ID: 960937838

View in Genome Browser
Species Human (GRCh38)
Location 3:122913983-122914005
Sequence CGGGGTCCACGCCCCATTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960937835_960937838 -10 Left 960937835 3:122913970-122913992 CCCACGATGACCACGGGGTCCAC 0: 1
1: 0
2: 1
3: 2
4: 36
Right 960937838 3:122913983-122914005 CGGGGTCCACGCCCCATTCCTGG 0: 1
1: 0
2: 1
3: 4
4: 89
960937831_960937838 12 Left 960937831 3:122913948-122913970 CCACAGGACGTGCTGCACAGCGC 0: 1
1: 0
2: 0
3: 6
4: 110
Right 960937838 3:122913983-122914005 CGGGGTCCACGCCCCATTCCTGG 0: 1
1: 0
2: 1
3: 4
4: 89
960937830_960937838 18 Left 960937830 3:122913942-122913964 CCGATGCCACAGGACGTGCTGCA 0: 1
1: 0
2: 0
3: 16
4: 111
Right 960937838 3:122913983-122914005 CGGGGTCCACGCCCCATTCCTGG 0: 1
1: 0
2: 1
3: 4
4: 89
960937829_960937838 26 Left 960937829 3:122913934-122913956 CCTGGAAGCCGATGCCACAGGAC 0: 1
1: 0
2: 0
3: 14
4: 126
Right 960937838 3:122913983-122914005 CGGGGTCCACGCCCCATTCCTGG 0: 1
1: 0
2: 1
3: 4
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960937838 Original CRISPR CGGGGTCCACGCCCCATTCC TGG Exonic
901738106 1:11325115-11325137 CGGGGTCCTCGCTCCCTCCCTGG - Intergenic
903859020 1:26354160-26354182 CAGGGGCCACGCCCCATCACAGG - Intergenic
912497769 1:110102448-110102470 TGGGGACCACTCCCCATGCCTGG + Intergenic
922792470 1:228317816-228317838 CAGGGTGCAGGCCCCACTCCCGG - Intronic
924291684 1:242543077-242543099 CGTGTTCCATGCCCCTTTCCTGG + Intergenic
1062984502 10:1755116-1755138 CAGCGTCCTCGCCCCATGCCAGG - Intergenic
1063321845 10:5058658-5058680 CAGGGTCCACGGACCATTGCAGG - Intronic
1064209148 10:13348297-13348319 CGGCGCCCCCGCCCCCTTCCCGG - Exonic
1065813889 10:29467380-29467402 CGGGGACCAAGCCACCTTCCAGG - Intronic
1076582312 10:131520048-131520070 CAGGGTCCCCGCCCCGCTCCTGG - Intergenic
1076683606 10:132187144-132187166 CGGCGTCCAGGCCCCACTCCGGG - Intronic
1077098325 11:809504-809526 CCGGGCCCACGCGCCGTTCCGGG + Intronic
1079130865 11:17746227-17746249 GGGGGTCCAAACCCCAATCCAGG + Intronic
1081799367 11:45847433-45847455 CGGGGTCCACGTCGCCTACCGGG + Exonic
1083609828 11:63999483-63999505 CTGGGTCCACCGCCCACTCCTGG + Intronic
1083624769 11:64066911-64066933 CGGAGCCCACGCCCCAGCCCAGG + Intronic
1084106180 11:66982211-66982233 CGGGGTCCACGCCTTCTTCTGGG + Intergenic
1084225723 11:67713690-67713712 CTGGGCCAAGGCCCCATTCCTGG - Intergenic
1089393082 11:118115253-118115275 AGGTGTCCACACCCCCTTCCGGG - Exonic
1094344595 12:29453291-29453313 CTGGGTCCACTCCTTATTCCTGG + Intronic
1103096473 12:118136488-118136510 CGGGGTCCATGTCCCATGCCTGG + Intronic
