ID: 960926339

View in Genome Browser
Species Human (GRCh38)
Location 3:122798282-122798304
Sequence TCTACCATAAAAAACAAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 384}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960926339_960926343 27 Left 960926339 3:122798282-122798304 CCAACCTTGTTTTTTATGGTAGA 0: 1
1: 0
2: 1
3: 38
4: 384
Right 960926343 3:122798332-122798354 ATAATTGTACCTACTATCCATGG 0: 1
1: 0
2: 2
3: 26
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960926339 Original CRISPR TCTACCATAAAAAACAAGGT TGG (reversed) Intronic
901299734 1:8190895-8190917 TCTACCAAAAAAAAATAGCTGGG - Intergenic
903572723 1:24318339-24318361 TCTACTATAAAGAACAAGCTTGG - Intergenic
903580991 1:24370784-24370806 TCTACAAAAAAAAAAAAGCTGGG - Intronic
905353836 1:37367028-37367050 TCAACCATCAAAGGCAAGGTGGG + Intergenic
906825275 1:48972628-48972650 TCTATCTTAAAAGACAATGTTGG + Intronic
906840099 1:49128404-49128426 ACTATTATGAAAAACAAGGTTGG + Intronic
906879455 1:49574717-49574739 TCAACCATCAAAGGCAAGGTGGG + Intronic
908085757 1:60632097-60632119 TTTTCCACAAAAAACAAGGAGGG - Intergenic
909032863 1:70562059-70562081 TCAACCATTAAAGGCAAGGTGGG + Intergenic
909432360 1:75604183-75604205 TTTTCCATATCAAACAAGGTAGG + Intronic
909482494 1:76140931-76140953 TGTACAATAAAAAACAAGCCTGG - Intronic
909963352 1:81876356-81876378 TATACCATAAAAACAAATGTTGG - Intronic
910448509 1:87324012-87324034 TCTACCAAAAAAAATTAGCTGGG + Intergenic
910948192 1:92616405-92616427 TCAACCATCAAACGCAAGGTAGG + Intronic
911109341 1:94165954-94165976 TCAACCATCAAAGGCAAGGTGGG - Intronic
911368179 1:96965713-96965735 TTTAGCCTAAAAAAAAAGGTTGG + Intergenic
911744039 1:101419488-101419510 TCTGCCTTAAAAAAAAAGGGAGG + Intergenic
912050900 1:105526701-105526723 TCAAACATTAAAGACAAGGTGGG - Intergenic
912944048 1:114069944-114069966 TCAACCATAAAAGGCAAGGTGGG - Intergenic
913031455 1:114907856-114907878 TCTAGCATAAAGGACAAAGTGGG - Intronic
913693078 1:121298083-121298105 TATACCATAAAAATCAGGGTAGG - Intronic
914144476 1:144981998-144982020 TATACCATAAAAATCAGGGTAGG + Intronic
915477884 1:156163869-156163891 TCTACCAAAAAAAATGAGCTGGG + Intronic
916354651 1:163891185-163891207 TCAACCATCAAAAGCAAGGTGGG - Intergenic
917541114 1:175915694-175915716 TCTACCAGAAAAGCCAAGGATGG + Intergenic
918613512 1:186518132-186518154 TCTGACTTAAAAAACAAGGATGG + Intergenic
918918449 1:190673591-190673613 TCAACCATCAAAGGCAAGGTGGG - Intergenic
918958800 1:191243666-191243688 TGAAACATAAAAAACAAGTTTGG - Intergenic
919124887 1:193381900-193381922 TCAACCATCAAAAGCAAGGTGGG - Intergenic
920197192 1:204236607-204236629 TCAACCATCAAAGGCAAGGTGGG + Intronic
920480402 1:206316452-206316474 TATACCATAAAAATCAGGGTAGG - Intronic
1063660856 10:8034481-8034503 GCTCCCATAAAAAACAAAGACGG + Intergenic
1064545884 10:16449558-16449580 TCAACCATCAAAGACAAGGTGGG - Intronic
1066167267 10:32801009-32801031 TCAACCATCAAAGGCAAGGTGGG - Intronic
1066231276 10:33436105-33436127 TGTACCAGCAAAAACAAGCTAGG - Intergenic
1066543496 10:36474711-36474733 TCAACCATCAAAGGCAAGGTGGG + Intergenic
1067125827 10:43514642-43514664 TCAACCATCAAAGGCAAGGTGGG - Intergenic
1067332920 10:45338459-45338481 TCAACCATCAAAGGCAAGGTGGG + Intergenic
1067758051 10:49020672-49020694 TGTACCATCAAAAAGAAGGAAGG + Intronic
1068225580 10:54103357-54103379 TCAACCATCAAAGGCAAGGTGGG - Intronic
1068317572 10:55366266-55366288 TCTATTATAAAAAACAAAGCAGG - Intronic
1068446977 10:57136837-57136859 TCAACCATCAAAAGCAAAGTGGG + Intergenic
1068804724 10:61182580-61182602 TCTACCATAAAGAACACAATAGG - Intergenic
1069713834 10:70508190-70508212 TATTCCATAAACAACAAGGCTGG - Intronic
1070909122 10:80102180-80102202 TCTACAAAAAAAAATAAGGCTGG + Intergenic
1073557107 10:104464149-104464171 TCAACCATCAAAGGCAAGGTGGG + Intergenic
