ID: 960925424

View in Genome Browser
Species Human (GRCh38)
Location 3:122791341-122791363
Sequence AACTGAAAGAAGTTGGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960925424_960925429 13 Left 960925424 3:122791341-122791363 CCTGACACCAACTTCTTTCAGTT 0: 1
1: 0
2: 2
3: 24
4: 186
Right 960925429 3:122791377-122791399 ATGCTTTCTCCTTTTGCCTCTGG 0: 1
1: 0
2: 1
3: 54
4: 412
960925424_960925430 19 Left 960925424 3:122791341-122791363 CCTGACACCAACTTCTTTCAGTT 0: 1
1: 0
2: 2
3: 24
4: 186
Right 960925430 3:122791383-122791405 TCTCCTTTTGCCTCTGGACTTGG 0: 1
1: 0
2: 2
3: 39
4: 330
960925424_960925432 24 Left 960925424 3:122791341-122791363 CCTGACACCAACTTCTTTCAGTT 0: 1
1: 0
2: 2
3: 24
4: 186
Right 960925432 3:122791388-122791410 TTTTGCCTCTGGACTTGGCATGG 0: 1
1: 0
2: 2
3: 12
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960925424 Original CRISPR AACTGAAAGAAGTTGGTGTC AGG (reversed) Intronic
902602149 1:17547263-17547285 ATCTGCAAGAAGGTGGTGTTGGG - Intronic
906926065 1:50118182-50118204 ATCTGAAGTAAGTTGGTTTCTGG - Intronic
906992019 1:50749274-50749296 GAGTGTAAGAAGGTGGTGTCAGG - Intronic
908162837 1:61427848-61427870 AACTGAAAGAATTTTGTGAGAGG - Intronic
910719612 1:90271761-90271783 AACTGAATCAAGCTGCTGTCAGG + Intergenic
910899967 1:92109676-92109698 AACAGAAAGATGTTTGAGTCTGG - Intronic
910967435 1:92822073-92822095 AACCTAAAGAAGGTGGTCTCAGG - Intergenic
911806411 1:102213925-102213947 ACCTGAAAGAAGCTGGAGTGAGG + Intergenic
912969989 1:114272084-114272106 AACTTTAAGAAGTCAGTGTCTGG - Intergenic
914907998 1:151762487-151762509 AATTGACAGATGTTGGAGTCCGG - Exonic
915302074 1:154957395-154957417 AACTGAGAGAAGTGGGGGTAGGG + Exonic
916993328 1:170268239-170268261 ACCTGAAGGAATTTAGTGTCAGG - Intergenic
917793245 1:178513274-178513296 TACTGAATGGAGATGGTGTCGGG + Intronic
918257198 1:182759389-182759411 AACTGACAGAAGCTGCTTTCTGG + Intergenic
919652292 1:200162404-200162426 AACTGAAAGAAGTTGGTGGGTGG + Intronic
921311324 1:213846537-213846559 AACTAAAAGAAATTGGCTTCAGG - Intergenic
923637260 1:235711424-235711446 AGCTTTAAGAAGTTGGTGTTGGG - Intronic
1063720342 10:8574221-8574243 AACTGAGATAAGTTGGTGAAAGG + Intergenic
1064137001 10:12759496-12759518 AGAGGAGAGAAGTTGGTGTCAGG + Intronic
1066328270 10:34388788-34388810 AAATAAAAGAGGTAGGTGTCAGG + Intronic
1068913370 10:62402860-62402882 AACAGAGAGAAGTATGTGTCTGG + Intronic
1069665196 10:70150377-70150399 AGCTGAAAGAAGCTGCTGTGAGG - Exonic
1072033722 10:91545332-91545354 GAGTGAAAGAAGATGCTGTCTGG + Intergenic
1074675504 10:115844714-115844736 TACTGCAAGAAGCTGGTGTTAGG - Intronic
1075101505 10:119509610-119509632 AAGTCAAAGAAGTTGGGGTAGGG + Intronic
