ID: 960932867

View in Genome Browser
Species Human (GRCh38)
Location 3:122872430-122872452
Sequence GAACACTCCCAGGAGAATAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960932867_960932870 17 Left 960932867 3:122872430-122872452 CCTGTATTCTCCTGGGAGTGTTC 0: 1
1: 0
2: 1
3: 16
4: 140
Right 960932870 3:122872470-122872492 TATATTTTTTGAGCTTTTTGTGG 0: 1
1: 1
2: 6
3: 102
4: 1464

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960932867 Original CRISPR GAACACTCCCAGGAGAATAC AGG (reversed) Exonic
900439790 1:2648743-2648765 GCACACTCCCAGGTGAGCACAGG + Intronic
900829247 1:4952834-4952856 TAAAACTCCCAGGTGAATCCTGG + Intergenic
901077562 1:6564872-6564894 GAACACTCCCAGGGGAGGACTGG - Intronic
904576575 1:31508955-31508977 GGACACTCCCAGGGGCACACGGG - Intergenic
905901506 1:41584574-41584596 GAAGGCTCTCAGGAGAAAACGGG - Exonic
906174167 1:43755176-43755198 GAACAACCCCAGTAGAAAACAGG + Intronic
907660669 1:56389988-56390010 TCAAACTCCCAGGAGAAAACAGG + Intergenic
908214017 1:61932418-61932440 GAGCACTTCCAGGAGATTAGGGG + Intronic
913280568 1:117181455-117181477 GAACAGTCTGATGAGAATACAGG - Intronic
915646189 1:157274424-157274446 GAACACTCCCAAGAAAGAACTGG - Intergenic
918329777 1:183447567-183447589 GAAAACTCTCAGGAGATTATGGG - Intergenic
918338492 1:183546194-183546216 GAAGAATCCCAGTAGAATTCTGG - Exonic
921049433 1:211500618-211500640 GAATACTCCCTGGAGAATGATGG - Intergenic
921154451 1:212428075-212428097 GAACATACCCAGGTGAAGACTGG + Intergenic
921154478 1:212428293-212428315 GAACACACCCAGGTGAAGATTGG + Intergenic
923932371 1:238716742-238716764 CAACATTCTCAGAAGAATACTGG - Intergenic
1063376660 10:5558246-5558268 GAACACCCCCAGCAGCATACGGG - Intergenic
1063746327 10:8887280-8887302 TAACATTCCCAGAAGAAAACAGG + Intergenic
1063876669 10:10485719-10485741 CAACCCTCCCAGGAGTATTCTGG - Intergenic
1066153593 10:32650985-32651007 GAACCCACCAAGGAGAAAACAGG - Intronic
1067296088 10:44975732-44975754 GCTCCCTCCCAGTAGAATACAGG - Intronic
1067463731 10:46478082-46478104 GATCACTCCAAAGAGAATAGTGG - Intergenic
1067623463 10:47906569-47906591 GATCACTCCAAAGAGAATAGTGG + Intergenic
1069940535 10:71952325-71952347 GAACACTCCCAGGGCAGGACTGG - Intergenic
1070640778 10:78167742-78167764 TAACACTTCCAGAAGAAAACAGG + Intergenic
1076459957 10:130635473-130635495 TAACACTCCCAGGAGGGTATGGG + Intergenic
1076574748 10:131456979-131457001 GAGCAATCCCAGGGGAATCCAGG + Intergenic
1077590935 11:3490556-3490578 GAAGACTGCCAGGAGACCACAGG + Intergenic
1080843584 11:36006716-36006738 GAACAATCCCATGACAATGCAGG + Intronic
1081989089 11:47328014-47328036 CAACACACCCAGCAGAAGACAGG - Intronic
1084246654 11:67862306-67862328 GAAGACTGCCAGGAGACCACAGG + Intergenic
1084826025 11:71732185-71732207 GAAGACTGCCAGGAGACCACAGG - Intergenic
1085136430 11:74093253-74093275 GAAGATTTCCAGGAAAATACTGG - Intronic
1085781214 11:79410861-79410883 GAACCCTCCCTGTAGAGTACAGG - Intronic
