTCTGAGG + Intronic
1151975997 17:77483795-77483817 CTGTTCTTCTCAGGGTTGAAAGG - Intronic
1152583912 17:81180728-81180750 CTGCTCTCCTCTGGATAGAGAGG - Intergenic
1152909618 17:82993286-82993308 CTGCTCTTTTCTGGTTCCATTGG - Intronic
1153653302 18:7260664-7260686 ATATTCATCTCTGGATTCAAGGG + Intergenic
1157561310 18:48648385-48648407 CTGCTGTTCTCCTGCTTCAAAGG + Intronic
1157628057 18:49068163-49068185 TGGCTTTTCTCTGCATTCAAGGG - Intronic
1160033777 18:75283212-75283234 CAGCTCCTCTGTGGATTCAGAGG - Intronic
1160153250 18:76411511-76411533 CTGCTCTCCTCTGAATGCCATGG - Intronic
1161730725 19:5959053-5959075 CTGGTCTGCTCTGGAGTCCAGGG + Intronic
1163541326 19:17912538-17912560 GTGCTATTCTCTGAATTCATGGG + Intergenic
1165352150 19:35281452-35281474 CAGCTCTGCTCTGTATTCAGGGG - Intronic
1166143139 19:40816239-40816261 CTGCTTTTCTCTGTATTTAAGGG + Intronic
1166184426 19:41130601-41130623 CTGCTCTTCTCTGTATTTAAGGG - Intergenic
1166713081 19:44949416-44949438 CTGCTTTTCTGAGGACTCAAGGG + Exonic
1168465864 19:56600733-56600755 CTGCTTTTCTTTTGTTTCAAGGG + Intronic
925891191 2:8436231-8436253 CTGCTCTTTTGTGCATTGAATGG - Intergenic
926825796 2:16903852-16903874 CTGGTCTTCCCTTCATTCAAGGG + Intergenic
928243846 2:29610084-29610106 ATGCTCTTTTCTGGGTTCACAGG - Intronic
928932738 2:36640964-36640986 CTGCTCTTTTTTGGTTTCTATGG - Intronic
932951116 2:76294762-76294784 CTGTTATTCTCTGAATTCCAGGG + Intergenic
933935620 2:87201359-87201381 CTCATCTTCTCTAGATCCAACGG - Intergenic
935802725 2:106714815-106714837 CTTCTCTTCTCTGCCTTCTAAGG + Intergenic
935977569 2:108594013-108594035 CTGCTATTGTCTGAATTTAAAGG - Intronic
936357530 2:111764466-111764488 CTCATCTTCTCTAGATCCAACGG + Intergenic
937301000 2:120841757-120841779 CTGCTCTGCACTGGAATCTAGGG - Intronic
939967725 2:148626798-148626820 CTGCTCGTCTCTAGATCCAGTGG - Intergenic
940130365 2:150374552-150374574 CTGCTCCTCTCTACATGCAAAGG - Intergenic
940656016 2:156489018-156489040 CTCCTCTTTTCTGGCTTCAATGG + Intronic
942367836 2:175247302-175247324 CAGCTCTTATCTGGGTGCAATGG - Intergenic
943196632 2:184760627-184760649 ATGCTCTTCTCTTGCTTCAAGGG + Intronic
944597314 2:201272885-201272907 CTGCTTCTCTCTGAATTAAAAGG - Exonic
945903816 2:215568524-215568546 CTGCTCTTCTCTGTACTGCAGGG + Intergenic
946050135 2:216855592-216855614 CTGCTGTTCTCTTGTTTCAAAGG + Intergenic
946184703 2:217973632-217973654 CTGGTCTGCTCTGGGTTAAATGG - Intronic
946308654 2:218871006-218871028 CTGCTATTCTCTGCTTTCCAGGG + Exonic
948111865 2:235462792-235462814 CTGCTCATACCTGGATTCCACGG + Intergenic
948667306 2:239544759-239544781 CTGCTCTTTTATGTATCCAATGG + Intergenic