1075420044 10:122293980-122294002 TCTGGCATTCAAAACAAGGTGGG - Intronic
1076295768 10:129383116-129383138 TCTAATATAAATAATAAGGTTGG + Intergenic
1076780963 10:132724375-132724397 TCTACCATAAAGATGAAGGTGGG + Intronic
1078058134 11:8024149-8024171 TCTACCATGTAATACAAGCTGGG - Intronic
1078149286 11:8745080-8745102 TCTACCAAAAATAAAAAAGTTGG - Intronic
1080080604 11:28214042-28214064 TCTCCAATAAAAAAAAAGATGGG - Intronic
1081065691 11:38536654-38536676 TCAACCATCAAAGGCAAGGTGGG - Intergenic
1081508726 11:43745848-43745870 TCTACAGGAAAAAAAAAGGTTGG + Intronic
1082019694 11:47521701-47521723 TCCACCATAAACACCAAGCTTGG - Intronic
1082999390 11:59277768-59277790 TCAACCATCAAAGGCAAGGTGGG + Intergenic
1083321499 11:61850188-61850210 TCTACCATATAAAATAATGTAGG - Intronic
1083916870 11:65752070-65752092 TCTACCAAAAAAAATTAGCTGGG - Intergenic
1085487714 11:76881617-76881639 TATAGCATAAAGAACAAGGTAGG - Intronic
1086250487 11:84806814-84806836 TCTACCATCAAATATAATGTAGG - Intronic
1087394074 11:97574184-97574206 TCTACTAAAAAAAAAAAGCTGGG - Intergenic
1087463804 11:98478605-98478627 TCTACCATAAATAAAAAGGAGGG - Intergenic
1088191910 11:107236274-107236296 TCAACCATCAAAGACAAGGTGGG - Intergenic
1088379106 11:109173626-109173648 TCTCCCATTAAATACAAGGGTGG - Intergenic
1088406630 11:109487525-109487547 TCTTCCATAAAAAATAAAGAGGG - Intergenic
1088449119 11:109963578-109963600 TCAACCGTCAAAAGCAAGGTGGG + Intergenic
1088497963 11:110451217-110451239 TTTCCCATAAAAAATAATGTTGG + Intronic
1091276113 11:134351948-134351970 TCTACCTTATAGAATAAGGTAGG + Intronic
1091536156 12:1411726-1411748 TCTGCCAAAATAGACAAGGTAGG - Intronic
1092093042 12:5819860-5819882 TCAACCATCAAAGGCAAGGTGGG + Intronic
1092381105 12:7997766-7997788 TCAACCATCAAAGACAAGGTAGG + Intergenic
1093036067 12:14333567-14333589 TCAACCATCAAAGGCAAGGTGGG + Intergenic
1093557953 12:20499988-20500010 CCTACCTTAAAACACAAGCTTGG + Intronic
1093739146 12:22661188-22661210 TCTACAATGAGAAACAAGGTAGG + Exonic
1094137619 12:27145432-27145454 TCTAGCATGAAAATCAAGGTGGG + Intergenic
1094187035 12:27655161-27655183 TCTAGCATGAAAATCAAGGTGGG + Exonic
1097769903 12:63571931-63571953 TCTACTATAAAAAACTACATTGG + Intronic
1098749610 12:74277721-74277743 TCAACCATCAAAAGCAAGGTGGG + Intergenic
1098832133 12:75375806-75375828 TCAACCGTCAAAGACAAGGTGGG - Intronic
1099365704 12:81763680-81763702 TCAACCATCAAAGGCAAGGTGGG + Intergenic
1099420169 12:82448017-82448039 TTTACCATTAAAAACAAGAATGG - Intronic
1100241399 12:92713463-92713485 TCAACCATCAAAGGCAAGGTGGG - Intergenic
1100534352 12:95492723-95492745 TCTACCAAAAAAAATTAGCTGGG - Intronic
1101460455 12:104886104-104886126 TCTACGAGAAAAAAGAAAGTGGG + Intronic
1101584213 12:106070478-106070500 TCCACCATAAATAAAAACGTTGG - Intronic
1103982314 12:124744627-124744649 TCTACCAAAAAATACAAGGGAGG - Intergenic
1105874914 13:24542421-24542443 TGTACAATAAAAAAAAAGCTAGG - Intergenic
1106224646 13:27775703-27775725 TCTAACATCAATAACAAGGGTGG + Intergenic
1106785487 13:33104287-33104309 TGTACAATAATAAATAAGGTTGG + Exonic
1107706713 13:43115107-43115129 TCTACCATAAAACAGGAGCTTGG + Intergenic
1108388090 13:49920058-49920080 TCTATAATAAAAATTAAGGTAGG + Intronic
1108864704 13:54909189-54909211 TCTTCCAAAAAAAAAAAGTTTGG - Intergenic
1109582827 13:64364367-64364389 TCAACCATCAAAGGCAAGGTGGG + Intergenic
1110095049 13:71507303-71507325 TCTATGCTAAAAAACAAAGTTGG - Intronic
1110100498 13:71595420-71595442 GCTACCATCAAAAAGAAGGGAGG + Intronic
1110123502 13:71912456-71912478 GCTACCTTGAAAAACAAGGGAGG - Intergenic
1110452104 13:75648246-75648268 ACAATCATAAAAAACAAGTTAGG - Intronic
1110477410 13:75932694-75932716 TCTACCACATAAAACCAGGAAGG - Intergenic
1110617489 13:77557480-77557502 TTTACAATAAAACACAACGTAGG + Intronic
1111533724 13:89574416-89574438 TCTCAAATAAAAAACAAAGTGGG - Intergenic
