ID: 960938445

View in Genome Browser
Species Human (GRCh38)
Location 3:122917815-122917837
Sequence ATATTTTCCTCTGGGATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 237}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960938445 Original CRISPR ATATTTTCCTCTGGGATCAA TGG Intronic
902084039 1:13843572-13843594 ATTTTTTCCTGTGGGATCAGTGG + Intergenic
903112711 1:21150527-21150549 AGATTTTCCACAGGAATCAAGGG - Intronic
904640290 1:31922094-31922116 ATGTTTTCCTCTGTAATCTAAGG - Intronic
906564916 1:46792362-46792384 TTATTTTCCTTTGGGATTACTGG - Intronic
907204435 1:52756436-52756458 ATATTTTTCCCTGGGCTCCAAGG + Exonic
907565967 1:55434020-55434042 TTATATTTCTGTGGGATCAATGG - Intergenic
908466917 1:64405321-64405343 AAATTTGCCTCAGGGAACAAAGG - Intergenic
909410646 1:75346816-75346838 TTATTTTCCTCTAGTTTCAAAGG + Intronic
909901500 1:81142071-81142093 ATATTTTCATCTGTGACAAATGG - Intergenic
910242725 1:85105153-85105175 ATTGTTTCCACTGGGGTCAAAGG - Intronic
910516150 1:88062250-88062272 ATATATTTCTCTGGCATTAATGG + Intergenic
911253447 1:95606831-95606853 ATTTTTTCATCTGCGATTAATGG - Intergenic
914221565 1:145686563-145686585 ATACTTTCCCCTGTGATGAATGG - Exonic
914424743 1:147565393-147565415 ATATTTTCTTCTGAGATGGAAGG - Intronic
914474130 1:148009429-148009451 ATACTTTCCCCTGTGATGAATGG - Intergenic
914802795 1:150973448-150973470 AGATTTTCCCCTGGGAGGAAGGG - Intronic
916355802 1:163906153-163906175 ATATGTTCCTGAGTGATCAATGG - Intergenic
916698571 1:167266539-167266561 AGATTGTTGTCTGGGATCAAGGG + Intronic
916913648 1:169382287-169382309 ATATTTTCTTTTGTGATCTATGG + Intronic
917214177 1:172660755-172660777 GGATTTTCCTTTGTGATCAAGGG - Intronic
917672298 1:177284248-177284270 ATACTTGCATCTGGAATCAAAGG - Intergenic
917875637 1:179284467-179284489 ATATTTTCCTGTGCCCTCAAAGG + Intergenic
919422773 1:197391308-197391330 AAATTAGCCTGTGGGATCAATGG - Intronic
919438174 1:197590512-197590534 ATATTTTTCTCTGTAATTAAGGG + Intronic
919646515 1:200100025-200100047 ATATTTTCCTCTGGGTTGCTTGG - Intronic
923128620 1:231055515-231055537 ATATTTTCATTTAGGAGCAATGG + Intergenic
1063338300 10:5238129-5238151 TTATATTTCTGTGGGATCAATGG - Intergenic
1064751507 10:18535034-18535056 AAAGTTTTCTCTGAGATCAATGG + Intronic
1065735150 10:28744814-28744836 ATATATTCCTCTTGTATCCATGG - Intergenic
1068456259 10:57257671-57257693 ATATTTTTCTATGGGTCCAATGG - Intergenic
1072229412 10:93401080-93401102 ACATTTTCATTTGGGATAAAAGG + Intronic
1072995702 10:100241905-100241927 ATATTTTCCTCAGGAATCTTGGG + Intronic
1075605129 10:123799498-123799520 ATCTTTACATCTGTGATCAACGG - Intronic
1078047388 11:7928308-7928330 ATGTTTTCTTCTGGGAGCAATGG - Exonic