1169789200 20:9391844-9391866 CTGCTCTTCTCTGCCTTCCAGGG + Intronic
1171265221 20:23766196-23766218 TCTCTCTTCTCAGGATTCAAGGG + Intergenic
1172808490 20:37630583-37630605 CTTCATTTCTCTGGATGCAAGGG + Intergenic
1174075105 20:47929700-47929722 CTGCTCTTCCTTTGATTCTAGGG + Intergenic
1175713125 20:61236902-61236924 CACCTCTTCTCTGAATCCAAGGG - Intergenic
1178677487 21:34643505-34643527 CTGTTTTTCTCTGGACTCATTGG + Intergenic
1178944946 21:36939309-36939331 CTCCTCTTCTCTGTTTTTAAAGG - Intronic
1179720549 21:43313897-43313919 TTGCCCTTCTCTGGACTCAGTGG + Intergenic
1180222256 21:46366375-46366397 CTGGGCTTCTCTGGCTTCATGGG + Intronic
1182665534 22:31956521-31956543 CTGCTCTTTGCTGATTTCAAAGG - Exonic
1184679528 22:46062712-46062734 CTGCTCATCTTTGGAGGCAAAGG - Intronic
1185219057 22:49619974-49619996 CTGTTCTGCTGTGGATTCACAGG + Intronic
949922492 3:9013948-9013970 CAGCTCTACTCTTGATTCCAGGG + Intronic
950154208 3:10709435-10709457 CTGCTCTTCTCTCTGTTGAAGGG + Intergenic
950677174 3:14561344-14561366 CTGCTATTCTCTGGCCTCCATGG + Intergenic
952098864 3:29987976-29987998 CAGCTCCTCTCTGTATTGAAAGG - Intronic
953665877 3:44926183-44926205 CTGCCCTTCTCAGGCCTCAAGGG + Exonic
955912739 3:63874532-63874554 CTCCTCTTCCCTGACTTCAAAGG - Intronic
958252495 3:91286784-91286806 CTCTAGTTCTCTGGATTCAAGGG - Intergenic
960396988 3:117149861-117149883 CTGCTGTTCTCTTGATACCATGG + Intergenic
960925330 3:122790291-122790313 CTGCTCTTCTCTGGATTCAATGG + Intronic
962381757 3:134903846-134903868 CTTCTCTCCTGTGGATTCACTGG - Intronic
964780340 3:160330295-160330317 TTGCTCTTCTCTTGAAACAATGG - Intronic
965554105 3:170001938-170001960 CTGCTTTTCTCAGGAGGCAATGG + Intergenic
967976811 3:195040108-195040130 CGGCTCTGCACTGGTTTCAAAGG + Intergenic
972830813 4:42811790-42811812 CTGCTCTTCTCTGGGTCTAATGG - Intergenic
974812477 4:66962584-66962606 CCGCTCTTGTCAGGATCCAAGGG + Intergenic
975493389 4:75012626-75012648 CTCCTCTTCTCTGGACTCTATGG - Exonic
975730643 4:77334239-77334261 CTGCTGTTCTCTGAAGTTAAAGG - Intronic
977938629 4:102834189-102834211 CTGCTCTTCTCTGTAGAAAAGGG - Intronic
978213901 4:106174105-106174127 CTGCTCTTCTCTCACTTTAATGG + Intronic
978914052 4:114101978-114102000 CTCCTCTTCCCAGGATACAAAGG + Intergenic
979218834 4:118197631-118197653 CTGCTCTTTTTTGGTTTCCATGG + Intronic
982892635 4:160875457-160875479 CTGGTCAACTCTGGATTTAAAGG + Intergenic
983359198 4:166706611-166706633 CTGGTCTCCTCTTCATTCAAAGG - Intergenic
983723846 4:170893570-170893592 CTGGACTTCTGTGGATTCACAGG + Intergenic
984069637 4:175094655-175094677 CAGATCTTCTCAGGATCCAAAGG - Intergenic