1111580109 13:90211566-90211588 ACTACCAAAAAAAAAAAGGGGGG + Intergenic
1111636273 13:90907903-90907925 TCTATCCAAAAAAAAAAGGTAGG - Intergenic
1112585585 13:100716059-100716081 TCACCCATAAAACACCAGGTAGG + Intergenic
1112776502 13:102849574-102849596 ACTAACATAAAAAAAAATGTAGG - Intronic
1112896447 13:104305678-104305700 TCAAGCATCAAAAGCAAGGTGGG - Intergenic
1114197810 14:20494577-20494599 TCTGTCTTAAAAAAAAAGGTGGG - Intergenic
1114845910 14:26321528-26321550 TCTTACATAAAAAACAGGGCCGG - Intergenic
1115059478 14:29172127-29172149 TCAACCATCAAAGGCAAGGTGGG + Intergenic
1115804748 14:37038281-37038303 TCTACCAACAAATATAAGGTAGG - Intronic
1116248935 14:42456505-42456527 TCAACCATCAAAAGCAAGATGGG + Intergenic
1116531675 14:45979973-45979995 TCAACCATCAAAGGCAAGGTGGG - Intergenic
1117085726 14:52198333-52198355 TTTTCCATTAAAAAAAAGGTGGG - Intergenic
1118304728 14:64646206-64646228 TCTACCGCAAAAAAAAAGGAGGG - Intergenic
1118432095 14:65729184-65729206 TCTACCATAAAAAATTAGCTGGG - Intronic
1119335110 14:73826866-73826888 TCTACCATAAAATACTATGCAGG - Intergenic
1119365536 14:74088386-74088408 TCTACAAAAAATAATAAGGTGGG - Intronic
1119664484 14:76474920-76474942 TCTACCAAAAAAAAAAAGAAAGG + Intronic
1120540513 14:85744854-85744876 TCAACCATAAAAAAAAAGGTGGG + Intergenic
1120556224 14:85932213-85932235 TCAACCATCAAAGGCAAGGTGGG - Intergenic
1121006573 14:90494491-90494513 TTTATCATCAGAAACAAGGTGGG - Intergenic
1121188192 14:91995979-91996001 TTTACCATAATAAAAAATGTAGG - Intronic
1125067904 15:35513302-35513324 TAGACTATAAAAAACAAGGCAGG + Intronic
1125192567 15:37010541-37010563 TCTACCAAAAAAAATTAGGAAGG - Intronic
1125872218 15:43112687-43112709 TCTAAAAAAAAAAAAAAGGTGGG + Intronic
1127253284 15:57265028-57265050 TCTAACTTAAAAAAAAAAGTTGG - Intronic
1127418338 15:58779604-58779626 TCTATATTTAAAAACAAGGTGGG - Intronic
1127655250 15:61049467-61049489 GCTACCATAAAAAATACAGTAGG + Intronic
1128097403 15:64968021-64968043 TCTACCAATAAAACCAATGTTGG - Intronic
1129281053 15:74485298-74485320 TCTACCAAAAAAACCTAGCTGGG - Intergenic
1130611725 15:85367348-85367370 TCTACCAAAAAAAAAAAGCCAGG + Intergenic
1130612363 15:85372817-85372839 TCTTCCAGAAAGAACAGGGTAGG - Intergenic
1130670060 15:85904115-85904137 TCTACCAAAAAAAAAAAAATTGG + Intergenic
1131610504 15:93956201-93956223 TCTGCCATAAAAAAATAGGAGGG - Intergenic
1132418029 15:101638293-101638315 TCTCCAAAAAAAAAAAAGGTGGG - Intronic
1135099198 16:19591548-19591570 TCTACAAAAAAAAAAAAGGAAGG + Intronic
1135462395 16:22656399-22656421 TCTAACAATTAAAACAAGGTGGG + Intergenic
1136354073 16:29732183-29732205 TCTATCATAAAAACAAATGTGGG - Intergenic
1136532149 16:30876866-30876888 TCTACCATAAGGAACTTGGTGGG + Intronic
1137406849 16:48196046-48196068 TCTACCACCAAAGCCAAGGTTGG - Intronic
1137967909 16:52955129-52955151 TCTACCAAAAAAAATAAATTAGG + Intergenic
1138677316 16:58660954-58660976 TCTCCCATTAAAAACAAAATTGG - Intergenic
1141106390 16:81237223-81237245 TCTACCAAAAAAAATTAGCTGGG - Intergenic
1141559787 16:84859810-84859832 TCAACCATCAAAAGTAAGGTGGG - Intronic
1142295078 16:89216108-89216130 TCTACTAAAAATTACAAGGTGGG + Intergenic
1146850693 17:36219253-36219275 TCAACCATGAAAGGCAAGGTGGG + Intronic
1146998534 17:37342777-37342799 TCTACCAAAAAAAAAAAAGCTGG + Intronic
1147942426 17:44058534-44058556 TCTACAAAAAAAAACTAGGCTGG + Intronic
1150045103 17:61905104-61905126 TCTACTAAAAAAAATAAGCTGGG - Intronic
1152290684 17:79438355-79438377 CCTTCCATGAAAAACAGGGTGGG - Intronic
1152427365 17:80225552-80225574 TTTCTCATAAAAAACAATGTAGG - Intronic
1152513688 17:80808127-80808149 TCTACCAAAAAAAAAAAGTTAGG + Intronic
1153217938 18:2837382-2837404 TCAACCATCAAAGGCAAGGTGGG - Intergenic
1154533380 18:15371337-15371359 TCTAAAAAAAAAAAAAAGGTTGG - Intergenic
