ID: 960937490

View in Genome Browser
Species Human (GRCh38)
Location 3:122912743-122912765
Sequence ACCTGGGCATTGGGGTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960937479_960937490 9 Left 960937479 3:122912711-122912733 CCCTAGCACAGAGTTGGCAGGGA 0: 1
1: 0
2: 2
3: 20
4: 216
Right 960937490 3:122912743-122912765 ACCTGGGCATTGGGGTTCCTGGG 0: 1
1: 0
2: 3
3: 22
4: 209
960937480_960937490 8 Left 960937480 3:122912712-122912734 CCTAGCACAGAGTTGGCAGGGAG 0: 1
1: 0
2: 3
3: 25
4: 374
Right 960937490 3:122912743-122912765 ACCTGGGCATTGGGGTTCCTGGG 0: 1
1: 0
2: 3
3: 22
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960937490 Original CRISPR ACCTGGGCATTGGGGTTCCT GGG Intronic
900504974 1:3025344-3025366 ACCTCGGGACTGGGGCTCCTAGG - Intergenic
901138158 1:7010923-7010945 ACCTGGGCACAGGTGTTCCCAGG - Intronic
901491084 1:9596665-9596687 ATCTGGGCCTTTGGGTTCCATGG + Intronic
902952201 1:19893871-19893893 ACCTTGGCATTGGGCTGCGTAGG + Intronic
905417282 1:37812686-37812708 ACCTGGGATTTGGGTTCCCTGGG - Exonic
905475668 1:38225952-38225974 ACCTAGGCAATGTGGTTCCAGGG + Intergenic
905884837 1:41486010-41486032 AACTGAGCATTGGGCATCCTGGG - Intergenic
906552152 1:46673809-46673831 ACCAGTGCCTTGGGGTACCTAGG - Intronic
912272259 1:108223483-108223505 ATCTGGGCATTGGTCTCCCTAGG + Exonic
912295961 1:108470838-108470860 ATCTGGGCATTGGTCTCCCTAGG - Exonic
912800992 1:112719628-112719650 TTTTGGGCCTTGGGGTTCCTAGG + Intergenic
915735266 1:158080652-158080674 ACCTGGGCATGGTGTCTCCTCGG + Intronic
917648214 1:177049207-177049229 TCCTGTGCCTTGGGGGTCCTGGG - Intronic
920310336 1:205044582-205044604 ACCTGTGCACTGGGTTTCTTGGG - Intronic
920969967 1:210734741-210734763 ACCTGCTCATGGGGCTTCCTAGG + Intronic
921482003 1:215674490-215674512 ATCTGGCCATTTGGGTTTCTTGG + Exonic
921613492 1:217239343-217239365 ATCTGGGCATTGAGTTTTCTGGG - Intergenic
1062873471 10:927116-927138 ACCAGGGCAATGGGGTTGATGGG + Intronic
1065527936 10:26641239-26641261 AACTGGGCATTGGGGTAGGTAGG - Intergenic
1065558064 10:26936503-26936525 AACTGGGCATTGGGGTAGGTAGG + Intergenic
1065859825 10:29863174-29863196 ACCAGGGCATTTGGTTTCATGGG + Intergenic
1067374048 10:45711078-45711100 ACCTGGGCACTGGGGCCCCTGGG - Intergenic
1067379640 10:45761184-45761206 ACCTGGGCACTGGGGCCCCTGGG + Intronic
1067565130 10:47330989-47331011 CCCTGGGCATTGCTGTCCCTGGG + Intergenic
1067881877 10:50052834-50052856 ACCTGGGCACTGGGGCCCCTGGG - Intergenic
1067887338 10:50101841-50101863 ACCTGGGCACTGGGGCCCCTGGG + Intronic
1069075061 10:64030647-64030669 GCCTGGGCATTGCAGTTTCTGGG + Intergenic
1069728413 10:70595888-70595910 ACCTGGACATTGGGATGCTTTGG - Intergenic
1069885115 10:71618702-71618724 ACGTGGGCAGAGGGGCTCCTGGG - Intronic
1070790650 10:79187376-79187398 AGCTGGGCAGTGAGGTTGCTGGG - Intronic
1072445780 10:95497420-95497442 ACATGGGAACTGGGTTTCCTGGG - Intronic