1075827170 10:125368934-125368956 ACATGAAAGATGTTGGTGTCAGG + Intergenic
1076410567 10:130246003-130246025 AACTAAAAGAATTTGGTGGCTGG - Intergenic
1077223615 11:1428089-1428111 AAGTGAAAGAAGATGGAGGCAGG + Intronic
1086734569 11:90290180-90290202 AACTGAAATTAGTTGATGTGGGG + Intergenic
1090115029 11:123960875-123960897 AAATGAGAGAAGTGGATGTCTGG + Intergenic
1091553683 12:1555726-1555748 GACAGAAAGAAGTGGTTGTCAGG - Intronic
1092869906 12:12796977-12796999 AGCAGAAAGAAGTTGGAATCAGG - Intronic
1093088563 12:14894039-14894061 AGCTCAAAGAACTTGCTGTCTGG - Intronic
1099523622 12:83693810-83693832 AACTGACAGAAGTAGGCTTCAGG + Intergenic
1101410939 12:104467708-104467730 AAGTGAAAGAAGCTGGTGGCTGG + Intronic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1105754678 13:23453362-23453384 CACTGAAACAAATTGGTCTCTGG + Intergenic
1105955449 13:25278046-25278068 AACTGAGTGAAGTTGGGGTGAGG - Intronic
1107367519 13:39699737-39699759 AAATGAAAGTTGTTGGTGACAGG - Intronic
1107386363 13:39914104-39914126 AACTGAAAGAAGTTCCTGTTTGG - Intergenic
1108964247 13:56276363-56276385 AACTTAAAGAAGTTAATATCTGG - Intergenic
1110300405 13:73919988-73920010 CACTGAGAGAATTTGCTGTCGGG + Intronic
1110484863 13:76026877-76026899 GACTGAAACAGGTTGGAGTCAGG - Intergenic
1112009241 13:95280096-95280118 TACTGTGAGAAGTTGGTGACGGG - Intronic
1114378678 14:22177207-22177229 AACTGAATAAAGTAGGTCTCAGG + Intergenic
1116150091 14:41129810-41129832 AACTCAGAGAAGTTGGTATTAGG - Intergenic
1118133999 14:63001464-63001486 AACAGAAAGAAGTTGGGGAAAGG + Intronic
1118500089 14:66353825-66353847 AAGTGAAATAAGTTGGCGACAGG + Intergenic
1118777495 14:68982121-68982143 AACTGAAAGACCTAGGAGTCTGG + Intergenic
1118926875 14:70199256-70199278 AACTGACAGAAGTAGGCTTCAGG - Intergenic
1119318088 14:73712669-73712691 AACTGAAAGAGGTTTGGGGCTGG + Exonic
1120150351 14:81025901-81025923 AACTGAAAGAAGATGGTTACTGG + Intronic
1121850941 14:97220559-97220581 AACTGAAACCTGTTGGTGCCTGG + Intergenic
1123875421 15:24618984-24619006 AACTGAAGGAAGTTGGGATGTGG - Intergenic
1124145457 15:27121233-27121255 AACAGAATGGAGTTTGTGTCTGG + Intronic
1125249939 15:37689298-37689320 AACTGGTAGAAGTAGGTGTGTGG + Intergenic
1125478879 15:40066583-40066605 AACTGAAGGAAGAAAGTGTCTGG - Intergenic
1126194856 15:45920606-45920628 AACATTAAGAAGTTGGTCTCTGG - Intergenic
1127143380 15:55999729-55999751 AACTAAAATGAGTTGCTGTCTGG + Intergenic
1127484810 15:59409155-59409177 AAGTGGAATAAGTGGGTGTCTGG - Intronic
1128247073 15:66140423-66140445 AACTGAGAGAAGCTGGAGTCAGG - Intronic
1131839158 15:96417348-96417370 AAATGAAAGGCGTTGGTGCCAGG - Intergenic