1155363473 18:25027310-25027332 ACTACCCTAAAAAACAATGCTGG + Intergenic
1155433941 18:25791878-25791900 TAAAAAATAAAAAACAAGGTAGG + Intergenic
1155754902 18:29480163-29480185 TCTATCATGGAAAACAAGTTGGG - Intergenic
1156537558 18:37878752-37878774 TCAACCATCAAAGGCAAGGTGGG + Intergenic
1156726783 18:40138075-40138097 TATACCATACAAAACAGGGACGG - Intergenic
1156998365 18:43495944-43495966 TCAACCATCAAAGGCAAGGTGGG + Intergenic
1157845948 18:51004195-51004217 TCAACCATCAAAGGCAAGGTGGG + Intronic
1157909153 18:51598770-51598792 TCTTCCATCAAAAAAGAGGTGGG - Intergenic
1158040109 18:53082972-53082994 TCTAGCATGAAGAACAAAGTGGG - Intronic
1158170812 18:54597215-54597237 TCTCACATTAAAAAAAAGGTAGG + Intronic
1159406821 18:68013769-68013791 TCTACCAAAAAAAAAAAGTCTGG + Intergenic
1159792100 18:72794494-72794516 TCTACCTTAAAAAACACATTAGG + Intronic
1159813017 18:73039381-73039403 TCTGCCTTAAAAGACAATGTTGG - Intergenic
1159950826 18:74481666-74481688 TCTCACATAAAAAGCAAGTTGGG + Intergenic
1161922891 19:7279807-7279829 TCTACCAAAAAAAAAAAAATTGG + Intronic
1164117539 19:22236886-22236908 TCAACCATCAAAGGCAAGGTGGG - Intergenic
1164200243 19:23012166-23012188 TCGACCATCAAAGGCAAGGTGGG - Intergenic
1165565423 19:36723171-36723193 TCCACCTAGAAAAACAAGGTAGG - Intronic
1166096627 19:40543282-40543304 TCTACCAAAAAAGAAAAAGTGGG + Intronic
1167343618 19:48931367-48931389 TCTACCAAAAAAAAAAAGTGGGG - Intergenic
1167392193 19:49202828-49202850 ACCACAATAAAAAACAAAGTTGG - Intronic
1168539591 19:57199142-57199164 TCAACCATCAAAGGCAAGGTAGG - Intronic
1168673761 19:58261370-58261392 TCTACCATGAAAACAAAGGGAGG - Exonic
926039062 2:9658284-9658306 TCTAGCAAAAAAAAAAATGTTGG - Intergenic
926825821 2:16904130-16904152 TCAACCATAAAAGGCAAGGTGGG - Intergenic
927131680 2:20065482-20065504 CCTACCATTAAAAGCAATGTGGG - Intergenic
927941829 2:27108941-27108963 TCTACCAAAAAAAAAAAGCTGGG - Intronic
928619690 2:33076237-33076259 TTTTCCTTAAAAAAGAAGGTAGG + Intronic
930780444 2:55219899-55219921 TCTACCAAAAAAGAAAAGGTGGG - Intronic
930792380 2:55347906-55347928 TCTAAAATAAATAACTAGGTTGG - Intronic
930954129 2:57183537-57183559 ACTACAATAAAAGACAGGGTGGG + Intergenic
931132144 2:59348664-59348686 TCTAGCATAAAAACAAATGTGGG + Intergenic
932842517 2:75096691-75096713 TATACCATAAACAACATGGGAGG - Intronic
934167922 2:89312361-89312383 TATTCCAAAAAAATCAAGGTGGG + Intergenic
934199362 2:89870222-89870244 TATTCCAAAAAAATCAAGGTGGG - Intergenic
934690671 2:96356375-96356397 TCATCCATAAAATGCAAGGTTGG + Intronic
934737177 2:96695487-96695509 TCTACCAGAACAAAGAAGGAGGG - Intergenic
936376294 2:111943993-111944015 TCTACCATAGAAATCAAGACAGG + Intronic
937416245 2:121717270-121717292 TCTAAAAAAAAAAAAAAGGTTGG + Intergenic
938717631 2:134035494-134035516 TGGACCATAAAAAACAATATTGG - Intergenic
941138612 2:161747646-161747668 TCTTCCAGGAAAAAAAAGGTGGG - Intronic
941667771 2:168259405-168259427 TCAACCATCAAAGGCAAGGTGGG + Intergenic
942437015 2:175989878-175989900 TCTACCATAAAGAATAATTTTGG + Intronic
942735450 2:179106127-179106149 TCTAGCATTAAAAACATGGCTGG - Exonic
942940992 2:181616792-181616814 TCTACCATTAATAAAAAGGTAGG + Intronic
943338003 2:186642693-186642715 TCTACTAAAAAAAATAAGCTGGG - Intronic
943384256 2:187182651-187182673 TCAACCATCAAATGCAAGGTGGG - Intergenic
943814860 2:192239749-192239771 TCTTTCAAAAAAAACTAGGTAGG - Intergenic
944178373 2:196859377-196859399 TCTCCCATCAAAAACAAGCATGG + Intronic
944267713 2:197747276-197747298 GCAACCATAAAAAAGTAGGTGGG + Intronic
944846680 2:203675635-203675657 TCTATCAAAAGAAACAATGTAGG + Intergenic
945532661 2:210975368-210975390 TCCACCATAGAAAACAGGGTGGG + Intergenic
945641928 2:212442047-212442069 TCAACCATCAAAGGCAAGGTGGG + Intronic
945777977 2:214131206-214131228 TCTACCAAAAAAAAGTAGCTGGG + Intronic