1074191510 10:111142040-111142062 ACTTGGAAATTGTGGTTCCTAGG + Intergenic
1075023259 10:118966625-118966647 ATCTAGGCAGTGGGGATCCTGGG - Intergenic
1075234259 10:120712151-120712173 ACCTGGGCAGTGAGCTTGCTTGG + Intergenic
1076595044 10:131620121-131620143 ACCTAGGCAATGAGTTTCCTCGG + Intergenic
1076919853 10:133445904-133445926 AGGTGGGCATTGGGGTGCGTCGG + Intergenic
1079331064 11:19533489-19533511 TCCTGGGCATGTGTGTTCCTGGG + Intronic
1080233687 11:30045654-30045676 AGCTGTGCATTTGGGTCCCTGGG - Intergenic
1080663394 11:34315263-34315285 ACCAGGGCACTGAGGTTCCTGGG + Intronic
1081967296 11:47177628-47177650 ACCTCTGCTTTGGGGTTCCTGGG - Exonic
1082884496 11:58068375-58068397 ACCATGGCATTGGGTTTCCCGGG - Intronic
1083308159 11:61771546-61771568 ATCTGGGCATTGAGGGTGCTGGG - Exonic
1083749531 11:64753715-64753737 GACTGGGGATGGGGGTTCCTGGG - Intronic
1083881715 11:65552212-65552234 ACCCGGGGATAGGGGTTCATAGG - Intronic
1085381183 11:76120204-76120226 ATCTGGGCTTTGTGGTTCCTTGG + Intronic
1089959150 11:122600221-122600243 ACCTGGGCATTTGGGGTCAATGG + Intergenic
1094870266 12:34595744-34595766 CCCTGGGCCTTGGGGATCCTGGG + Intergenic
1095958834 12:47820960-47820982 ACCTCGCCATTGTGCTTCCTGGG + Intronic
1098976912 12:76912431-76912453 ACCTGGGCAGTGGAGGTGCTGGG + Intergenic
1100897200 12:99196979-99197001 CCCTTGGCTTTGGGGTTGCTAGG - Intronic
1103566217 12:121817160-121817182 GCCTGGGCATTGGGCTGCGTGGG + Exonic
1105637527 13:22229743-22229765 ACCTGGGCAGTGTGGTCCCAAGG - Intergenic
1111014258 13:82356149-82356171 ACCTGAGCATTTGTTTTCCTGGG - Intergenic
1112753339 13:102604062-102604084 AGCTGGGCGTGGGGATTCCTGGG + Intronic
1114696770 14:24633138-24633160 TCCTGGGCATTTGGGAGCCTGGG + Intronic
1119296890 14:73539787-73539809 GCCGGGGCACTGGGGTTTCTCGG + Intronic
1119301125 14:73571701-73571723 GCCGGGGCACTGGGGTTTCTCGG + Intronic
1121102588 14:91260249-91260271 ACCTAGGCAGTGGGGCTCCAGGG - Intergenic
1121219535 14:92275274-92275296 ATCTGGGATGTGGGGTTCCTGGG - Intergenic
1121622058 14:95357139-95357161 AGCTGGGTACTGGGGTTGCTGGG + Intergenic
1122973698 14:105162580-105162602 CCCTGGGCTTTGGGGTGCCCTGG - Intronic
1123016128 14:105376573-105376595 ACCTGGGGACCGGGGGTCCTCGG + Intronic
1123033041 14:105460167-105460189 ACCTGGGGAGTGGTGTGCCTGGG + Intronic
1123033061 14:105460226-105460248 ACCTGGGGAGTGGTGTGCCTTGG + Intronic
1124608229 15:31187669-31187691 ACCTGGGTAATGGGATTGCTGGG + Intergenic
1125450957 15:39806773-39806795 ACCTGGGGATGGGAGTTCCATGG - Intronic
1125592062 15:40860852-40860874 AGCTGGGCAGTGGAGATCCTGGG + Intergenic
1125920825 15:43524672-43524694 TCCTGGGCCTGGGGGCTCCTGGG - Exonic
1126112124 15:45181377-45181399 CCCTGGGCATAGAAGTTCCTGGG + Intronic
1126425357 15:48521871-48521893 AACTGGGGATTGGGGCCCCTGGG - Intronic
1126800766 15:52295265-52295287 CCCTGGGCACTGGGGATTCTAGG + Intronic