1089674288 11:120079675-120079697 GAAAACTCCCAAGAGAAACCAGG + Intergenic
1090132829 11:124162520-124162542 GAACAGTGACTGGAGAATACAGG - Intergenic
1092417221 12:8299553-8299575 GAAGACTGCCAGGAGACCACAGG + Intergenic
1095992917 12:48050336-48050358 GAACACTGCCAGGAACACACCGG + Intronic
1098296366 12:69008173-69008195 CTACACTCCCAGGACAAAACAGG - Intergenic
1101943242 12:109116431-109116453 GAACTCTCCCAGGAGTAGCCAGG + Intergenic
1111330808 13:86760795-86760817 GAACACTCCCAGGGGAGGACTGG - Intergenic
1112697567 13:101967881-101967903 GAACACTCCCAGGATAAAATGGG + Intronic
1113231266 13:108215884-108215906 GAAAACTCCCAAGAGAGAACAGG + Intronic
1114413940 14:22526475-22526497 GAAGACTCCCTGGAGCTTACAGG + Intergenic
1116332542 14:43614045-43614067 GAACCTACCCAGGAGAAGACTGG + Intergenic
1122507150 14:102238905-102238927 GAACACTCCCAGGGGAAGACTGG + Intronic
1122565520 14:102652432-102652454 GAACACTGCCAGAAGACTAGAGG - Intronic
1122904775 14:104796561-104796583 GGACACTCACAGGAGAGTGCAGG + Intergenic
1129106263 15:73309356-73309378 GAACACTGCAAGGGCAATACTGG + Intergenic
1133356312 16:5139589-5139611 GAAGACTGCCAGGAGACCACAGG + Intergenic
1143389772 17:6553403-6553425 TTACACTGCCAGGAGAATCCAGG - Intronic
1143396774 17:6605519-6605541 GAAGACTCCTAGGGGAAGACAGG - Intronic
1148447620 17:47747675-47747697 GAACACTCTCAGGCTAAGACAGG + Intergenic
1151835255 17:76578658-76578680 GAACACTCTCATGAGATTGCTGG - Intronic
1152401956 17:80071729-80071751 GGACACTCCCATGAGCCTACAGG - Intronic
1153252098 18:3133135-3133157 GAATAGTCCCAGGAAAATGCTGG + Intronic
1153978524 18:10290174-10290196 AAACACCGCCAGGAGAAAACTGG - Intergenic
1154168129 18:12031086-12031108 GAACACTCACATGATATTACTGG - Intergenic
1155157106 18:23167135-23167157 GCACACTCCCAGGAGATTAGGGG - Intronic
1155649413 18:28122378-28122400 GAAAACTCCTAGGAGAAAAAAGG - Intronic
1160410992 18:78675375-78675397 GAACACTCTCTTGGGAATACAGG + Intergenic
1167993874 19:53386738-53386760 GAAGATTCCCAGGAGACTCCTGG - Intronic
1167996979 19:53413694-53413716 GAAGATTCCCAGGAGACTCCTGG - Intronic
1168006763 19:53496390-53496412 GAACATTCCCAGGAGACTCCTGG - Intergenic
926178881 2:10622513-10622535 AAACACCCCCAAAAGAATACAGG + Intronic
926301550 2:11608071-11608093 GAAAAATCCCAAGAGAAGACTGG + Intronic
927485394 2:23485228-23485250 GAACTCTCTCAGGAGACTACCGG + Intronic
935476522 2:103529686-103529708 GCAAACTGCCAGGAGAACACAGG - Intergenic
943347294 2:186754553-186754575 GAACAGTACAAGGAAAATACTGG - Intronic
945307646 2:208274032-208274054 CAACATCCCCAGGAGAACACAGG + Intronic
946904988 2:224407226-224407248 CAAAACTCCCAGGAGAAGCCCGG - Intergenic
948096605 2:235339975-235339997 GAGCAATCCCAGGAGAATAAAGG + Intergenic
1170965284 20:21063271-21063293 AAACACTCCCAGGACAAGCCAGG + Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1175702229 20:61147911-61147933 GAACACTCCAAGGAGAGAAGAGG + Intergenic