946098420 2:217296513-217296535 TCTACCATAAAAATAAGGGTTGG - Intronic
946133383 2:217625099-217625121 TCTTGCATAGAAAACAAGGGGGG + Intronic
947062165 2:226179339-226179361 TCTCCCACATAAAACAAGGAAGG - Intergenic
947607090 2:231493471-231493493 TATACCATATAAAATAAAGTTGG - Intergenic
1169295669 20:4395631-4395653 TTTACCATAAAAAAATAAGTTGG - Intergenic
1170407456 20:16053894-16053916 TTTCCCATAATAAACAAGGTTGG + Intergenic
1171479815 20:25445646-25445668 TCTACTAAAAAATACAAAGTTGG - Intronic
1171507870 20:25653672-25653694 TCTTTCCAAAAAAACAAGGTCGG + Intergenic
1173153512 20:40587970-40587992 TCCACCATAAAAAATATGTTTGG + Intergenic
1173238302 20:41268829-41268851 TCAGCAATAAAAAACAAGGGAGG + Intronic
1173361560 20:42349267-42349289 TTTAACATAAACATCAAGGTGGG - Intronic
1174689341 20:52488489-52488511 TATACCAGGAAAAACAAGATGGG - Intergenic
1175582217 20:60109026-60109048 TCTTCTGTAAAAGACAAGGTTGG - Intergenic
1176360566 21:5993390-5993412 TCAATGATAAAAAACAAGATAGG - Intergenic
1177346044 21:19872399-19872421 TTTATCCTAAAAAACAAGATTGG + Intergenic
1177933920 21:27318697-27318719 TCAACCATCAAAGGCAAGGTGGG - Intergenic
1178012405 21:28303145-28303167 TCAGCCATCAAAAGCAAGGTGGG + Intergenic
1178060971 21:28852923-28852945 TCAACCATCAAAGGCAAGGTGGG - Intergenic
1178764053 21:35432710-35432732 TCAACCACCAAAGACAAGGTGGG - Intronic
1179272157 21:39859927-39859949 TCACCCATCAAAAGCAAGGTGGG - Intergenic
1179762952 21:43545160-43545182 TCAATGATAAAAAACAAGATAGG + Intronic
1180698368 22:17768572-17768594 TCTGTCATAAAGAACAAGGCTGG + Intronic
1181348630 22:22239379-22239401 CCTACCAAAAAAAAAAAAGTGGG - Intergenic
1181892735 22:26078288-26078310 TCCACCAAAGAAACCAAGGTAGG + Intergenic
1183367271 22:37413399-37413421 TCTACAAAAAAAAAAAAGCTTGG + Intronic
1183943898 22:41313066-41313088 TCTCACATAAAAAATGAGGTGGG + Intronic
1184352024 22:43950775-43950797 TCTACAAAAAAAAACTAGCTGGG - Intronic
1184603804 22:45560169-45560191 TCAACCATCAAAGGCAAGGTGGG - Intronic
949245645 3:1923131-1923153 TCAACCATCAAAGGCAAGGTGGG + Intergenic
949306219 3:2644140-2644162 TCTTCCTTAAATAACCAGGTAGG + Intronic
949537770 3:5009052-5009074 TCTACCAAAAAAAAAAAGCCAGG - Intergenic
950895341 3:16444686-16444708 TGTACCACAATAAACAATGTGGG + Intronic
950971891 3:17197535-17197557 TCTACCAAAAAAAATTAGCTGGG - Intronic
951211677 3:19982074-19982096 TCTACCAAAAAAAAAAAGCCAGG + Intronic
951455416 3:22886713-22886735 ACAACCAAAACAAACAAGGTGGG + Intergenic
951727472 3:25776012-25776034 TCTACCACCAAAAAGAAAGTTGG - Intronic
951915791 3:27799486-27799508 CCAACAATAAAAAACAATGTTGG + Intergenic
951970987 3:28443639-28443661 TCAACCATTAAAGGCAAGGTGGG - Intronic
953897625 3:46814274-46814296 TCAACCATCAAAGGCAAGGTGGG - Intergenic
954053887 3:48005923-48005945 TCAACCATCAAAGGCAAGGTGGG + Intronic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
956880559 3:73506934-73506956 TTTACCATTAAAAACAATGCTGG - Intronic
957287612 3:78237106-78237128 TATCACATAAACAACAAGGTAGG + Intergenic
957589629 3:82179294-82179316 TCTACCTTAAAAAACAAAATAGG + Intergenic
957655899 3:83075029-83075051 TCAAAAATAAAAAACAATGTTGG + Intergenic
958028520 3:88077839-88077861 TCTACACTAAAAAACAACCTTGG - Intronic
958095786 3:88942707-88942729 GCCACCAGAAAAACCAAGGTGGG + Intergenic
960044420 3:113182895-113182917 TAAACAATAATAAACAAGGTGGG + Intergenic
960635180 3:119777896-119777918 TCTACCAGAAAAAAATAGCTGGG + Intergenic
960926339 3:122798282-122798304 TCTACCATAAAAAACAAGGTTGG - Intronic
961218599 3:125182019-125182041 TCTACAAAAAAATACAAGGCTGG + Intronic
961670011 3:128522254-128522276 TTTAAAATAAAAAAAAAGGTTGG - Intergenic
961847435 3:129778282-129778304 TCTGCAATAAAAAACAATTTAGG + Intronic
962102609 3:132358224-132358246 TCTACCAAAAAAAGGAAGGAAGG + Intronic
962462038 3:135623044-135623066 CCTGCTAGAAAAAACAAGGTTGG + Intergenic