1126802409 15:52310873-52310895 TACTGGGCCTTGGGGTTCCCTGG + Exonic
1127184209 15:56461255-56461277 GACTGGGCCTTGGGGTTTCTAGG - Intronic
1129454181 15:75667652-75667674 ACCTGGGCAGTCAGGTTCTTTGG + Intergenic
1134474879 16:14564489-14564511 ACCTGGGCATGGGGCTTGCCAGG + Intronic
1136584421 16:31174778-31174800 ACTGGGGCCTTGGGGGTCCTGGG - Intergenic
1136666817 16:31819628-31819650 GCCTGGGCCTTGGGGACCCTTGG + Intergenic
1138307962 16:55995493-55995515 ACATGGGCATAGGGGTTCCAAGG + Intergenic
1139590070 16:67928502-67928524 ACCTGGGGAATGGGGCACCTGGG + Exonic
1141172461 16:81700110-81700132 ACATGGGCATTGGGGTACCTGGG + Intronic
1141426566 16:83947990-83948012 ACCCAGGCCTGGGGGTTCCTGGG + Intronic
1141764777 16:86051316-86051338 AGCTCGGCATTGGGGAGCCTTGG - Intergenic
1142010796 16:87712843-87712865 GCCTAGGCATTGGGTCTCCTGGG + Intronic
1143275416 17:5706210-5706232 AGCTGGGCAGAGGGGTACCTTGG + Intergenic
1144660416 17:17064432-17064454 ACCTGGGCAAAGGGGTACATGGG - Intronic
1144842841 17:18198948-18198970 ACCTGGGTCTTGTGGTTCGTTGG + Intronic
1144950647 17:18991872-18991894 TCTTGGGCATTGGGCCTCCTGGG - Intronic
1146571076 17:33953924-33953946 TGCTGGGCAATGGGGTTCCATGG + Intronic
1148554473 17:48570111-48570133 ACCTGGGAAATAGGGATCCTGGG - Intronic
1149102907 17:52927801-52927823 ACGTGGGCTTTGGGGGTCATGGG - Intergenic
1149121203 17:53167901-53167923 ACTTGGACTTTGGGGTTACTTGG + Intergenic
1151411973 17:73936971-73936993 ACCTGGGCAGTGGGCCCCCTGGG - Intergenic
1152217734 17:79044176-79044198 GCCTGGGCCTTGGGGCCCCTGGG + Intronic
1152427749 17:80227694-80227716 GCCTGGGCATTGGGCCTCCCTGG + Intronic
1152554724 17:81047093-81047115 CCCTGGGCATTGGCCCTCCTGGG + Intronic
1154308945 18:13253001-13253023 ACCGGGGCACTGGGGGTCCAGGG + Intronic
1154339690 18:13492720-13492742 ACCTGGGCAGTGGGGTGCCCTGG + Intronic
1156627590 18:38927822-38927844 CTCTGGGCATTGGGGTTCAGCGG + Intergenic
1156957843 18:42990411-42990433 AACTGGGCCATGGGGTGCCTAGG - Intronic
1157287068 18:46384245-46384267 ACCTGGGCACTGGAGTCCCAGGG + Intronic
1157424616 18:47574099-47574121 AACTGGGGATTGAGCTTCCTAGG + Intergenic
1160187395 18:76686208-76686230 ATCTGGTCCTTGGGGTTGCTGGG + Intergenic
1160873542 19:1287275-1287297 GCCGGGGCTTTGGGGGTCCTGGG + Intronic
1161108287 19:2455352-2455374 AGCTGGGTATTGGGGTATCTGGG - Intronic
1161718759 19:5892033-5892055 GCCTCGGCTTTGGGGTTCCCTGG + Exonic
1161805050 19:6438415-6438437 ACATGGTCCTTGGTGTTCCTTGG - Intronic
1161811990 19:6476477-6476499 CCCTGGGTATTCGGGTCCCTGGG + Intronic
1162155404 19:8674652-8674674 TCTTTGGCACTGGGGTTCCTAGG + Intergenic
1163288742 19:16365007-16365029 CCCTGGGTTTGGGGGTTCCTGGG - Intronic
1164890546 19:31819919-31819941 ACCTGGTCATTGGATGTCCTGGG - Intergenic
1166817688 19:45556817-45556839 CCCTGGGCTTGTGGGTTCCTGGG + Intronic
1168413030 19:56151682-56151704 TGCTGTGCATTGGGGTTTCTTGG + Intronic