1132161346 15:99545814-99545836 AACTGAAACCATTTGTTGTCTGG + Intergenic
1133332686 16:4985521-4985543 AACAGAATGAAGTTGGAGCCGGG - Intronic
1133348959 16:5089021-5089043 AAGTGAAAGAACTGGGTGCCGGG - Intronic
1134200606 16:12195458-12195480 AAATGTAAGCAGTTGGTGACAGG - Intronic
1137515399 16:49139078-49139100 AAGTGCAAGAAGATGCTGTCTGG + Intergenic
1138364826 16:56466428-56466450 AACTTAAAGAGGTGGTTGTCAGG - Intronic
1140022869 16:71255341-71255363 TTCTGAAAGCAGATGGTGTCTGG + Intergenic
1140165381 16:72544692-72544714 AATTGACAGAAGTAGGTTTCAGG + Intergenic
1142320780 16:89381412-89381434 AACTGGTAGGTGTTGGTGTCTGG - Intronic
1145997673 17:29113855-29113877 ACCAGAGAGTAGTTGGTGTCTGG + Intronic
1146230241 17:31101248-31101270 AACTGGAAGAGATTGGTTTCCGG - Intronic
1149775944 17:59357254-59357276 AACTAAAACTAGTTGGTGTCAGG - Intronic
1150082078 17:62249418-62249440 AACTGAAAGAAGAATGTGGCCGG + Intergenic
1153998591 18:10463725-10463747 AAGTGAAAGAAGTTGCAGTAAGG - Intronic
1156659594 18:39331118-39331140 AACTGATCGAAGTTGGTCTGTGG - Intergenic
1157142093 18:45119933-45119955 AACTGAAAGAATTTGAACTCGGG - Intergenic
1157374209 18:47148673-47148695 AACTGACATAATTTGGTGTCTGG - Intronic
1158584495 18:58719403-58719425 AAGAGAAAGAAGTTGGGGGCGGG - Intronic
1159282489 18:66304854-66304876 AACAGAAGGAAGTTGGTGCATGG + Intergenic
1160278417 18:77461992-77462014 AAGTGACAGCAGTAGGTGTCTGG + Intergenic
1162001730 19:7748843-7748865 AACTGGAAGAACTTGTTTTCTGG + Intergenic
1166612938 19:44215690-44215712 ATCTGAAAGAAGATGGGGCCAGG + Intronic
1166896601 19:46026642-46026664 AGGTGAAAGGAGGTGGTGTCTGG - Intergenic
925063091 2:908628-908650 AACTGAAATCAGTTGGTCTTTGG + Intergenic
925170819 2:1749367-1749389 AGTTGAAATAAGTTGATGTCTGG - Intergenic
931287058 2:60841074-60841096 AAATGAAAGAAGTTGAGGGCAGG + Intergenic
932288473 2:70555266-70555288 ACCTGAAGGAAGTGGGAGTCAGG - Intergenic
934994928 2:98949198-98949220 AACAGAAAGAACTCAGTGTCTGG + Intergenic
936664905 2:114583278-114583300 GACTGACAGAAATTGGTGCCTGG + Intronic
939231261 2:139428947-139428969 AACAGAAAGACGTTGGAGTACGG + Intergenic
939818712 2:146929377-146929399 AATTCAAAGAACTTGGAGTCAGG - Intergenic
940003012 2:148985633-148985655 AATTCAAAGAATTTGGTTTCAGG - Intronic
941811274 2:169758125-169758147 AAAAAAAAGAAGTTGGTGACAGG + Intronic
942337194 2:174901251-174901273 AACTGAAAGAAGAGGGTGGCCGG - Intronic
942959539 2:181813453-181813475 AAAAGAGAGAAGTTGGTGTGAGG + Intergenic
944058964 2:195552063-195552085 TGTTGAAAGAAGATGGTGTCTGG - Intergenic
944283134 2:197921709-197921731 AACTCAAAGAAGTGTATGTCAGG - Intronic
945997774 2:216453323-216453345 ATCTGAAAGAATTTAGTGTCTGG - Intronic