1079348154 11:19670771-19670793 ATAATTTCCTGTGGGCTCAGAGG - Intronic
1079788818 11:24710529-24710551 CTATTTTTCTCTGTGATTAATGG + Intronic
1080222022 11:29917119-29917141 AGATTTTCTTTGGGGATCAATGG - Intergenic
1081595813 11:44458645-44458667 ACAGTGTCCTCTGTGATCAAAGG - Intergenic
1082675360 11:56093640-56093662 GTGTTTCCTTCTGGGATCAATGG + Exonic
1083528225 11:63392484-63392506 ATATACTACTCTGGGATAAAAGG + Intronic
1085673683 11:78494106-78494128 CTATAGTCCTCTGGAATCAAGGG - Intronic
1085811026 11:79681177-79681199 ATAATTTCCTCATAGATCAAAGG + Intergenic
1086253951 11:84852078-84852100 ATATTTACCTTTTGGATCAATGG + Intronic
1087248214 11:95865612-95865634 ATATTTTCTCCTGGAAGCAAGGG + Exonic
1087253903 11:95934309-95934331 ATATCTTCTTCTGGGAACCATGG - Intergenic
1087714619 11:101594188-101594210 ATATTGTGCTCTGGAATCACTGG - Intronic
1088616405 11:111633903-111633925 ATTTTTTCCTCTGGAATCACAGG + Intronic
1090617019 11:128523714-128523736 ATATTTTCCTCTGGTCACTAAGG - Intronic
1091912395 12:4242959-4242981 CTGTTTTCCTCTGGTTTCAATGG + Intergenic
1092598963 12:10037791-10037813 ACATTTTCTTCTGGGGTTAAAGG + Intronic
1093727839 12:22535454-22535476 CTATTATCCTCTGGGACAAAGGG + Intronic
1094051838 12:26228586-26228608 ACAGTTTGCTCTGGGAACAATGG - Intronic
1095141869 12:38673675-38673697 AAATTTTCCTCTGGAAACATGGG - Intronic
1095733516 12:45532096-45532118 AGCTTTTCCTCTGAGACCAAGGG - Intergenic
1096461333 12:51822628-51822650 ATATTTTCCTCAGCGCCCAAAGG + Intergenic
1096551123 12:52372388-52372410 ATGTGTTCCTCGGGGCTCAAGGG - Intergenic
1098571832 12:71996575-71996597 ATATCTTGCTCCGTGATCAAGGG - Intronic
1100053895 12:90485683-90485705 AAATTTTCCTCTGGTTTCTATGG - Intergenic
1103845285 12:123897778-123897800 ATATTTTCTGCCGGGATCATTGG - Exonic
1106687477 13:32076368-32076390 ATATCTTCCTCAGGTATCAAAGG - Intronic
1107455278 13:40549342-40549364 AGATTTTTCTCTGGGCTCCAGGG - Intergenic
1107525148 13:41223206-41223228 ATATTTTCTTCTGAAATCAAAGG + Intronic
1108945910 13:56023755-56023777 ATATTTTACTCTGAGGGCAAGGG + Intergenic
1110167741 13:72463736-72463758 TTGTTTTCCTCTGGGAGCAGAGG - Intergenic
1111428156 13:88117281-88117303 ATGTTTTCATCTTGGATCAGTGG + Intergenic
1112811727 13:103225931-103225953 CTATGTTCCCCGGGGATCAAGGG - Intergenic
1113286714 13:108857607-108857629 AGTTTTTACTCTGGGATTAAAGG - Intronic
1113578153 13:111409012-111409034 ATGTATTTCTCTGGGAGCAAAGG + Intergenic
1114951801 14:27763721-27763743 TTTTTTCCCTCTGGTATCAATGG - Intergenic
1115368548 14:32585953-32585975 AAACTTTCCTCTGGGGGCAATGG + Intronic
1115578521 14:34735559-34735581 ATATTTGCCTCTGTGATTAGAGG - Intergenic
1115634129 14:35274926-35274948 ATATTTTCAGCTGAAATCAAGGG - Intronic