925283273 2:2699795-2699817 ACCTGCGCAGTGTGGCTCCTGGG + Intergenic
926797224 2:16628998-16629020 AGCTGGGTATTAGGGTTCCGGGG - Intronic
927032854 2:19140700-19140722 ACCTGGGCCTGGGGCTTTCTGGG - Intergenic
928207673 2:29298159-29298181 ACCAGGGCATTGGGGCCCCCAGG + Intronic
929234778 2:39594216-39594238 ACCTGGGCTTTGGGGTTGCTAGG - Intergenic
932236442 2:70124523-70124545 AGCTGGGATTTGGGGTTCCACGG + Intergenic
933832177 2:86219896-86219918 CCCTGGAGATTGGGGGTCCTGGG - Intronic
935123132 2:100199210-100199232 ACTCAGGCATTGGGGTCCCTGGG + Intergenic
935199510 2:100844190-100844212 AGCTGGGCATGGTGGTTGCTGGG - Intronic
938972137 2:136442342-136442364 ACCTGGGAATTGGGGTGCCTGGG + Intergenic
943880953 2:193142926-193142948 CCCTGGGCAATGGGGTGTCTCGG + Intergenic
944231404 2:197397209-197397231 ACCTGGGCATCTGGGCACCTGGG - Intronic
946688324 2:222293152-222293174 ACCTGGGACTTGGAGTTCATTGG - Intronic
947028695 2:225768406-225768428 ACCTAGTAAGTGGGGTTCCTGGG - Intergenic
948493774 2:238331784-238331806 CCCTGGGAACAGGGGTTCCTCGG - Intronic
948599802 2:239101719-239101741 ACCTGGGGATGGGGGATCCCAGG - Intronic
948837508 2:240632706-240632728 TCCTGGGCATGGGCCTTCCTGGG - Intergenic
1170741128 20:19057364-19057386 CCCTGGGAATGGGGCTTCCTGGG - Intergenic
1171265726 20:23771063-23771085 AACTTGGCATTGGGGGTACTGGG - Intergenic
1173056406 20:39617859-39617881 AGCTGGGCATGGTGGTTCATGGG - Intergenic
1174442788 20:50569353-50569375 ACGTGGGCACTGGGACTCCTCGG - Intronic
1174496911 20:50952047-50952069 ACCCAGGCATTGTGGTTCCAGGG - Intronic
1175810082 20:61853148-61853170 ACCCGGGCACTGGGAGTCCTGGG + Intronic
1175851789 20:62097686-62097708 ACATGGGCATGAGGGTTCCCAGG + Intergenic
1175909298 20:62397008-62397030 AGCTGGGCATTGGGGCACCATGG + Intronic
1178354302 21:31897803-31897825 CCCTGGGCATTGATGTTTCTTGG + Intronic
1179965770 21:44804234-44804256 CCCTGGGAGTGGGGGTTCCTGGG + Intergenic
1180642690 22:17311681-17311703 AACTTGGAATTGGGGTTCATGGG + Intergenic
1181006126 22:20014570-20014592 AGCTGGGCCTTGGGGGTCCTGGG - Intronic
1184034814 22:41913356-41913378 CCCAGGGCATGGGGGTTGCTGGG + Intronic
1184036783 22:41922001-41922023 ACCTGGGCATTTGGATACTTTGG - Intergenic
1184110241 22:42389895-42389917 TCCTGGGCATTGGGGGTGATGGG + Intronic
1185111233 22:48901361-48901383 ATCTGGAGATTGGGGATCCTGGG - Intergenic
1185150941 22:49163700-49163722 ACCTGGGCACTGGAGTTCTTGGG + Intergenic
950086191 3:10259695-10259717 ACTGGGGGATTGGAGTTCCTGGG + Intronic
952851713 3:37734914-37734936 ACCTGGGGATTGGGGGGCATGGG + Intronic
953718097 3:45333109-45333131 ACCTGGGCAGTGGTGTTGCTTGG + Intergenic
954361907 3:50126590-50126612 ACCTGGGCCTTGGGCTCCTTGGG - Intergenic
954646325 3:52133800-52133822 ACCTGGGCATGGGGGCTCTGCGG - Intronic
955202377 3:56862551-56862573 ACATTGGCATGGGGGTTCCCAGG - Intronic
956106241 3:65821736-65821758 ACCTGGGCAAAGGGGATGCTTGG + Intronic