1103899636 12:124296547-124296569 CTGGCTCCACTCCCCTTTCCTGG + Intronic
1110090000 13:71433468-71433490 TGGGGGACACCCCCCATTCCTGG - Intergenic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1115523134 14:34252847-34252869 CAGATTCCATGCCCCATTCCTGG - Intronic
1115647928 14:35383325-35383347 CGGGCTCCAGGCGCCATTACAGG - Intergenic
1117084049 14:52181041-52181063 CAGGGTACACCCCCCACTCCTGG + Intergenic
1119479088 14:74948606-74948628 CGTGGGCCACTCCCCAATCCAGG - Intronic
1122162434 14:99793777-99793799 CGGGGTCCGCGCGCCAGTGCCGG - Intronic
1124343266 15:28903587-28903609 CGGGGTCCCCGCCCATTTACAGG - Intronic
1132328864 15:100996358-100996380 CAGGGTCCATGCCCCAGCCCTGG - Intronic
1132392387 15:101448546-101448568 CTGGGCACATGCCCCATTCCAGG + Intronic
1141630225 16:85283595-85283617 TGGGGTCCACAGCCCATCCCAGG - Intergenic
1142367479 16:89657699-89657721 CGGGGTCGCCGCCCCACTTCCGG + Exonic
1143446938 17:7015166-7015188 CAGCGTCCACGTCCCAGTCCGGG - Intronic
1144576811 17:16434811-16434833 GGGGGGCCACGCCCCTCTCCGGG + Intronic
1145866934 17:28247678-28247700 CTGGGCCCACTCCACATTCCTGG + Intergenic
1145909603 17:28534853-28534875 CCAGCTCCAGGCCCCATTCCTGG + Exonic
1146929712 17:36768527-36768549 TGGGGTCCCCGCCCCAGGCCTGG + Intergenic
1147925153 17:43941398-43941420 CTGGGCCCACTCCACATTCCTGG - Intronic
1152566305 17:81101941-81101963 CGGGGGCCAGGCCCCATGACGGG + Intronic
1154437417 18:14357577-14357599 CACTGTCCCCGCCCCATTCCTGG + Intergenic
1157312528 18:46562792-46562814 CCTGGTGCACGCCCCATACCAGG - Intronic
1161238729 19:3210345-3210367 CGGTGCCCAGGCCCCCTTCCTGG + Intergenic
1161396481 19:4047388-4047410 CGGGCCCCAGGCCCCATGCCGGG + Exonic
1162569545 19:11463237-11463259 CGCGGGCCAGGCCCCATCCCAGG - Intronic
1163548378 19:17952162-17952184 CGGGGTCCGCGCCCCCTCCCCGG + Intronic
1163584452 19:18156221-18156243 AGGGGACCACCCCCCTTTCCAGG - Intronic
1165436439 19:35797762-35797784 CTGGGCCCACACCCCAGTCCTGG + Intergenic
1165603470 19:37078509-37078531 CGGGTTCCAAGCCCAATTTCGGG - Exonic
1166290518 19:41860457-41860479 CGGGGCCCACGCTCGGTTCCCGG - Intronic
1166663818 19:44665060-44665082 CTGGGCCCACTCTCCATTCCTGG - Intronic
1167906413 19:52664628-52664650 GGGGTTCCACCCCCCAGTCCTGG - Intronic
924962203 2:45707-45729 CGGGGTCCAGGCCGCAGTACTGG + Exonic
928218566 2:29383109-29383131 CTGGGTCCACGCTTCATTCTTGG + Intronic
928608079 2:32962790-32962812 CGGAGCTGACGCCCCATTCCAGG - Intronic
928756729 2:34535245-34535267 CAGGGTCCTGGTCCCATTCCTGG + Intergenic
929951281 2:46411477-46411499 CAGTGGCCATGCCCCATTCCTGG - Intergenic
