ID: 960939135

View in Genome Browser
Species Human (GRCh38)
Location 3:122922208-122922230
Sequence CCTGCAGTCCAGGTTGGACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 177}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960939118_960939135 20 Left 960939118 3:122922165-122922187 CCGGAAGCTTGCAGCCCCGCGCC 0: 1
1: 0
2: 0
3: 5
4: 132
Right 960939135 3:122922208-122922230 CCTGCAGTCCAGGTTGGACCGGG 0: 1
1: 0
2: 2
3: 17
4: 177
960939120_960939135 5 Left 960939120 3:122922180-122922202 CCCGCGCCGTCCCTCAACCCACC 0: 1
1: 0
2: 1
3: 17
4: 203
Right 960939135 3:122922208-122922230 CCTGCAGTCCAGGTTGGACCGGG 0: 1
1: 0
2: 2
3: 17
4: 177
960939124_960939135 -6 Left 960939124 3:122922191-122922213 CCTCAACCCACCCCCGACCTGCA 0: 1
1: 1
2: 6
3: 63
4: 543
Right 960939135 3:122922208-122922230 CCTGCAGTCCAGGTTGGACCGGG 0: 1
1: 0
2: 2
3: 17
4: 177
960939116_960939135 22 Left 960939116 3:122922163-122922185 CCCCGGAAGCTTGCAGCCCCGCG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 960939135 3:122922208-122922230 CCTGCAGTCCAGGTTGGACCGGG 0: 1
1: 0
2: 2
3: 17
4: 177
960939123_960939135 -5 Left 960939123 3:122922190-122922212 CCCTCAACCCACCCCCGACCTGC 0: 1
1: 0
2: 3
3: 38
4: 434
Right 960939135 3:122922208-122922230 CCTGCAGTCCAGGTTGGACCGGG 0: 1
1: 0
2: 2
3: 17
4: 177
960939121_960939135 4 Left 960939121 3:122922181-122922203 CCGCGCCGTCCCTCAACCCACCC 0: 1
1: 0
2: 6
3: 36
4: 474
Right 960939135 3:122922208-122922230 CCTGCAGTCCAGGTTGGACCGGG 0: 1
1: 0
2: 2
3: 17
4: 177
960939117_960939135 21 Left 960939117 3:122922164-122922186 CCCGGAAGCTTGCAGCCCCGCGC 0: 1
1: 0
2: 0
3: 11
4: 101
Right 960939135 3:122922208-122922230 CCTGCAGTCCAGGTTGGACCGGG 0: 1
1: 0
2: 2
3: 17
4: 177
960939122_960939135 -1 Left 960939122 3:122922186-122922208 CCGTCCCTCAACCCACCCCCGAC 0: 1
1: 0
2: 6
3: 83
4: 985
Right 960939135 3:122922208-122922230 CCTGCAGTCCAGGTTGGACCGGG 0: 1
1: 0
2: 2
3: 17
4: 177
960939119_960939135 6 Left 960939119 3:122922179-122922201 CCCCGCGCCGTCCCTCAACCCAC 0: 1
1: 0
2: 0
3: 8
4: 202
Right 960939135 3:122922208-122922230 CCTGCAGTCCAGGTTGGACCGGG 0: 1
1: 0
2: 2
3: 17
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960939135 Original CRISPR CCTGCAGTCCAGGTTGGACC GGG Intronic
900153959 1:1196640-1196662 CTTGCAGTCCAGCTTGGGCTTGG - Exonic
900180058 1:1307441-1307463 CCTGCAGTCCAGCTCTGGCCAGG - Intronic
900619212 1:3579340-3579362 CCTGAAGACCAGGTTGAAGCAGG - Intronic
901023680 1:6267942-6267964 CCTGCAGCCCATGTTCAACCAGG + Intronic
904405641 1:30286400-30286422 CCTGCAATTCAGGCTGGGCCTGG - Intergenic
905235038 1:36540372-36540394 CCCACAGTGCAGGTTCGACCGGG - Intergenic