960937490 3:122912743-122912765 ACCTGGGCATTGGGGTTCCTGGG + Intronic
961741860 3:129038233-129038255 CCCTGTGCATTGGGCTGCCTGGG + Intronic
968634729 4:1672129-1672151 ACCTGGGTCTTTGGGTCCCTAGG - Intronic
969929235 4:10613965-10613987 GCCTGGGCATTCAGGGTCCTTGG - Intronic
975060056 4:69986001-69986023 ACCTGGGCTTTGGGAGTCATGGG - Intergenic
979813141 4:125064866-125064888 ACCTGGGCATGCTTGTTCCTGGG - Intergenic
984346288 4:178531678-178531700 ACCTGTGCTTTAGGGTACCTTGG + Intergenic
985540428 5:484964-484986 ACATGGTCCTGGGGGTTCCTGGG - Intronic
988841121 5:35084949-35084971 ACCTGGGTATGGTGGTGCCTGGG - Intronic
993308288 5:86296507-86296529 ATCTGGGCATTGGTCTCCCTAGG - Intergenic
994591958 5:101784481-101784503 ACCTGTGCCTTGGTGGTCCTGGG + Intergenic
998041182 5:138951867-138951889 ACCTGGACCTTGGGGTTGCTGGG + Exonic
998210287 5:140191956-140191978 GCCTTTGCATTAGGGTTCCTAGG + Intronic
998847852 5:146328135-146328157 GACTGGGAATTGGGTTTCCTGGG + Intronic
999315606 5:150582199-150582221 TCCTGGGGAAAGGGGTTCCTGGG - Intergenic
999776312 5:154815337-154815359 AACTTGGCCTTGGGGTTCCAAGG - Exonic
1001131458 5:169067453-169067475 ACATAGGCAGTGTGGTTCCTGGG + Intronic
1001769725 5:174284516-174284538 TTCTGGGCATTTGGGTTCCTGGG + Intergenic
1002032554 5:176441260-176441282 ACATGAGCATGTGGGTTCCTGGG + Intergenic
1002092516 5:176813516-176813538 GCCTGGGCTTTGGGGCCCCTAGG + Intronic
1002402241 5:178997180-178997202 ACCTGCATGTTGGGGTTCCTGGG - Intergenic
1003660549 6:8056700-8056722 AAATGGGCTTTGGGGTTCCAGGG + Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006830414 6:36964701-36964723 AGCTGGGGATGGGGATTCCTAGG + Exonic
1010001831 6:70956474-70956496 AGCTGCGCACTGGGGTCCCTCGG - Exonic
1012476431 6:99619015-99619037 CCCTGGGAATAGGGGTTTCTGGG + Intergenic
1014216726 6:118758915-118758937 ACCTAGGCACTGGGATTGCTGGG - Intergenic
1015356462 6:132282548-132282570 ACCTGGTTAATGGGGTTCCTTGG - Intergenic
1018167860 6:161116284-161116306 ACATGGGCATTTGGATACCTGGG + Intronic
1019178885 6:170175283-170175305 ACCTGGGCTGAGGGGGTCCTGGG + Intergenic
1019603446 7:1896539-1896561 ACCTGGGAACTCGGGATCCTGGG - Intronic
1022319902 7:29278713-29278735 AGCAGGGCACTGGGGTCCCTCGG - Intronic
1024486350 7:49924924-49924946 TCCTGTGCATTGGGTTTTCTTGG - Intronic
1025295454 7:57772503-57772525 ACTTGGGCATCGGGGCTCCGAGG + Intergenic
1026166223 7:67912157-67912179 ACCCTGGCATTGGAGTTTCTTGG - Intergenic
1026631685 7:72043330-72043352 CCCTGGGAAATGGGCTTCCTGGG - Intronic
1026859055 7:73773229-73773251 AGCTGGGCCTTGGGGTTTTTTGG + Intergenic
1029124163 7:98285728-98285750 CCCTGGCCATTGGGTTTGCTGGG + Intronic
1032092060 7:128915971-128915993 GCCTGGGCCTTGGGGTTCCCTGG + Intergenic
1032709867 7:134452154-134452176 ACATGGGAATTGGGGTCCATAGG - Intronic
1032753761 7:134868576-134868598 ATCTGAGCATTGGAGTTACTGGG - Intronic