946199939 2:218065526-218065548 CACTGAATGAGGTGGGTGTCTGG + Intronic
946950765 2:224872046-224872068 AAATGAAAGTAGTTGAAGTCAGG - Intronic
947569926 2:231225602-231225624 AACTGAAAGAAGCCAGTGGCAGG + Intronic
1170434970 20:16317046-16317068 AAATAAAAGATGTTGGTGTGTGG - Intronic
1170913021 20:20593705-20593727 AACAGATAGATGTTGGTTTCTGG + Intronic
1173809466 20:45947428-45947450 ATCTGCAAGAAGTGGGTGCCAGG + Exonic
1174987074 20:55467037-55467059 AACTGTAAGAACTGGGTGTGGGG + Intergenic
1175566586 20:59984732-59984754 TACTGAAAGAAAGTGGTTTCCGG + Exonic
1182109322 22:27711567-27711589 AACTTAAAGAAGTCAGTTTCTGG - Intergenic
1183767930 22:39896548-39896570 AACTGAAAGAAGAGGGTTTGGGG + Intergenic
1183864297 22:40692132-40692154 AGCTAAAAGAATTTGGTGGCTGG + Intergenic
1184817517 22:46883639-46883661 CACTGAACGCAGTTGATGTCAGG + Intronic
949249464 3:1965638-1965660 AAATGAAGGCAGATGGTGTCTGG + Intergenic
956029600 3:65023383-65023405 AACTGAAAAAAGTTATTATCTGG + Intergenic
960511741 3:118557337-118557359 AACTGAAAAAAGTGGGCTTCAGG - Intergenic
960831664 3:121856042-121856064 AACTGACAGGATTTGGTGACTGG + Intronic
960925424 3:122791341-122791363 AACTGAAAGAAGTTGGTGTCAGG - Intronic
962055835 3:131870700-131870722 ATCTAAAAGAAGCTGGTTTCGGG - Intronic
963029187 3:140950510-140950532 AACTAAAAGAAGATGGTGGTAGG - Intronic
964036615 3:152206752-152206774 AAAGGAGAGAAGCTGGTGTCTGG + Intergenic
964278526 3:155035595-155035617 ACCTGAAAGAAGTTAGTGGAAGG + Intronic
964914557 3:161824375-161824397 AACTGCAAGGATTTGCTGTCGGG - Intergenic
967201611 3:187077014-187077036 AGCTCAAAGAAATTGGGGTCAGG - Exonic
967548102 3:190756631-190756653 AACTGAAGGAATTTGTTGCCAGG - Intergenic
968340842 3:197954300-197954322 AATTGAAAGAATTAGGTGTTTGG + Intronic
972771844 4:42204601-42204623 AACCAGAAGAGGTTGGTGTCAGG - Intergenic
973856445 4:55015468-55015490 AATTGATAGGACTTGGTGTCGGG - Intergenic
976423363 4:84871471-84871493 AACTGAGAGAACTTGTTGTGAGG + Intronic
977245398 4:94624724-94624746 AACTGAGAGAATTTGGCTTCGGG + Intronic
977741208 4:100485691-100485713 ATCAAAAAGAAGTTGGTGCCAGG - Intronic
979308964 4:119179737-119179759 AACTGCCAGCATTTGGTGTCTGG + Intronic
979314797 4:119249584-119249606 AACTGGAAGAAGTTGTGGTAGGG - Intronic
980253072 4:130343098-130343120 TACTGAAAGTAATTGCTGTCAGG - Intergenic
980314826 4:131185276-131185298 AACTAAAAGAAGATTGTATCTGG + Intergenic
981111150 4:140934826-140934848 AACTCAAAGAAGTTGGTCCCAGG - Intronic
981136757 4:141219818-141219840 AACCTAAAACAGTTGGTGTCAGG + Intergenic
981922788 4:150104225-150104247 AAATAAAAGAAGTTGTGGTCAGG + Intronic