907305028 1:53508566-53508588 CCCGCAGCCCAGGTGGAACCAGG - Intronic
907671854 1:56481419-56481441 CTTGCATTCCAGTTTGGAGCTGG - Intergenic
908351173 1:63287045-63287067 CCTGCAAACCAGGCTGGTCCAGG + Intergenic
908973105 1:69862249-69862271 CCTCAAGTCCAGGTTGAACGTGG + Intronic
910006815 1:82407183-82407205 ACTGCACTCCAGTTTGGGCCTGG + Intergenic
920678741 1:208056964-208056986 CCTGCAGGCCAGGGTGGAAAGGG + Intronic
920776497 1:208943261-208943283 ACTGAAGCCCAGCTTGGACCAGG + Intergenic
921080997 1:211738321-211738343 CCTACAGCCCAGGGTGGAGCGGG - Intergenic
923537347 1:234863357-234863379 CCTGCAGCCCAGGCTGGGGCTGG - Intergenic
924464337 1:244286414-244286436 CCTGAAGACCAGGCTGTACCAGG + Intergenic
1068462104 10:57342041-57342063 CCTACACTTCAGGCTGGACCTGG + Intergenic
1073057313 10:100710791-100710813 CCTGGAGTCCAGGTGGGAGGTGG - Intergenic
1074078320 10:110149359-110149381 TCTGCAGTCCAGCATGGAACTGG - Intergenic
1074891575 10:117740503-117740525 CCTGCAGGCCTGCTTGGACTGGG + Intergenic
1075637824 10:124042346-124042368 CCTGCAGTCCTTGATGGATCTGG + Exonic
1076536255 10:131179523-131179545 GCTGCTGTCCAGGTTGGAAAAGG - Intronic
1077500893 11:2909371-2909393 ACTGGAGTCCAGGTGGGGCCGGG + Intronic
1077515032 11:2996245-2996267 ACTGCAGTCCAGGTGGAGCCAGG + Intergenic
1080487140 11:32721060-32721082 ACTGCACTCCAGGCTGGATCTGG - Intronic
1081794383 11:45809567-45809589 CCTGAAGTCCAGATCGGTCCAGG - Intronic
1083611350 11:64005886-64005908 CCTCCAGCCCAGGAAGGACCAGG + Intronic
1083794582 11:65007829-65007851 CCTGCACTCCAGCATGGGCCTGG + Intergenic
1084415912 11:69032894-69032916 CCAGCAGTCCACGGTGGGCCAGG - Intergenic
1084445699 11:69202359-69202381 CCTGCAGTACAAGGAGGACCAGG - Intergenic
1086945829 11:92843199-92843221 CCTGCAGACCAGGTGGGATCTGG - Intronic
1088545296 11:110952959-110952981 CCTGCAGGCCTGGTTGGCCCAGG - Intergenic
1091278437 11:134368358-134368380 CCTGCAGCCCAGGTCGGCCAGGG - Intronic
1091784000 12:3231415-3231437 ACAGCACTCCAGGCTGGACCTGG + Intronic
1094653271 12:32398386-32398408 ACTGCACTCCAGCTTGGATCAGG + Intergenic
1096795911 12:54077432-54077454 CCTGGAGGCCAGGTTGGCCACGG + Intergenic
1097033666 12:56107592-56107614 CCTGATTTCCAGGTTTGACCAGG - Exonic
1103742606 12:123101273-123101295 CCTGCATCACAGGTTGGCCCAGG - Intronic
1105883732 13:24624939-24624961 AGTGGGGTCCAGGTTGGACCAGG + Intergenic
1107830816 13:44373104-44373126 CCTGCAGCCCAGGTCGGATTTGG - Intergenic
1108503308 13:51087273-51087295 CCAGCAGTCCAGGCTGGGTCTGG + Intergenic
1110570035 13:76992792-76992814 CCTGCAGTCCTGGTTAGACCGGG + Intronic
1113403719 13:110019080-110019102 CCTGCAGTAGATGTTGGAACAGG + Intergenic
1119084529 14:71727733-71727755 CCTGCCTTGCAGGTTGTACCTGG - Intronic