963053891 3:141167495-141167517 ACTTTCATAAAGAACAAGGTTGG - Intergenic
963355892 3:144208621-144208643 TCAACCATGAAAGGCAAGGTGGG - Intergenic
963400672 3:144793432-144793454 TCTACCTTAAATAATCAGGTTGG + Intergenic
964947078 3:162238813-162238835 TCTATTAAAAAAAACAATGTGGG + Intergenic
965251715 3:166351416-166351438 TCAACCATCAAAGTCAAGGTGGG - Intergenic
965474728 3:169141767-169141789 TCATCCATAAACAACAAGGGAGG - Intronic
966641410 3:182194909-182194931 TCTGCCATAAAACAAAAGGTAGG + Intergenic
966997815 3:185300790-185300812 TCAGCCTTAAAAAAGAAGGTAGG - Intronic
967679792 3:192347665-192347687 TCTTCCAAAGAAAAGAAGGTTGG + Intronic
968669323 4:1840369-1840391 TCTGCCTCAAAAAATAAGGTTGG + Intronic
968906643 4:3455861-3455883 TCAACCATCAAAGGCAAGGTGGG + Intergenic
969331557 4:6476131-6476153 GCTGCCATAATAAACAAGATAGG - Intronic
969613133 4:8238008-8238030 TCTAACAAAGAAAACAGGGTAGG + Intronic
970089416 4:12388125-12388147 TCAACCATCAAAGGCAAGGTAGG - Intergenic
970632751 4:17969480-17969502 ACTACCTTAAAAATCAACGTTGG - Intronic
971002903 4:22342068-22342090 TCAACCATGAAAGGCAAGGTAGG + Intergenic
971210794 4:24614239-24614261 TCTACCAAAAAAAAAAAAATTGG + Intergenic
971245184 4:24920935-24920957 TCTAGCATGGAAAAGAAGGTGGG + Intronic
971959362 4:33465315-33465337 TCTAGTATAAACAACAAGGAGGG - Intergenic
972095282 4:35340906-35340928 TAAACCATCAAAGACAAGGTGGG + Intergenic
972463497 4:39329333-39329355 TCTACCAAAAAAAATTAGCTGGG + Intronic
972883199 4:43449928-43449950 TTTACCATCAAAGGCAAGGTGGG - Intergenic
973662011 4:53117731-53117753 TCTAAAATATAAACCAAGGTTGG - Intronic
974564571 4:63566542-63566564 TCAACCATCAAAGGCAAGGTGGG + Intergenic
974644844 4:64676551-64676573 TCAACCACCAAAAGCAAGGTGGG - Intergenic
974951487 4:68588449-68588471 TTTAAAATAAAAAACAAAGTTGG - Intronic
975037727 4:69705041-69705063 TATTACATAAAAAACAAGGGAGG + Intergenic
976745634 4:88400360-88400382 TCTACAAAAAAAAACCAGCTGGG - Intronic
978062560 4:104355569-104355591 TGCACCTTAAAAAACTAGGTTGG + Intergenic
978899304 4:113928619-113928641 TCAACCATCAAAGGCAAGGTGGG - Intronic
979545549 4:121936282-121936304 TCTAGCATGAAAAATAAGGAAGG + Intronic
980025372 4:127759865-127759887 TCTACCTTAAAATCCAAAGTTGG - Intronic
980065843 4:128187530-128187552 TGTAAAATCAAAAACAAGGTAGG - Intronic
980601934 4:135037694-135037716 ACAACCATCAAAGACAAGGTGGG + Intergenic
983184827 4:164689789-164689811 TCAACCATCAAAGGCAAGGTGGG + Intergenic
983305891 4:165986107-165986129 TTTACCTCAAAAAACAAAGTTGG - Intronic
983408130 4:167358390-167358412 TCTTCCACAAAAATGAAGGTGGG + Intergenic
986687862 5:10289808-10289830 TCTTCCTAGAAAAACAAGGTAGG + Intronic
986742685 5:10717720-10717742 TCGACCATCAAAGGCAAGGTGGG + Intronic
986938550 5:12920516-12920538 TCAACCATCAAAGACAAGTTGGG - Intergenic
987152942 5:15059889-15059911 TCAACCATCAAAGGCAAGGTGGG + Intergenic
988233514 5:28508858-28508880 TCAACCATCAAAGGCAAGGTGGG - Intergenic
989023067 5:37032780-37032802 TCTACCATTAAAAACATTTTTGG - Intronic
989097599 5:37795557-37795579 TCAACCATCAAAGGCAAGGTGGG + Intergenic
991724481 5:69522610-69522632 TTTATCTTAAAAAACAAGGGGGG - Intronic
992242639 5:74787666-74787688 TCAACCATCAAATGCAAGGTGGG + Intronic
993775731 5:91993336-91993358 GCTTCCATAAAAAAAAATGTTGG + Intergenic
993791563 5:92217140-92217162 TCAACCATCAAAGGCAAGGTGGG + Intergenic
994958234 5:106562552-106562574 TCAACCATCAAAGGCAAGGTAGG + Intergenic
994984649 5:106917501-106917523 TCAACCATCAAAGGCAAGGTGGG - Intergenic
997971021 5:138402087-138402109 TCTACCAAAAAAAATTAGCTGGG - Intronic
999351157 5:150873074-150873096 TCAACCATCAAAGGCAAGGTGGG + Intronic
1000326741 5:160178009-160178031 TCTACCTCAAAAAAAAAGGGGGG - Intergenic
1000674681 5:164106003-164106025 TGTAAAATAAAAAACAAGTTAGG - Intergenic