982937673 4:161504268-161504290 AACTTAAAGAACTTTGTGTTTGG - Intronic
982951811 4:161707803-161707825 AACTAACAGAATTTGGTCTCTGG + Intronic
984546344 4:181108646-181108668 AACCGAAGTAAGTTGGTTTCTGG - Intergenic
985850015 5:2381968-2381990 AGCTGAAATAAGTTGATCTCAGG - Intergenic
987697357 5:21349325-21349347 TTCTGAAAGAAGTTGGGATCTGG - Intergenic
989329393 5:40238619-40238641 GTCTGAAATAAGTTGCTGTCTGG - Intergenic
989484095 5:41968061-41968083 AACTAAATGAAGCTGTTGTCAGG - Intergenic
990440299 5:55837827-55837849 AACTGACAGAAGCTGGTTCCAGG - Intergenic
990998912 5:61762959-61762981 AACTGAAAGAATTTGTTGCCAGG - Intergenic
991161509 5:63508415-63508437 AACTGACAGAAGTAGGCGTCAGG + Intergenic
991161514 5:63508453-63508475 AACTGACAGAAGTAGGCGTCAGG + Intergenic
991197672 5:63955402-63955424 AACTGGCAGGACTTGGTGTCTGG - Intergenic
994724770 5:103421510-103421532 ACCTGAAAGATCTTGTTGTCTGG - Intergenic
994887846 5:105588122-105588144 AACTGAAAGTGGTTGTTGTGTGG - Intergenic
996361153 5:122648644-122648666 AACTGAAAGAACTTAGTGTCTGG - Intergenic
996397247 5:123025857-123025879 AACTGAGAGCCATTGGTGTCAGG + Exonic
996471310 5:123864172-123864194 AAAGGAAACAAGTTGGAGTCTGG - Intergenic
997532480 5:134590690-134590712 AACTAAAAGAATTTGGTGGCTGG + Intergenic
997850318 5:137326592-137326614 AGCTGAAGGAAGTTACTGTCAGG + Intronic
998382221 5:141734041-141734063 AACCCAAAGAAGTTGGTCTATGG + Intergenic
1002955175 6:1855408-1855430 AAATGCAAGAAGCTGGAGTCTGG + Intronic
1005957750 6:30676499-30676521 AACTGAATTGAGATGGTGTCGGG - Exonic
1006439940 6:34047673-34047695 GACTGGAAGGAGTTGGTGTTGGG - Intronic
1006901062 6:37501637-37501659 AACAAAAACAAGTTGGTGGCAGG + Intergenic
1007470805 6:42089039-42089061 AGAAGAAAGAAGATGGTGTCCGG - Intergenic
1007758304 6:44115526-44115548 AAATGAAGGAAGTTGTTGGCGGG - Intronic
1008190162 6:48446554-48446576 TACACAAAGAAGTTGATGTCTGG - Intergenic
1008816661 6:55576742-55576764 AAATGAAAGAAGATAGTTTCTGG + Intronic
1010788753 6:80038120-80038142 AACTTAAAGAAATTGTTATCTGG - Intronic
1011030405 6:82916856-82916878 AACTAAATAAAGTTGGTATCGGG - Intronic
1011340175 6:86305872-86305894 AACTGACAGAAGTAGGCTTCAGG - Intergenic
1014273629 6:119362541-119362563 AACTGAAAGAATTTGGAATCAGG - Intergenic
1015799695 6:137047508-137047530 AACAGAAAGAATTTGCTGTAAGG - Intergenic
1017803616 6:157923129-157923151 AAAAGAAAGAACTTGGAGTCAGG + Intronic
1019817311 7:3210739-3210761 AACTGAAAGAAGTTGGTTGGAGG + Intergenic
1021649587 7:22820687-22820709 AAGTGAAAGAAGTGGGTGTGGGG + Intronic
1021654528 7:22862209-22862231 AACTAAAAAAATTTGGGGTCAGG - Intergenic
1023704053 7:42921017-42921039 AACTGAAGGAAGTTGGTTAAGGG + Intronic