1119386633 14:74261430-74261452 CCTGCAGACCTGGCTGGGCCTGG + Exonic
1121267822 14:92615754-92615776 CCTGGAGTCCTGCGTGGACCAGG + Intronic
1122119553 14:99544821-99544843 CCTGCAGGCCATGTGTGACCTGG - Intronic
1123023111 14:105411474-105411496 CCTGCAGTGCAGCTGGGTCCCGG - Exonic
1125576760 15:40761294-40761316 CCTGTAGTCCCGCTTGAACCTGG - Intergenic
1125884030 15:43215061-43215083 CATGCAGCCCAGGCTGGCCCAGG + Intronic
1127291092 15:57571815-57571837 CCACCAGTCCAGGCTGGAGCAGG + Intergenic
1127303272 15:57678322-57678344 CCTGCACTCCAGCCTGGGCCTGG + Intronic
1132541233 16:510835-510857 CCTGCAGGCCAGGTAGGAGACGG + Intronic
1138512224 16:57515330-57515352 CCTGCAGTCCAGGTGGGCCCCGG - Exonic
1139268158 16:65658720-65658742 CCTGCAGTACAGGTAGGAACTGG - Intergenic
1139923445 16:70473331-70473353 CCTGCTGGCCACGCTGGACCAGG + Exonic
1140977839 16:80077372-80077394 CCTCCAATCCAGATTGGAGCAGG + Intergenic
1142276711 16:89122554-89122576 CCTGCAGACAGGGTTGGAACTGG - Intronic
1142407068 16:89896170-89896192 GCTGCCCTCCAGGGTGGACCAGG + Intronic
1142690860 17:1605528-1605550 CCTGCAGGCCAGGGAGGACTCGG - Intronic
1143593174 17:7898191-7898213 CCTGAACTCCAGGTTGAATCAGG - Intronic
1146727822 17:35170228-35170250 CCTGCAGGCCATGTTTGAGCTGG + Exonic
1146891852 17:36511437-36511459 GCAGCAGTCCAGCTAGGACCTGG + Exonic
1146901474 17:36592099-36592121 CCTTCAGTCCCTGCTGGACCAGG - Exonic
1147215853 17:38898634-38898656 CCTGCCCTCCAGGGTGGGCCTGG + Intronic
1147882586 17:43663572-43663594 CCTGCTGTTCAGTTTGGAGCAGG + Intergenic
1148085930 17:44993850-44993872 CCTGCAGTGCTGGTGGGAGCTGG - Intergenic
1148152123 17:45403091-45403113 CCTGCCCTCCAGGCTGGAGCTGG + Intronic
1148511391 17:48173140-48173162 ACTGCAGTCCAGCCTGGGCCTGG + Intronic
1149594897 17:57859147-57859169 CCTGCACTCCTTGTTAGACCTGG + Intergenic
1151891994 17:76956491-76956513 CCTACAGTCCTGCTGGGACCTGG - Intergenic
1152206649 17:78977845-78977867 GCTGCAGCCCAGGGTGGGCCAGG + Intronic
1152685125 17:81690133-81690155 CTTGCAGGCCAGGTGGGAGCAGG + Intronic
1152722700 17:81930728-81930750 CCAGCAGGCCAGGTGGGCCCTGG - Intergenic
1153721596 18:7909054-7909076 GCTGCAGTCAAGGTTGCACATGG + Intronic
1155419706 18:25641869-25641891 CCTGTATTTCAGGTAGGACCTGG + Intergenic
1155513911 18:26604928-26604950 CCTGCAGTCCAGGGCTGACTTGG + Intronic
1155538446 18:26841843-26841865 CCAACAGTCCAGGTTGGAGCAGG + Intergenic
1157255743 18:46137457-46137479 CAGGCAGTCCAGGTTGGAGGTGG + Intergenic
1158514443 18:58119529-58119551 CCTGCTGTCCCGGATGGCCCTGG + Intronic
1158532236 18:58273958-58273980 CCTGGAGTCCAGGCTGGCCTTGG + Intronic
1158642529 18:59215826-59215848 CCTTCACTCCAGCCTGGACCTGG + Intergenic