1116119865 14:40708917-40708939 TTTTTTTCCTGTGGGATCAGTGG - Intergenic
1116639326 14:47440809-47440831 ATTATTTCCTCTGGAATCCAAGG + Intronic
1117311914 14:54534408-54534430 ATTTTGTCCTCTGGGAGCAGTGG - Intronic
1119197005 14:72724575-72724597 ATGTGTTCCTCTGGGCTTAAGGG + Intronic
1120050246 14:79857594-79857616 ATAGTGTCCTGGGGGATCAAAGG - Intronic
1120764387 14:88315327-88315349 ATATTTTCCTCTGAGAACTGGGG - Intronic
1120972737 14:90221776-90221798 AGCTTTTCCTCTATGATCAAGGG + Intergenic
1126302330 15:47211673-47211695 ATGTTTTCCTCTTTGATAAAAGG - Intronic
1126737260 15:51743117-51743139 ACATTTACTTCTGTGATCAATGG + Intronic
1127738465 15:61871202-61871224 ATATTTTCCTCTGAGTTTAATGG + Intronic
1128205306 15:65846316-65846338 GTTTTCTCCTCTGGGATGAAAGG + Intronic
1130380824 15:83371202-83371224 ACATTTTCAACTGAGATCAAGGG - Intergenic
1135750226 16:25052544-25052566 ATTTTTTCCTCTGGGATTTTAGG + Intergenic
1140211883 16:72976997-72977019 ATGTTTTTCTCTGGGATGAAGGG + Intronic
1141010991 16:80398826-80398848 ATATTTACCCCTGGGATCCAAGG + Intergenic
1141257010 16:82411816-82411838 TAATATTCCTCTGGGATCATGGG - Intergenic
1141802819 16:86322718-86322740 ATATTTTCCTTTAGGATGATGGG - Intergenic
1143085174 17:4410703-4410725 ACATTTTCAGCTGGGATCAGTGG - Intergenic
1144157421 17:12519924-12519946 ATATGTTCCTTTGGGATAAATGG + Intergenic
1146972090 17:37081703-37081725 AGATTTTCATCTGGGATCATGGG - Intergenic
1147019459 17:37519929-37519951 TTATTTTTCTCTGTGATGAATGG - Intronic
1148840965 17:50496846-50496868 ATGTTTTCCTCTGGTATAGAGGG + Intergenic
1150558073 17:66271567-66271589 ATATTCACCTCTGGGTTCCAGGG - Intergenic
1151867966 17:76817138-76817160 ATGTTTTCTTCTGAGGTCAAAGG - Intergenic
1155334450 18:24750018-24750040 GCATTTTCCTTCGGGATCAAGGG + Intergenic
1155729336 18:29133127-29133149 ATTTTTTCCACAAGGATCAAAGG - Intergenic
1158296185 18:55999321-55999343 ATTTATTCCACTGGGATGAAAGG - Intergenic
1159037699 18:63293469-63293491 ATATCTTCCACTGAGATTAAAGG + Intronic
1162658621 19:12152000-12152022 TCATTCTCCTCTGGGAACAAAGG - Intronic
1167492158 19:49799141-49799163 GTATCTTTCTCTGGGCTCAAAGG + Intronic
926382052 2:12300799-12300821 CTATATTGCTCAGGGATCAAGGG + Intergenic
926538501 2:14144500-14144522 ATATATTCCTGTGGGGTCAGTGG + Intergenic
927116153 2:19903814-19903836 CTATTTTCCTCTTAGATCACTGG - Intergenic
927167099 2:20334504-20334526 AAATTAACCTCTGGGGTCAAAGG + Intronic
927333820 2:21897276-21897298 ATATTTTTGTCTGAGATCTATGG - Intergenic
928852243 2:35762685-35762707 ATATATTTCTCTGGGTGCAATGG + Intergenic
930182503 2:48376604-48376626 ATCTTTTTCTCATGGATCAATGG - Exonic
930488475 2:52038601-52038623 ATATTTTCATCTAGGCTTAAAGG + Intergenic