1028713794 7:93940892-93940914 ATCAGAAATGAGTTGGTGTCAGG - Intergenic
1030539317 7:110809999-110810021 AACTCTAAGAGGTTGGTGGCTGG + Intronic
1034329528 7:150270360-150270382 AGGTGAAAGGAGTTGGTGTGTGG - Intronic
1034668528 7:152839501-152839523 AGGTGAAAGGAGTTGGTGTGTGG + Intronic
1035672694 8:1432384-1432406 AACTGAAAGAAGTTAGAATCTGG + Intergenic
1039920007 8:41886837-41886859 GACTGAAAGAAGGGAGTGTCAGG + Intronic
1041528973 8:58840904-58840926 AACTCAGAGAGGGTGGTGTCAGG - Intronic
1041970739 8:63739345-63739367 AACTGAAAGAATTAGGTCACTGG - Intergenic
1042344476 8:67713290-67713312 AACTGAAACCAGTTGATCTCAGG + Intronic
1042710230 8:71708829-71708851 AACTGTGAGAAGTTGATTTCTGG - Intergenic
1043226637 8:77740532-77740554 AACAGAAAAAAGATGGTATCAGG + Intergenic
1043268967 8:78304663-78304685 AATTGAAAGAAGTAAGTCTCAGG - Intergenic
1043582252 8:81727645-81727667 AAGTGAATGAAATGGGTGTCTGG + Intronic
1043679540 8:83005183-83005205 AAATGAAAGAAGTTTGTTTCCGG - Intergenic
1043977806 8:86602690-86602712 AAGTGAAAGATGATGGTGTCTGG - Intronic
1044015358 8:87043900-87043922 GTCAGAAAGAAGTTGGTTTCAGG + Intronic
1044220673 8:89665410-89665432 AACTGACAGGATTAGGTGTCTGG - Intergenic
1046482131 8:114835862-114835884 AAATGAAAGAATTTGTTGTCAGG + Intergenic
1047129089 8:121998600-121998622 ATCTGAATGGAGTTGCTGTCTGG - Intergenic
1048671435 8:136727540-136727562 AACTGAAAGAAGTGGCTTCCAGG + Intergenic
1049121058 8:140738258-140738280 AACTGGAAGAAGAAGGTATCAGG + Intronic
1049858402 8:144879617-144879639 AACTGACAGATGTTGGGGGCGGG + Exonic
1050340037 9:4627653-4627675 AACAGAAAGAAATTGGGGTGAGG + Intronic
1051936969 9:22455150-22455172 AACTGACAGAGGTTAGTGTAAGG + Exonic
1052458979 9:28738196-28738218 AAATGAAATAACTTGGTGACTGG - Intergenic
1053105174 9:35402861-35402883 AACTGAAAGACGTTGGGGTAGGG - Intronic
1053206802 9:36193036-36193058 AACTGACAGATCTTGGTGACGGG + Intronic
1055523812 9:77109888-77109910 AACTTCAGGAAGTTAGTGTCAGG - Intergenic
1056850328 9:90078450-90078472 AACTGAAAGAATTTGCTTTGAGG - Intergenic
1186380179 X:9049532-9049554 AACTGAAAAACGTTAGTGACTGG - Intronic
1187735127 X:22295273-22295295 AACTGGAAGAAGTTGGAATAAGG - Intergenic
1187775799 X:22755281-22755303 ACATCAAACAAGTTGGTGTCTGG + Intergenic
1188325933 X:28800763-28800785 GTCTGAAAGAAGTTGATGTCAGG + Intronic
1195141407 X:101964346-101964368 AACTGGAAGAACTGGGTTTCAGG - Intergenic
1196709944 X:118752311-118752333 AACTGAAAGAAGTTTGCTGCGGG - Intronic
1197602014 X:128542600-128542622 AATTGACAGAAGTAGGTTTCAGG - Intergenic
1198408675 X:136343050-136343072 AAGTGAAAGATGATGGTGACTGG + Intronic
1201284546 Y:12368051-12368073 AAAAAAAAGAAGTTGGTGCCTGG + Intergenic