1160333737 18:78018382-78018404 CTTCCAGTCCAGGTGGGGCCAGG + Intergenic
1161735874 19:5991793-5991815 CCTGCAGTCCACACTGGGCCTGG + Intergenic
1161795523 19:6384215-6384237 ACTGCAGGCCAGGTTGGGCGCGG + Intronic
1162198021 19:9000533-9000555 CCTCCAGCCCAGGATGGCCCCGG + Intergenic
1162553457 19:11371672-11371694 CCTGCAGGTAGGGTTGGACCTGG - Intergenic
1163425870 19:17240747-17240769 CTGGCAGTCACGGTTGGACCTGG + Exonic
1163768189 19:19175146-19175168 TCTGCAGTCCTGGCTGGCCCTGG - Intronic
1164145429 19:22509902-22509924 CCTGCAGACCCGGTGGGACTGGG + Intronic
1165383800 19:35498736-35498758 GCAGCAGGCCAGGTTGCACCCGG + Exonic
1166747351 19:45147649-45147671 CCTGCAGTGCTGGCTGGGCCCGG - Intronic
1167602362 19:50461752-50461774 GCAGGAGTCCAGGTGGGACCTGG - Intronic
1168106502 19:54168665-54168687 CCTGCAGGCCAGTTTGGCGCCGG - Exonic
925511522 2:4631237-4631259 CCTGCAGTAGAGGCTGGAACTGG + Intergenic
928464730 2:31513304-31513326 ACTACAGGCCAGGTTGGCCCAGG + Intergenic
929338716 2:40785660-40785682 CCTGCACTCCAGCCTGGACAAGG - Intergenic
929712809 2:44281810-44281832 CATGGAATCCAAGTTGGACCGGG - Intronic
936295548 2:111264808-111264830 CTTGCAGTCCAGGGGGCACCCGG + Intergenic
937034894 2:118772849-118772871 CCTTCAGTGCAGGCTGCACCTGG + Intergenic
938940583 2:136166310-136166332 ACTGCAGTCTAGGTTGGGCATGG - Intergenic
939688874 2:145232962-145232984 CATCCAGTCCAGATTAGACCAGG - Intergenic
946046669 2:216827106-216827128 CCTGCACTCCAGGCTGGAGGGGG - Intergenic
947914565 2:233823007-233823029 CCTGCTGGCCAGGTGGGCCCTGG + Exonic
1169748694 20:8969222-8969244 ACTGCAGTCCAAGTAGGAACTGG + Intergenic
1170315646 20:15038705-15038727 CCTGGCCTCCAGGTTGGGCCAGG - Intronic
1171422465 20:25026365-25026387 CCTACAGTCCAGGCTGGCACAGG - Intronic
1172527193 20:35607045-35607067 CCTGAACCCCAGGTTGGACTTGG + Intergenic
1172590827 20:36116673-36116695 CCTGCTGTCCAGGGAGGACATGG - Intronic
1173439869 20:43066661-43066683 CCCACAGTTCAGGTTGGAACAGG - Intronic
1173644569 20:44625582-44625604 CATGCAGCACAGGATGGACCGGG + Exonic
1173896085 20:46551860-46551882 TCTGCATTCCAGGTAGGAACTGG - Intergenic
1176326671 21:5507678-5507700 ACTTCAAGCCAGGTTGGACCTGG + Intergenic
1176401086 21:6313273-6313295 ACTTCAAGCCAGGTTGGACCTGG - Intergenic
1176436071 21:6675831-6675853 ACTTCAAGCCAGGTTGGACCTGG + Intergenic
1176460333 21:7002901-7002923 ACTTCAAGCCAGGTTGGACCTGG + Intergenic
1176483894 21:7384679-7384701 ACTTCAAGCCAGGTTGGACCTGG + Intergenic
1177826495 21:26090054-26090076 TCTGCAGTTCAGGGTAGACCTGG + Exonic
1178264376 21:31129093-31129115 CCTGCTGTCCAAGTGGGACAGGG + Intronic
1178697872 21:34809620-34809642 CCTGCAGTCCAGGCTGGGCATGG + Intronic