931203421 2:60123438-60123460 ATGTTTTTCTTTGGGATCTATGG - Intergenic
931811779 2:65861253-65861275 ATATTTTCTTCTGGCAGGAAGGG - Intergenic
933194891 2:79377638-79377660 ATATTTCCCTCTGGGGAAAAGGG + Intronic
935017403 2:99196955-99196977 ATTTTTTCCTCATGGAACAAGGG + Exonic
935323676 2:101914150-101914172 ATATTTTCCCCTGCAATTAAGGG - Intergenic
936449156 2:112620445-112620467 AAATGTTCCTCTGGGATCAAGGG + Intergenic
936725942 2:115315898-115315920 ATAATTTCCTCTGGCATTAACGG + Intronic
936734227 2:115420845-115420867 ATATTTTCCTCTGTGTTCTTAGG - Intronic
939338595 2:140863505-140863527 GTTTTTTCCTCTGGGATAAATGG - Intronic
940249700 2:151661462-151661484 ATCTTTTTCTCTGTTATCAAAGG + Intronic
941376541 2:164738135-164738157 ATATCTTCCTCTGTTATAAATGG + Intronic
942243138 2:173982641-173982663 AGATTATCCTCTGGAAACAAAGG + Intergenic
943271191 2:185807228-185807250 ATGTTTGCCTCTGGAATCTAAGG + Exonic
943273188 2:185834037-185834059 ATGTTTGCCTCTGGAATCCAAGG + Intergenic
944368531 2:198954069-198954091 ATATTTTCCTGAGGAATCACTGG + Intergenic
944988848 2:205210934-205210956 CTATTTTCCCCTGTGAGCAAGGG - Intronic
946009199 2:216551428-216551450 ATATTTTTCTTTGGGATCATGGG - Intronic
946284038 2:218689167-218689189 ATATTTCCCTGTGGCAACAATGG - Intronic
947053266 2:226071330-226071352 ATATTTTGTTCTGGGGTTAAGGG - Intergenic
948246054 2:236487043-236487065 ATTTTTTCTTCTGTGATCACAGG + Intronic
1169591937 20:7153204-7153226 TCATTTCCCTCTGGGATCAATGG + Intergenic
1170217497 20:13907201-13907223 ATATTTTTTTCTGATATCAAAGG + Intronic
1172256865 20:33526384-33526406 GTGTTTTCCTCTAGGAGCAAAGG + Intronic
1174899498 20:54483893-54483915 ATTTTGTTCTCTGGGATCCAGGG - Intronic
1174953554 20:55069611-55069633 ATACTTTTCTCTGAGATCAGTGG + Intergenic
1177732816 21:25050682-25050704 ATATTTATCTCTGGGATCCAAGG + Intergenic
1181451355 22:23024172-23024194 ATAATTTTCTCCTGGATCAAGGG - Intergenic
1182861487 22:33563209-33563231 ACATTTTCCTTTGGGAATAAAGG - Intronic
1183115352 22:35687784-35687806 ATATTTTAGTTTGGGGTCAAGGG + Intergenic
953210245 3:40869125-40869147 ATTTTTTCCTCTGGGACCCATGG - Intergenic
955855916 3:63273510-63273532 TTATTATTCTCTGGGGTCAATGG + Intronic
957307683 3:78479494-78479516 AGATTTTTTTCTGGGAGCAAAGG + Intergenic
957571704 3:81955163-81955185 ATATTTTATTCATGGATCAATGG - Intergenic
959182139 3:102994761-102994783 ATATTTACCTTTGAGATTAATGG + Intergenic
959267332 3:104158958-104158980 AGAATTTCCTGTGGGATCAGAGG - Intergenic
960008338 3:112805236-112805258 AAATGTTCCTCTTGGTTCAAAGG + Intronic
960938445 3:122917815-122917837 ATATTTTCCTCTGGGATCAATGG + Intronic
962040651 3:131704263-131704285 AAAGTTTCCTCTGGTATCCATGG + Intronic