1181264738 22:21624335-21624357 TAACACTCCCAGGAGGCTCCAGG - Intergenic
1183077677 22:35437097-35437119 GAACAGCCCCAGGAGGATGCTGG + Intergenic
952845674 3:37686222-37686244 GAGCACTCTCAGGAGAAGAGGGG + Intronic
954570772 3:51638972-51638994 GAGAACTCCCAGGAGAAGAGAGG - Intronic
955340277 3:58120066-58120088 AAACCCTCACAGGTGAATACAGG - Intronic
956527396 3:70179935-70179957 AAAGAATCCCAGGAGAATAAAGG - Intergenic
957060965 3:75481057-75481079 GAAGACTGCCAGGAGACTGCAGG + Intergenic
960932867 3:122872430-122872452 GAACACTCCCAGGAGAATACAGG - Exonic
961028133 3:123579012-123579034 GAAGACTCCCAGGAACATGCAGG - Intronic
961292416 3:125858363-125858385 GAAAACTGCCAGGAGACCACAGG - Intergenic
961412861 3:126735498-126735520 GAACACTCCCAAAAGGAAACTGG - Intronic
961894769 3:130158044-130158066 GAAGACTGCCAGGAGACCACAGG + Intergenic
964004500 3:151811707-151811729 GAACACTCCCAGGGGAGGACTGG + Intergenic
965079740 3:164021010-164021032 GAACACTTCCAGGGGAGGACTGG - Intergenic
965720656 3:171657682-171657704 TAAAATTCCCAGGAGAAAACAGG + Intronic
967204980 3:187111257-187111279 GAAGACATTCAGGAGAATACGGG + Intergenic
968094353 3:195917593-195917615 GAACACTCGCAGGGGAACGCAGG + Intergenic
969809032 4:9633589-9633611 GAAGACTGCCAGGAGACCACAGG - Intergenic
970493126 4:16596380-16596402 GAACAATCCCAAGAGAGTGCAGG + Intronic
970622366 4:17836534-17836556 GAAAACTCTCAGAAGAAAACAGG - Intronic
973596308 4:52494090-52494112 GAAAACTACCAGGAGAAAATGGG + Intergenic
974874801 4:67690343-67690365 TAAAACTCCCAGAAGAAAACAGG + Intronic
984106848 4:175558347-175558369 TAAAACTCCAAGGAGAAAACAGG - Intergenic
986389579 5:7272086-7272108 GAAAAGTCCCAGGAGAAAAGAGG + Intergenic
993800624 5:92330700-92330722 GAACAAACCTAGGAGAGTACTGG + Intergenic
994216043 5:97138730-97138752 GAACTCTACCAGGAGCATAGAGG - Intronic
994427776 5:99615488-99615510 GAACAGTTTCAGAAGAATACTGG + Intergenic
995046869 5:107660218-107660240 GAACACTGCCAGAAAAAGACTGG + Intronic
995255344 5:110039730-110039752 GAACCCTCTCAGGAAAAGACAGG - Intergenic
997170977 5:131720384-131720406 TAAAACTCCCAGAAGAAAACAGG + Intronic
999309373 5:150541900-150541922 GGAGACTCCCAGGATAATGCAGG - Intronic
1000342256 5:160286887-160286909 GAAGACTACCAAGAGAATAAGGG - Intronic
1000452022 5:161401062-161401084 GACCACTGCCAGGATGATACAGG + Intronic
1002042253 5:176523164-176523186 GAAGACTTCCAGAAGAAAACAGG - Intergenic
1003034862 6:2633564-2633586 GAACACTCACGGGAGAAAGCTGG + Intronic
1003535749 6:6973907-6973929 GAACACGACCTGGAGAATGCAGG + Intergenic
1004022541 6:11788290-11788312 GAACACTCCCAGGGGAGCACTGG + Intronic
1004557268 6:16711299-16711321 GAAATCTTCCAGGAGAAAACAGG + Intronic
1013339246 6:109197231-109197253 GAACAGTCCCAAGAGAGTGCAGG - Intergenic
1013578815 6:111511604-111511626 GAAAACTCCTAGGAAAATATTGG + Intergenic
1015984911 6:138875198-138875220 GAAGACTCCCTGGAGCAGACAGG + Intronic
1016116311 6:140290383-140290405 CAGCCCTCCCAGGTGAATACAGG - Intergenic