986273799 5:6256335-6256357 CTGCTCCTTTCTGGATTAAGTGG - Intergenic
989096494 5:37786495-37786517 TTAATCTTTTCTGGATTCAAAGG - Intergenic
990536455 5:56727992-56728014 CTGCCCTTCTTTGGAATCACTGG - Intergenic
995966661 5:117915614-117915636 GAGCTCTTCTCTGCATTCAAAGG + Intergenic
996927784 5:128848728-128848750 CTGCTCTTTTTTGGCTTCATTGG - Intronic
997832922 5:137167136-137167158 CTGCTCTTTTATGGCTTCCATGG - Intronic
998432718 5:142080409-142080431 CTGCTTTTGTCTTGATTCCAGGG + Intergenic
1001055736 5:168448241-168448263 CTGCTCATCTCTGGAGTCTTGGG + Intronic
1001378558 5:171286324-171286346 CTGCTCTCCCCTGGAATCACTGG - Intronic
1006979213 6:38133145-38133167 CTTCTCTTCTGTGGAGTCCATGG + Intronic
1008381097 6:50840582-50840604 CAGCTCTTCCCTGGATCCGAAGG + Intronic
1008492579 6:52101679-52101701 CTGACCTTCTCAGGTTTCAAAGG + Intergenic
1009191986 6:60640139-60640161 CTCTAGTTCTCTGGATTCAAGGG + Intergenic
1009534478 6:64862274-64862296 CTGCAATTCTCTGAATTCATTGG + Intronic
1009678946 6:66865956-66865978 CTGCTGTTGTCTGTATTCACAGG - Intergenic
1009924361 6:70102148-70102170 CTATTCTTCTTTGGTTTCAAGGG + Exonic
1010325532 6:74558097-74558119 CTGGTCTTCCCTTCATTCAAGGG + Intergenic
1012184943 6:96201672-96201694 CTGATTTTCTCTGTATTCCAAGG + Intronic
1012342391 6:98143153-98143175 CTTCTCTTCTATGGATTAACAGG + Intergenic
1013054490 6:106570218-106570240 CTGATCTTCTCTGGAGTCTATGG + Exonic
1014345004 6:120258243-120258265 CAGCTCTTCTGTGACTTCAAAGG - Intergenic
1014865015 6:126518669-126518691 CTGCTCTTTTGTGGATCCACTGG + Intergenic
1015166809 6:130207919-130207941 CTGCTCTTCTCTGCACTCATAGG + Intronic
1018153269 6:160960709-160960731 CTGAACTTCACTGGTTTCAAGGG - Intergenic
1019205894 6:170361517-170361539 CTGCTGTTTTCTGGATACCAAGG + Intronic
1019353315 7:565333-565355 CTGCTCTCCTTTGGATCCGAGGG - Intronic
1022892771 7:34717882-34717904 CTGCCCTTCTCTTTACTCAAAGG + Intronic
1023477156 7:40593169-40593191 CTCCCCTGCTCTGGATTCCAAGG - Intronic
1023858958 7:44205515-44205537 CTGCTCTTTTCTGATTTCAGGGG + Intronic
1025614559 7:63106681-63106703 CTGCTCCTCACTGGAATCAAGGG - Intergenic
1026112657 7:67470537-67470559 CTGCTCTCTTCTGTTTTCAAAGG - Intergenic
1027452068 7:78343534-78343556 CTTCTGTTTGCTGGATTCAATGG - Intronic
1028955039 7:96679809-96679831 CTTCTGATCTCTTGATTCAATGG + Intronic
1030377137 7:108766349-108766371 CTGCTTTTCTCTGGTTTTAATGG - Intergenic
1033437052 7:141342649-141342671 TTGCTCTTCTCTCTGTTCAAGGG - Intronic
1034361577 7:150504133-150504155 CTGCTCCTCATAGGATTCAAAGG + Intergenic