962833547 3:139165694-139165716 ATATTTTCCTCTGTGTTCTGTGG + Intronic
963576919 3:147071939-147071961 ATCTCTGCCTCTGGGCTCAAGGG - Intergenic
964012373 3:151906137-151906159 ATATTTTAGTCTGGGGTCATTGG + Intergenic
968276532 3:197444718-197444740 ACCTTTGCCTCTGGGTTCAAGGG + Intergenic
970030770 4:11671777-11671799 ATAATTATTTCTGGGATCAATGG + Intergenic
973300459 4:48576823-48576845 TTATTTTCATGTGGGATTAAAGG - Intronic
974681154 4:65163689-65163711 TTATTTTTCTCTGAGACCAATGG + Intergenic
975320077 4:73000197-73000219 TCATTTTCCTCTGGGAACACAGG + Intergenic
977049644 4:92113174-92113196 GTATTTTGTTCTGGGTTCAATGG - Intergenic
978998843 4:115191808-115191830 ATATTTTCCTCTGGAGCAAAGGG + Intergenic
981295164 4:143123431-143123453 ATATTTTTCTCTGGGAACCAAGG + Intergenic
981691986 4:147519198-147519220 ACATTTTCCTCTGTGCTTAAGGG - Intronic
981697226 4:147571074-147571096 ACCTTTTCTTCTGGGATCACCGG - Intergenic
982038601 4:151372243-151372265 ATATTTTCATGTGGTATGAAAGG + Intergenic
982063224 4:151625266-151625288 GTTTTTTCCTCTGTTATCAAAGG + Intronic
982404560 4:155005593-155005615 ACATTTTCCTCAGGGATGCAGGG + Intergenic
982655965 4:158150262-158150284 ATATCTCCCTCTGAGATGAAGGG + Intronic
982676443 4:158381510-158381532 ATACTTTCCTCTGTGTTCAGTGG + Intronic
982961917 4:161850072-161850094 ATATTTTCCCCAGGCCTCAAAGG - Intronic
983103148 4:163651376-163651398 ATATTTTCCCCTGGTTCCAAAGG + Intronic
983134049 4:164057749-164057771 ATATTTTCCTCTTACATGAAAGG - Intronic
984007082 4:174324807-174324829 ATATATTCCTGTGGGAACCAGGG + Intronic
984109088 4:175587641-175587663 ATATTTTTCTCTGGATGCAATGG - Intergenic
984318737 4:178163207-178163229 ATATTTTATTCTGTGATCTAGGG - Intergenic
984733227 4:183087764-183087786 ATATTTTCTTCTGGAATTACTGG - Intergenic
985050969 4:185990678-185990700 ATATTTTTCTCTGGAAAGAAGGG + Intergenic
986738221 5:10683006-10683028 CTATTTTCCAGAGGGATCAATGG + Intronic
988045983 5:25953885-25953907 TCATTATCCTCAGGGATCAAGGG - Intergenic
988310117 5:29546067-29546089 AGATTTTCCTTTTGGATTAAGGG + Intergenic
989121442 5:38008492-38008514 ATATATTGCTTTGGGATTAAGGG + Intergenic
990823245 5:59867197-59867219 ATCTTCTTCTCTGGGATCAAGGG - Intronic
991151383 5:63375454-63375476 GTATTTTCCTGTGGAAGCAATGG + Intergenic
991368579 5:65894769-65894791 ATCTCTTCTTCTGGGATCTAAGG + Intergenic
991955981 5:71996570-71996592 GTATTTTTCTCTGGGCTCAAAGG - Intergenic
991998276 5:72410006-72410028 ATATTTTCCTCTAATTTCAAAGG + Intergenic
992742559 5:79788969-79788991 AGATCTTTCTCTGGAATCAAAGG + Exonic
993381567 5:87214676-87214698 TTGTTTTTCTGTGGGATCAATGG + Intergenic
994798092 5:104332243-104332265 ATAGTTTCCCCTAGGGTCAATGG - Intergenic