1001246590 5:170109507-170109529 TCTTCCAAGAGAAACAAGGTTGG + Intronic
1005271063 6:24164151-24164173 TTAACCATCAGAAACAAGGTGGG - Intergenic
1005508912 6:26494626-26494648 TCTACCAAAAAAAGGAAAGTAGG + Intergenic
1007968782 6:46029647-46029669 GCTCCCCTAAGAAACAAGGTTGG - Intronic
1008400057 6:51053708-51053730 TCAACCATCAAAGGCAAGGTGGG + Intergenic
1008475775 6:51934249-51934271 TCCACCATCAGAAACAAGGATGG + Exonic
1008495637 6:52130902-52130924 TCTCACATAAATAAGAAGGTGGG - Intergenic
1010108229 6:72192698-72192720 TCAACCATCAAAGGCAAGGTGGG - Intronic
1010312869 6:74407935-74407957 TCCACCTTCAATAACAAGGTGGG + Intergenic
1010580958 6:77595520-77595542 TCAACCATCAAAGGCAAGGTGGG - Intergenic
1011415361 6:87113517-87113539 TTTTCCATAAAAAGCAAGTTTGG - Intergenic
1011723117 6:90179482-90179504 TCTACCAAAACAAAAAATGTAGG + Intronic
1012344354 6:98168554-98168576 TCAACCATCAAAGGCAAGGTGGG + Intergenic
1012458665 6:99435725-99435747 TCTTTCATAGAAAAGAAGGTAGG + Exonic
1012460958 6:99459449-99459471 TCTACCATAAAAACACATGTAGG - Intronic
1012820567 6:104081145-104081167 TCGACCATCAAAGGCAAGGTGGG + Intergenic
1013151410 6:107449870-107449892 TCAGCCTTAAAAAACAAGGAGGG - Intronic
1013318873 6:108967352-108967374 TCAGCCATAAATAACAAGGATGG + Intronic
1013379352 6:109551765-109551787 TCTTCCAAAAAAAAAAAGGGGGG + Intronic
1013538181 6:111082550-111082572 TCTAAAAAAAAAAAAAAGGTCGG - Intergenic
1013556553 6:111262164-111262186 TCCACTATAAAAAAAAAGGGGGG - Intronic
1014416772 6:121193599-121193621 TCAACCATCAAAGGCAAGGTGGG + Intronic
1015467161 6:133560011-133560033 TCAACCATCAAAGGCAAGGTGGG - Intergenic
1015475502 6:133655541-133655563 TCAACCATCAAATGCAAGGTAGG + Intergenic
1015912243 6:138180583-138180605 GTTACCATAAAAAAAAAGGCGGG + Intronic
1016094542 6:140019930-140019952 TGTAAAATAAAAAACAAAGTTGG + Intergenic
1017302577 6:152879617-152879639 CCTACCATAGAAAGGAAGGTTGG + Intergenic
1018909459 6:168093751-168093773 TCTTCCTTAGGAAACAAGGTGGG + Intergenic
1019020119 6:168911333-168911355 TCTACTTTACAAAACAAAGTCGG - Intergenic
1019040564 6:169100675-169100697 TCAACCATCAAAGGCAAGGTGGG + Intergenic
1020911734 7:14139867-14139889 TCTAACTTAAAAAACTAGGTAGG + Intergenic
1021330111 7:19326508-19326530 TCTTCTATAAAAAACAAAATGGG - Intergenic
1021895092 7:25226062-25226084 TCTACTATAAAAGAACAGGTAGG + Intronic
1022271657 7:28813552-28813574 TCTACCAAAACAAAAAAGCTGGG + Intronic
1022512146 7:30944636-30944658 TCTCCCAGAAAAAACGAGGAAGG - Intronic
1023246464 7:38210216-38210238 TCTACCAAAAAAAACTATATGGG + Intronic
1023817331 7:43961269-43961291 TCTACCATGCAGAAAAAGGTTGG + Intergenic
1025074624 7:55932361-55932383 TCTACCAAAAAAAAAAAGGCAGG + Intronic
1027406990 7:77872534-77872556 TCAACCATCAAAGGCAAGGTGGG - Intronic
1027900323 7:84105588-84105610 TCTAAAATAAAAAAAAAGGCAGG - Intronic
1027974934 7:85140842-85140864 TCTACCATTAAAAAAATGGTAGG + Intronic
1028521651 7:91738286-91738308 TCTCCCATAAAAAAAAACCTAGG - Intronic
1028876117 7:95825147-95825169 TCGGCCAGAAAAACCAAGGTAGG - Intronic
1029588412 7:101490693-101490715 TCTATCTCAAAAAAAAAGGTCGG + Intronic
1029715436 7:102322902-102322924 TCTACCAAAAAAAATTAGCTAGG - Intergenic
1029825272 7:103186620-103186642 TCTACTATAAAAAACTATGTTGG + Intergenic
1030224846 7:107138842-107138864 TCTACCAAAAAAAATAAGCTGGG - Intronic
1031297383 7:120018604-120018626 TCTAGGATAAATAACAATGTAGG + Intergenic
1031689878 7:124774319-124774341 TCTAGCACAAAACAGAAGGTGGG + Intergenic
1031855709 7:126920369-126920391 TCTACTATAAAAAAAAAGAGGGG + Intronic
1033022862 7:137744500-137744522 TCTTCCAAAAAAATCAAGGAGGG + Intronic
1033640705 7:143261145-143261167 TGTCTCAAAAAAAACAAGGTGGG + Intronic
1033946105 7:146719992-146720014 TCTTCCCTAAAAAACAAGGGAGG + Intronic
1034333053 7:150299784-150299806 TCAAAAACAAAAAACAAGGTCGG + Intronic