930220007 2:48736539-48736561 AGGGGCCCAAGCCCCAATCCTGG - Intronic
931649294 2:64454147-64454169 CCGGGTCCCCGCCCTGTTCCCGG + Exonic
937644919 2:124255746-124255768 AGGAATCCATGCCCCATTCCTGG + Intronic
938232022 2:129669498-129669520 CAGGGTCCACACACCCTTCCCGG + Intergenic
1170026201 20:11891387-11891409 CGGGGGCCGCGCCCCTCTCCCGG + Intronic
1170737185 20:19022264-19022286 GGGGGCTCACGCCCCATTTCAGG + Intergenic
1170900662 20:20459654-20459676 TGGTGTCCATGGCCCATTCCAGG - Intronic
1175589190 20:60173723-60173745 AGGGGTGCACGCCCCATTGAAGG - Intergenic
1176195466 20:63834815-63834837 AGGGGACCCAGCCCCATTCCAGG + Intergenic
1179126800 21:38598270-38598292 TGGGCCCCATGCCCCATTCCTGG + Intronic
1180167699 21:46038528-46038550 CGGGATTCATGCCCCATGCCTGG + Intergenic
1181026493 22:20130723-20130745 CTGGGTCCCGGCCCCAGTCCTGG + Intronic
1181282122 22:21727754-21727776 CTGGGTCGTCGCCCCATCCCTGG + Intronic
1184516339 22:44965069-44965091 CGGTGTTCACGCCACATTGCAGG - Intronic
1184698007 22:46150513-46150535 CCGCGTCCACGGCCCATGCCCGG - Intronic
949947607 3:9202770-9202792 TGGAGTCCATGCCCCATGCCAGG + Intronic
960937838 3:122913983-122914005 CGGGGTCCACGCCCCATTCCTGG + Exonic
961655288 3:128438459-128438481 CAGGCTCCAGGCCCCATCCCAGG + Intergenic
976764426 4:88584395-88584417 CGGGGTGCACGTTCCATTCCAGG + Intronic
998253363 5:140567259-140567281 CGGTGCCCATGCCCCATTGCTGG + Exonic
1001280326 5:170382013-170382035 CAGCCTCCACGCCCCATCCCAGG + Intronic
1002450556 5:179316154-179316176 CGGTGCCCACGCCCCAGTCTGGG - Intronic
1002578747 5:180194482-180194504 CGGGGTCTACGCTCAAGTCCCGG + Intronic
1006097046 6:31662507-31662529 CGGGGTCCCAGCCCCATTCCTGG + Exonic
1016029909 6:139326552-139326574 AGGGGTCCTGCCCCCATTCCTGG + Intergenic
1024089306 7:45921874-45921896 CGGGGCCTTCGCCCCTTTCCAGG + Intronic
1046478697 8:114784417-114784439 CTGGGTCCATGACTCATTCCTGG - Intergenic
1049172611 8:141171009-141171031 CAGGGCCCACGCACCCTTCCCGG - Intronic
1049532178 8:143160148-143160170 CGCGCTCCACGCCCCATCCGCGG - Intronic
1049728076 8:144160346-144160368 CTGGGAGCAGGCCCCATTCCTGG + Intronic
1049849243 8:144821888-144821910 CGGGCTCCACGCCCCTAGCCAGG + Intergenic
1054787215 9:69221204-69221226 CGTGGTCCAGGCCCCGCTCCAGG - Exonic
1062285159 9:135769613-135769635 CGGGGGGCAGGCCCCATGCCAGG + Intronic
1187403685 X:18984242-18984264 GGGCGTCCTCGCCCCACTCCCGG - Exonic
1187438284 X:19292655-19292677 AGGTGTACACGCCCCATCCCTGG - Intergenic
1188222860 X:27561379-27561401 AGGGATCCTCACCCCATTCCAGG + Intergenic
1196909200 X:120468868-120468890 CGGCGTCCACCCCCCGTTACCGG + Intronic