996117967 5:119639591-119639613 AGATTTTCCTCTTTGATAAAAGG + Intergenic
996658828 5:125974455-125974477 ATATTTGCATCAGGGATGAATGG + Intergenic
998310046 5:141120891-141120913 ATATTTTATTCTGTGACCAAAGG - Intronic
999970456 5:156856200-156856222 ATATTTTCTCCTGGGAGCAGTGG + Intergenic
1000487145 5:161861348-161861370 ATATTTTGCTGTTGGAGCAATGG - Intronic
1000807777 5:165818308-165818330 ATATTAACTTCTGGGATAAATGG - Intergenic
1001977681 5:176013746-176013768 ATATTATATTCTGGGATCCATGG + Intronic
1002239738 5:177830019-177830041 ATATTATATTCTGGGATCCATGG - Intergenic
1004416390 6:15428209-15428231 ATTTTTTCCTTTAGGCTCAATGG + Intronic
1005922820 6:30416596-30416618 ATATTTTCTTCTTGCACCAAAGG - Intergenic
1008309386 6:49947495-49947517 CTTTTTCCCTCTGGCATCAAAGG - Intergenic
1008939537 6:57031231-57031253 ATTTTTTCCTCATGGAACAAGGG + Intergenic
1009060934 6:58397107-58397129 TTATATTCCTGTGGGATCGATGG - Intergenic
1009979643 6:70712261-70712283 GGATTTTCCTCTGGGATATAAGG - Intronic
1010130284 6:72484366-72484388 ATATTTTCCTCTGAGGAAAAAGG - Intergenic
1010928573 6:81773067-81773089 GAATCTTCCTCTGGGATAAAGGG - Intergenic
1011144151 6:84193630-84193652 ATAGATTCCTTTGGGATCAGTGG - Exonic
1011839876 6:91484334-91484356 ATATTTTACTCTGTGATCTTGGG + Intergenic
1012541834 6:100370126-100370148 ATATTTTCTTCTGGAATTTATGG - Intergenic
1012620103 6:101333568-101333590 AAGTTTTCCTCTGGGAGGAAGGG - Intergenic
1013463432 6:110397769-110397791 GAGTTTTCCTCTGGGATCCAAGG - Intronic
1016549151 6:145257624-145257646 ATATGTTCCTCAGGGAAAAATGG - Intergenic
1017786102 6:157758497-157758519 TCATTTTGCTCTGGGATCATCGG - Intronic
1020549084 7:9575423-9575445 ATGCTTTTCTCTGGGATCAGTGG - Intergenic
1020940953 7:14536475-14536497 ATATTTATCTCTGGGATGCAAGG + Intronic
1020951783 7:14688356-14688378 CTATTTTCCTCTCGAATGAAAGG + Intronic
1021051649 7:15992670-15992692 ATATATTTCTGTGGGATCAGTGG + Intergenic
1021146430 7:17094875-17094897 AAATTTTACTCTTGGTTCAATGG - Intergenic
1021469858 7:20989563-20989585 ATATTTTCCTCTGGGAATTTTGG + Intergenic
1022121778 7:27315435-27315457 TTATTTTTGTCTGGGATCTATGG + Intergenic
1022189826 7:28006636-28006658 ATATTTTCCTCTGGGAAGTGGGG - Intronic
1022731810 7:33033623-33033645 ATTTCTTCTTCTGGGGTCAAAGG + Intronic
1024318524 7:48043351-48043373 GTAGTTGCCTCTGGGATCCAGGG - Intronic
1026978742 7:74514500-74514522 CTATTCTCCTCTGGGATCTGCGG - Intronic
1029091230 7:98049901-98049923 ATATTTTCCCATGTGATAAAAGG + Intergenic
1031789791 7:126087646-126087668 ATATTTTCCTTTCGGTTCTATGG - Intergenic
1033830357 7:145244087-145244109 TTTTTTTCCTCTGGCAACAATGG - Intergenic
1035187018 7:157134426-157134448 AGATTTTCCTGTGGCATCACTGG + Intergenic