1016811673 6:148267017-148267039 GACCACTCGCAGCAGAATTCTGG - Intergenic
1018205532 6:161434244-161434266 GAACTCTTCCAAGAGCATACTGG - Intronic
1018897867 6:168033607-168033629 GAAAACACCCAGGAGAAACCGGG + Intronic
1019528315 7:1491115-1491137 TAACATTCCCGGGAGAAAACGGG + Intronic
1020346300 7:7167765-7167787 CAACAGTCTCAGGAGAATAAGGG - Intronic
1020662359 7:10996851-10996873 GCACACTCTCAGGAACATACAGG + Intronic
1020787547 7:12590296-12590318 GAACACTCCCAGGGGAGGACTGG - Intronic
1027188831 7:75986543-75986565 AAACACACCCAGGAGACTACGGG - Exonic
1030402379 7:109068109-109068131 GAACACAAACAGGAGAAGACAGG - Intergenic
1030510685 7:110479228-110479250 GAACACAGCCAAGAGAATAGTGG - Intergenic
1033145265 7:138865779-138865801 GAAGACAGCCAGGAGAAGACAGG + Intronic
1033890303 7:146004527-146004549 GAACAGACCTAGGAGAAGACGGG - Intergenic
1034514688 7:151566382-151566404 GAGCTCTCCAAGGAGAATTCAGG - Intronic
1036371062 8:8163247-8163269 GAAGACTGCCAGGAGACCACAGG - Intergenic
1036655687 8:10675703-10675725 GAACCATCACAGGAGAATGCTGG - Intronic
1036879835 8:12502389-12502411 GAAGACTGCCAGGAGACCACAGG + Intergenic
1039210263 8:35205076-35205098 GAACACTCCCAGGAGCTGGCAGG - Intergenic
1040499213 8:47992491-47992513 GAATACTCCCAGGGGAACACTGG - Intergenic
1045595758 8:103653443-103653465 GACAACTGTCAGGAGAATACTGG - Intronic
1045784483 8:105904345-105904367 GAAGACTCCCAGGGGAAGAGAGG + Intergenic
1046361704 8:113167627-113167649 CAACACTCCCTGGAAAATACAGG - Intronic
1046382873 8:113473605-113473627 GAACATACCCAGGGGAAGACTGG - Intergenic
1046468520 8:114637023-114637045 GGTCACTCCCACCAGAATACTGG - Intergenic
1046496349 8:115019292-115019314 GAACTCTCCCAGGAGTACATGGG + Intergenic
1048320087 8:133392605-133392627 GAAAATTCCCAGGACAATTCAGG - Intergenic
1186298774 X:8176808-8176830 GAACCCTACCAGGAGAAGACTGG - Intergenic
1186516508 X:10170189-10170211 TAACACTCCCTGTAGAATAGAGG + Intronic
1191779106 X:64847604-64847626 GAACACTTCCAGGGGAAGATTGG + Intergenic
1191970334 X:66807279-66807301 CAAAACTCCCAGAAGAAAACAGG - Intergenic
1193699296 X:84742887-84742909 GAGCACTCCCAGGAGAAGAGTGG + Intergenic
1198936594 X:141906466-141906488 GAGCACTCTCAGGAGAACTCTGG - Exonic
1200001039 X:153059894-153059916 GCACAGTCCCAGGAGATGACAGG + Intronic
1200696427 Y:6365058-6365080 GAATACTCCCACCTGAATACTGG + Intergenic
1200984827 Y:9293601-9293623 GAGTACTCCCAGGTGAACACAGG + Intergenic
1201037686 Y:9799641-9799663 GAATACTCCCACCTGAATACTGG - Intergenic
1201783266 Y:17745729-17745751 GAACACCCCCAGGAAAAAATAGG - Intergenic
1201818287 Y:18160258-18160280 GAACACCCCCAGGAAAAAATAGG + Intergenic
1202125612 Y:21566586-21566608 GAGTACTCCCAGGTGAACACAGG - Intergenic
1202153396 Y:21862806-21862828 GAGTACTCCCAGGTGAACACAGG + Intergenic
1202178036 Y:22115566-22115588 GAATACTCCCACCTGAATACTGG + Intergenic
1202213325 Y:22470829-22470851 GAATACTCCCACCTGAATACTGG - Intergenic