1179945061 21:44667709-44667731 CCTGCAGTACAGGGTGCACATGG - Intronic
1180174166 21:46079414-46079436 CCCCCAGTCCATGTTGGACCAGG - Intergenic
1181860475 22:25813943-25813965 CCTGCAGCCCAGAATAGACCTGG - Intronic
1182099516 22:27648109-27648131 TCTGCAGTCTTGGTTGGTCCTGG - Intergenic
1182459518 22:30473863-30473885 CCTGCAGTCCAGGCTACTCCGGG - Intergenic
1182720646 22:32395988-32396010 AGTGCAGTCCAGGCTGGACACGG - Intronic
1183032991 22:35119436-35119458 CCTCCAGTCCAGGAAGCACCTGG + Intergenic
1183522530 22:38303673-38303695 CCTGTAGGCCAGGGTGGTCCTGG - Intronic
1183559005 22:38555044-38555066 ACTGCACTCCAGCCTGGACCTGG + Intronic
1184692763 22:46124683-46124705 TCTGCAGTCAAGGCTGCACCGGG - Intergenic
1184981123 22:48096714-48096736 CCTGGAGTCGCGGATGGACCTGG - Intergenic
949917326 3:8975192-8975214 CCTGGAGTCCAGTATGGAGCCGG + Intergenic
949922754 3:9015809-9015831 CCTGTGGTTCAGGCTGGACCAGG - Intronic
952629822 3:35453128-35453150 CCTGCTGTCCAGGTGCGTCCAGG - Intergenic
953674740 3:44992159-44992181 CCTGGAGTCCAGGTGGGAGTGGG - Intronic
954773980 3:52999408-52999430 CCTGCATTCCAGGGTGGGGCAGG + Intronic
956283724 3:67586347-67586369 CATGCAGTCTAGGTTGTTCCAGG - Intronic
960939135 3:122922208-122922230 CCTGCAGTCCAGGTTGGACCGGG + Intronic
961306132 3:125959863-125959885 ACTGCAGTCCCTGTTGGATCTGG + Intergenic
962840461 3:139227927-139227949 CCTGCAGCCCAGGTTGGGCTTGG + Intronic
965774635 3:172215684-172215706 ACTGCAGTCCAGCCTGGACTCGG + Intronic
967106758 3:186260667-186260689 CCTGGCGTCCAGGTTCCACCTGG + Intronic
969226398 4:5801316-5801338 CCTGCATTCCAGGTAGGAGGAGG + Intronic
984646499 4:182225821-182225843 CCTGGAGTGAAGGTTAGACCGGG + Intronic
985754791 5:1707135-1707157 CCTTCAGTCCAGGTGGGAGCTGG - Intergenic
986045324 5:4031276-4031298 CCTGCAATCAAGGTATGACCAGG - Intergenic
986132342 5:4943003-4943025 CCTGCAGTCCAGGACGGCCACGG + Intergenic
988124932 5:27018836-27018858 CCAGCAGTCCAGTCTGGACTGGG + Intronic
988682402 5:33496703-33496725 CCTGCTAACCAGGTTGAACCTGG + Intergenic
996172312 5:120309165-120309187 GCTGCAATCAAGGTTGGGCCGGG - Intergenic
996846240 5:127902232-127902254 CCTGCACTCCAGCTTGGCCTGGG + Intergenic
998060862 5:139117841-139117863 CCTGCAGTCCAGGTAGGAATTGG - Intronic
999134922 5:149312177-149312199 CCTCCTGTGCAAGTTGGACCTGG + Exonic
1001280256 5:170381623-170381645 CCTGCCGCCCAGGCTTGACCAGG - Intronic
1010758809 6:79698654-79698676 CCTGCAGGCCACATTGGCCCTGG + Intronic
1010964075 6:82182932-82182954 GCTGCAGTCAAGGTTTGGCCAGG - Intronic
1011014088 6:82735887-82735909 CCCGCAGTCCAGGTTAGTCCAGG + Intergenic
1011633862 6:89352694-89352716 CCCGCAGTCCAGGCTGGACTGGG - Exonic
1013160424 6:107538573-107538595 CCTGCAGGCCAGGGTGCAGCTGG - Intronic