1037501430 8:19489424-19489446 ATCCTTTCCTCTGGTCTCAAAGG + Intronic
1039929373 8:41970485-41970507 AAATTTTCTTCTGGGAGAAATGG - Intronic
1040736840 8:50518626-50518648 ATATATTTCTGTGGGATCAGTGG - Intronic
1041611668 8:59857356-59857378 TTTTTTTCCTGTGGGATCAGTGG - Intergenic
1041683972 8:60625439-60625461 TTACTTTCCTCTGGTATCACAGG - Intergenic
1041950392 8:63494857-63494879 ATATTTTCCTATAGGCTCTAGGG + Intergenic
1042315780 8:67424437-67424459 ATTTCTTCCTCTGAGCTCAACGG - Intronic
1046332429 8:112736821-112736843 ATATTTTTCTTAGGGAACAATGG + Intronic
1046685255 8:117218675-117218697 TTATTTTCCTTTAGCATCAAAGG - Intergenic
1048734148 8:137479630-137479652 ATATTTTCTTGAGGGAGCAAGGG + Intergenic
1048802735 8:138209060-138209082 ATATATTCCTCAGCAATCAATGG + Intronic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1051018089 9:12506108-12506130 ATTTATTCCTTTGGGATCAGTGG - Intergenic
1051125202 9:13795851-13795873 GTATTTTTCTGTGGGATCAGTGG - Intergenic
1052124800 9:24761882-24761904 TTGTATTCCTGTGGGATCAATGG + Intergenic
1052181626 9:25535696-25535718 ATCTTTTCCTCTTGGATAAAAGG + Intergenic
1055163485 9:73161130-73161152 AAATGTTCCTCTAGGATAAATGG + Intronic
1056400865 9:86225819-86225841 AAATTTACCTCTGGGATCTCAGG + Intronic
1056409266 9:86309958-86309980 ATACTTCACTCTGGGATCAATGG + Exonic
1056474332 9:86938984-86939006 CTTTCTTCCTCTAGGATCAAAGG + Intergenic
1058643208 9:107107032-107107054 ATATTTTCTACTGGGCTCAGTGG + Intergenic
1058901394 9:109445618-109445640 AAATTGTACTCTGAGATCAATGG + Intronic
1060239795 9:121893005-121893027 ATGATTTCCTCTGGGACCATAGG - Intronic
1186755342 X:12665022-12665044 TTATATTACTCTGGGATCAGTGG + Intronic
1186997538 X:15139687-15139709 CTATTTTCCTCTGTGATCCTGGG - Intergenic
1187568942 X:20481335-20481357 GGACTTTACTCTGGGATCAATGG + Intergenic
1187674986 X:21707498-21707520 AAATTTACCTCAGGGATCACTGG - Intronic
1189192309 X:39121193-39121215 ATATTTCTCTGTGGGATTAAAGG - Intergenic
1191972748 X:66835209-66835231 AGTGTTTCTTCTGGGATCAATGG - Intergenic
1193051685 X:77107703-77107725 ATAATTTCCTCTAAGATCAGGGG + Intergenic
1194194536 X:90876053-90876075 ATAATTTCCTCTTTGATCCATGG + Intergenic
1194386938 X:93266981-93267003 TTTTTTTTCTCTTGGATCAAAGG + Intergenic
1194984888 X:100479619-100479641 ATATTTTCCTGTGTCATCAAAGG - Intergenic
1199030186 X:142988504-142988526 TTATTATCCTCTGGGTTTAAGGG - Intergenic
1200385089 X:155882123-155882145 ACTGTATCCTCTGGGATCAAGGG - Intronic
1200541153 Y:4458454-4458476 ATAATTTCCTCTTTGATCCATGG + Intergenic
1200713433 Y:6510470-6510492 TGATTTTCATCTTGGATCAAAGG - Intergenic
1201020495 Y:9651571-9651593 TGATTTTCATCTTGGATCAAAGG + Intergenic