1035028667 7:155843683-155843705 GCCAGGGCTGTGGGGTTCCTGGG + Intergenic
1036061882 8:5332094-5332116 ATCTGGCCATGGGGGTTCATGGG + Intergenic
1040314856 8:46255548-46255570 AACTGGGCAGTAGGGTTGCTTGG + Intergenic
1040527546 8:48238247-48238269 ACCTGGACATTCTGGTTCTTCGG - Intergenic
1040683909 8:49847238-49847260 ACCTGGGCAGTGGGGCTCTCAGG + Intergenic
1041173305 8:55167497-55167519 ACCTGGTTATTTGGGGTCCTGGG - Intronic
1041374360 8:57197814-57197836 ACTTTGGCATTTGGGATCCTGGG + Intergenic
1043417931 8:80070674-80070696 ACCTGGGCGTTGGGGATCCCTGG + Intronic
1045220791 8:100197936-100197958 ACCTGGGGATTTGAGTTCATGGG + Intronic
1045754933 8:105531371-105531393 ACAGGGGCCTTGGGGTTCCTTGG + Intronic
1046532266 8:115462205-115462227 TCCTGGGCACTGGAGTTGCTTGG - Intronic
1048130291 8:131688698-131688720 GCCTGGACTTTTGGGTTCCTGGG + Intergenic
1050654288 9:7809229-7809251 AACTGGGTATTAGAGTTCCTTGG + Intronic
1050687327 9:8186569-8186591 ACCTGGGCATTTGAGTCACTAGG - Intergenic
1050923865 9:11239586-11239608 GCCTGGGCATTGGGGACCCCTGG - Intergenic
1054947767 9:70814316-70814338 AGCTGGACTTTGGGGTGCCTAGG + Intronic
1057196779 9:93119912-93119934 ACCTGGGCATTGGGACTGCAGGG + Intergenic
1057210489 9:93198534-93198556 GCCCGGGCATTGGGTTTCATGGG + Intronic
1057290956 9:93807303-93807325 TCCTGGGCAGTGGGCATCCTGGG + Intergenic
1057441608 9:95087743-95087765 AGCTGGGCACTGAGCTTCCTTGG + Intergenic
1057704886 9:97389292-97389314 ACCTGGCCTATGGGATTCCTCGG + Intergenic
1057895250 9:98903982-98904004 ACCTGGGGATTGGAGTTCTGAGG - Intergenic
1058246445 9:102631972-102631994 ATCTGGGCAATGGGGCTCCCTGG + Intergenic
1060403556 9:123361875-123361897 ACCTGGGCATTGTGGTGACAAGG + Intronic
1061278045 9:129580858-129580880 TCCTGGGCAATGGGGTGCCGTGG - Intergenic
1061822719 9:133237418-133237440 AGCTGAGCCTTGGAGTTCCTGGG - Intergenic
1062057223 9:134474940-134474962 ACCTGGACAGAGGGGCTCCTGGG - Intergenic
1062236576 9:135513034-135513056 AGCTGAGCCTTGGAGTTCCTGGG + Intergenic
1185762576 X:2700083-2700105 ACGTGGGCACAGGGGTTGCTGGG + Intronic
1185891085 X:3822614-3822636 GCCTGGGCTTCGAGGTTCCTTGG - Intronic
1185896189 X:3861030-3861052 GCCTGGGCTTCGAGGTTCCTTGG - Intergenic
1185901308 X:3899456-3899478 GCCTGGGCTTCGAGGTTCCTTGG - Intergenic
1185906418 X:3937888-3937910 GCCTGGGCTTTGAGGTTCCTTGG - Intergenic
1186211321 X:7253291-7253313 ACCTCGGCATTGGAGATCCTGGG + Exonic
1186436885 X:9550815-9550837 ACCAGGGCAGTTGTGTTCCTTGG + Intronic
1186721106 X:12305206-12305228 ACCTGGGCAGCAGGATTCCTGGG - Intronic
1190254693 X:48753772-48753794 CCCTGGGCAGTGTGCTTCCTGGG - Intergenic
1198271088 X:135056451-135056473 GCCTGGGGATTGGGGTCCCCTGG + Intergenic
1198644675 X:138793110-138793132 CCCCAGGCATTGGTGTTCCTTGG - Intronic
1199676541 X:150194534-150194556 ACCTGGGAGCTGAGGTTCCTGGG - Intergenic
1201584668 Y:15547313-15547335 ACCTTGGCATTGGAGATCCTGGG + Intergenic