1016142610 6:140631014-140631036 TCTGCCGTCCAGGCTGGAGCTGG + Intergenic
1017304735 6:152903902-152903924 CAGGCAGTCCATATTGGACCAGG - Intergenic
1019388574 7:772677-772699 CCTGCAGGCCTGGCTGTACCCGG + Intronic
1019518737 7:1451150-1451172 CCTGCTGTCCAGGCTGGCCGGGG - Intronic
1023969192 7:44978856-44978878 CCTGCAGCTCAGGTAGGCCCAGG - Exonic
1024451571 7:49551519-49551541 CCTGAAGTCCAGTCTGAACCTGG + Intergenic
1028885058 7:95922734-95922756 CCTGGAGTCCTGGTTTGACCGGG - Intronic
1029163719 7:98571228-98571250 CCTGCTGTTGGGGTTGGACCAGG - Intergenic
1029551555 7:101239505-101239527 CCTGCCCTCCAGGTTGGCACGGG - Intronic
1031977390 7:128102724-128102746 CCTGCACTCTATGTTGGCCCTGG - Intergenic
1032217471 7:129968860-129968882 CCTGGAGTCCAGTTTGGTGCTGG - Intergenic
1032801116 7:135317893-135317915 CCTGCAGGACAGGCTGGAGCGGG - Intergenic
1033253972 7:139783554-139783576 CCTGCAGTCCAGGCTGAACTTGG + Intronic
1033690921 7:143736311-143736333 CCTCCAGTCTAGGTTGGACACGG - Intergenic
1034964866 7:155384644-155384666 GCTGCAGCCCTGGCTGGACCTGG - Intronic
1035783080 8:2244253-2244275 CCTGCAGTCCGGGTAGGAGAGGG + Intergenic
1035809045 8:2475333-2475355 CCTGCAGTCCGGGTAGGAGAGGG - Intergenic
1035899040 8:3437549-3437571 CCTGCAGTCCAGTTTTTCCCTGG - Intronic
1036173754 8:6515996-6516018 CCTGCAGACCAGGCTGTTCCAGG - Intronic
1036642469 8:10592940-10592962 CCTGCTGTCCAGGGTGGAGAGGG - Intergenic
1041220686 8:55648353-55648375 CCTGCAGTCCAGGTGCTTCCTGG + Intergenic
1044216187 8:89613460-89613482 CCTGTAGTCCAGGTTGAGGCAGG - Intergenic
1049370467 8:142261873-142261895 CCTGCTGCCCAGGTTGGACTTGG - Intronic
1049548855 8:143247067-143247089 CCAGCAGTCCTGGTAGGGCCCGG + Intergenic
1049719831 8:144110682-144110704 GGTGCAGTCCAGGCTGGAGCAGG - Exonic
1050299422 9:4242162-4242184 CATGGGGTCCAGGTTGGATCAGG - Intronic
1052791330 9:32877843-32877865 CCTGCAGGCCAGTTTGCACGTGG - Intergenic
1057132061 9:92661222-92661244 CCAGCAGGCGAGGCTGGACCTGG - Intronic
1061051579 9:128199328-128199350 ACTGCACTCCAGCTTGGAGCTGG + Intronic
1061895001 9:133642547-133642569 TCCACAGTCCTGGTTGGACCAGG + Intronic
1062376147 9:136262747-136262769 CCTGCAGCCCAGCCTGGAGCAGG + Intergenic
1203779836 EBV:95248-95270 CCCGCAGTGCTGCTTGGACCTGG - Intergenic
1189921607 X:45908349-45908371 ACTGCACTCCAGGCTGGACGTGG - Intergenic
1190256533 X:48767103-48767125 CCATCAGTCCAGTTTGGAACAGG + Intronic
1192234877 X:69289382-69289404 CCTGCAGCCCAGCTTGGGCTGGG + Intergenic
1199527990 X:148813174-148813196 CCTGCAGTCCAGGGTGGGGCTGG + Intronic
1199676599 X:150194837-150194859 CCTCCAGTCCAGGTTGGGCTGGG - Intergenic
1200044215 X:153392467-153392489 TCTGCAGTCCATGGTGGACATGG + Intergenic