1035142605 7:156777838-156777860 TCTGGCATAAACAACAAAGTGGG - Intronic
1035937617 8:3859594-3859616 CCCACCATAAATAACATGGTTGG - Intronic
1037213614 8:16422765-16422787 TCTACCATAAAAGATAGAGTGGG + Intronic
1037836815 8:22219512-22219534 TCTACAAAAAAAAAAAAGGAGGG + Intergenic
1038679265 8:29652004-29652026 TCTGCTATTAAAAAAAAGGTGGG - Intergenic
1039081279 8:33736550-33736572 GCTACAAAAAAAAACAAGGAAGG - Intergenic
1039417164 8:37405571-37405593 TCTACAAAAAAAAAAAATGTAGG + Intergenic
1039616291 8:38957219-38957241 TCTACCATAAAAAAGGAAGATGG - Intronic
1041700752 8:60786505-60786527 TCTCCCATATAAACCAAAGTGGG - Intronic
1042001288 8:64125747-64125769 TCAACCATCAAAGGCAAGGTGGG - Intergenic
1043216590 8:77598821-77598843 TCTACCAACAAAAATAAGATAGG + Intergenic
1044286198 8:90414232-90414254 TCAACCATCAAAGGCAAGGTGGG - Intergenic
1044890654 8:96832054-96832076 AGTACCACAAAAAACAATGTTGG - Intronic
1045026056 8:98087918-98087940 GCTGCTATAAAAAACAATGTGGG + Intronic
1045470351 8:102506838-102506860 TCTAAAAAAAAAAAAAAGGTGGG - Intergenic
1046128901 8:109943384-109943406 TCGACTATCAGAAACAAGGTTGG - Intergenic
1050782434 9:9354517-9354539 CCTACCACAAAAAAAAATGTAGG - Intronic
1050900262 9:10939141-10939163 TTTTCCATAAAAAAGAAGCTTGG + Intergenic
1051466431 9:17383351-17383373 TCTACCAAAAAAAAAAAGTTGGG + Intronic
1051841383 9:21402297-21402319 TCTCCCAGATAAAACAAAGTAGG + Intergenic
1051993749 9:23187415-23187437 TCTGCCATAAATAAAAAAGTAGG - Intergenic
1052169145 9:25372351-25372373 TCTACTAAAAATAAAAAGGTGGG + Intergenic
1055800933 9:80034747-80034769 TCTCACAGAAAAAACAAGTTTGG - Intergenic
1055963690 9:81844673-81844695 TCTACTATAAGACACCAGGTAGG - Intergenic
1056297910 9:85211360-85211382 TGGACCTTAAAAAACAAGGCAGG + Intergenic
1056314470 9:85374730-85374752 TCAACCATCAAAGGCAAGGTGGG - Intergenic
1056581845 9:87893737-87893759 TCTATTTTTAAAAACAAGGTGGG - Intergenic
1057690477 9:97279265-97279287 TCTAAGATTAAAAAGAAGGTGGG + Intergenic
1059096665 9:111423745-111423767 TCTACCATAAAAAATTAAGAGGG + Intronic
1061096853 9:128462758-128462780 TCTACCATAAAAAATTAGCCGGG - Intronic
1061534231 9:131237708-131237730 TCTATAAAAAAAAAAAAGGTGGG + Intergenic
1187768114 X:22665561-22665583 TCTTCCATAAAACACAAAATGGG + Intergenic
1187806972 X:23131273-23131295 GCTACCATACTATACAAGGTAGG + Intergenic
1188810491 X:34648591-34648613 TCAACCCTATAAGACAAGGTAGG + Intronic
1189595443 X:42560020-42560042 TCTACCTTAAAAAACATATTCGG - Intergenic
1190223135 X:48525788-48525810 TCTGCCATTATAAACAAGGCCGG + Intronic
1190397242 X:49997685-49997707 TCTACAAAAAAAAAAAAGGCCGG - Intronic
1192297946 X:69869771-69869793 TCAACCATGAAAGGCAAGGTGGG - Intronic
1193297562 X:79850917-79850939 TCAACCATCAAAGGCAAGGTGGG + Intergenic
1194979029 X:100421603-100421625 TATACCAAAAAAAAAGAGGTTGG + Intergenic
1195749078 X:108146459-108146481 TCAACCATCAAAGGCAAGGTGGG - Intronic
1196654479 X:118202599-118202621 TATACCAGCAAAAACAAGTTTGG - Intergenic
1197002060 X:121451169-121451191 TCAACCATAACAGGCAAGGTGGG + Intergenic
1197477590 X:126943110-126943132 TCAACCATCAAAGGCAAGGTGGG - Intergenic
1197591630 X:128417559-128417581 TCAACCATCAAAGGCAAGGTGGG + Intergenic
1198467169 X:136913662-136913684 TCTTCAATAACATACAAGGTGGG - Intergenic
1198467175 X:136913844-136913866 TCTTCAATAACATACAAGGTGGG - Intergenic
1198928682 X:141827887-141827909 TCTAGTATAAAAAACAAGCTTGG - Intergenic
1199310637 X:146316047-146316069 TCAACCATCAAAGGCAAGGTGGG - Intergenic
1200521064 Y:4210260-4210282 TCAACCATCAAAGGCAAGGTGGG + Intergenic
1200759797 Y:7027381-7027403 TCTACCTTAAAGAAAAAGGAAGG + Intronic
1202137792 Y:21685181-21685203 TCAACCATCAAAGGCAAGGTGGG + Intergenic
1202359554 Y:24093611-24093633 TCGACCATCAAAGGCAAGGTGGG + Intergenic
1202511224 Y:25576503-25576525 TCGACCATCAAAGGCAAGGTGGG - Intergenic