1034673826 7:152877207-152877229 ATGCTCTTCTGTGGAGTAAATGG + Intergenic
1034883144 7:154777731-154777753 CTGCTCTTCTCCTGATTCCCTGG + Intronic
1035103082 7:156417226-156417248 CTCCTGTTCTCTGCTTTCAAAGG - Intergenic
1036634343 8:10538647-10538669 CTCCTTTTCTCTGCATTGAAGGG - Exonic
1038146808 8:24904923-24904945 CTTATCTTCTCTGGTTTCTAGGG - Intergenic
1038467692 8:27779960-27779982 CTGCTGTACTCTGGCTTTAAAGG + Intronic
1039187413 8:34932762-34932784 CTTCTCTTCTCTACATTCATAGG - Intergenic
1041757529 8:61330724-61330746 CTGCTATTTTCTGGATCCCATGG + Intronic
1043204948 8:77426332-77426354 CTTCTCTTCTGTGCATTCACAGG - Intergenic
1044181304 8:89198664-89198686 CTCTTCATCTCTGGTTTCAATGG + Intergenic
1045266191 8:100620529-100620551 CTGCTCTCTTCTACATTCAAAGG + Intronic
1045753788 8:105517560-105517582 CTACTCTTGGCTGGATGCAATGG + Intronic
1046595550 8:116257103-116257125 CTGCTCTTCTCTGGAAAGCAGGG + Intergenic
1047777127 8:128081665-128081687 CTGCTCTTCTATGGCTTCCATGG + Intergenic
1050766595 9:9142196-9142218 CTGCTCTTCTAGGGCTTCTATGG - Intronic
1051909186 9:22133452-22133474 CTGCTCTTCCCTACATTGAATGG - Intergenic
1052378102 9:27740949-27740971 CTTCTCGTCTCTGGTTTCAGAGG + Intergenic
1052839108 9:33276360-33276382 TTGCTCATGTCTAGATTCAAAGG + Intronic
1053158040 9:35793560-35793582 CTGCCCTTCCCTGGGCTCAAAGG - Intronic
1056052507 9:82784166-82784188 CTCCTCTTCTGTGGCTTCTAAGG + Intergenic
1056433033 9:86547501-86547523 CTGCCCTTGTCTGTATTCACAGG + Intergenic
1056520390 9:87395718-87395740 CTGCTCTTCTCACCCTTCAAAGG + Intergenic
1057740461 9:97706757-97706779 CTGCTGGTCCCTGGATGCAAAGG - Intergenic
1060137720 9:121173523-121173545 CTGCTATTCTCTGGGTTCGTAGG + Intronic
1061192006 9:129087622-129087644 CGGCCCTTCTCTGGGTTCAGAGG + Intronic
1061709841 9:132480113-132480135 CTCCTCTTCTCTGGCCTCAGTGG - Intronic
1187675093 X:21708346-21708368 ATATACTTCTCTGGATTCAATGG - Intronic
1188897997 X:35694170-35694192 TTGCTTTTCTCTGTATTGAATGG - Intergenic
1191860219 X:65660087-65660109 CTGCTCTGCTCTGGAGACAGGGG + Intronic
1196629786 X:117925506-117925528 CTGCTCTTCATTTTATTCAAAGG + Intronic
1198233528 X:134715661-134715683 CTGCTCTTGTCTGCCTTGAATGG + Intronic
1198511270 X:137354216-137354238 CTGCTCTCCTCCGGTTGCAAGGG - Intergenic
1199457960 X:148050596-148050618 ATGCTCTTCTTTCGATTCATTGG + Intergenic
1200086193 X:153607410-153607432 CAGCTCTTCTCCAGATTCATGGG - Intergenic
1200248818 X:154541476-154541498 CTGCTCTCCTCAGGACTCAGGGG + Intronic
1201396526 Y:13554701-13554723 CTCCTCTTCTCTGGGTCCCATGG - Intergenic
1201960830 Y:19679340-19679362 CTGCTGTTCTTTGGTTTCGAGGG - Intergenic