ID: 960940565

View in Genome Browser
Species Human (GRCh38)
Location 3:122930308-122930330
Sequence GAGTGACAAGTTTGGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960940562_960940565 -6 Left 960940562 3:122930291-122930313 CCCTGGATTCAGGAGATGAGTGA 0: 1
1: 0
2: 2
3: 14
4: 168
Right 960940565 3:122930308-122930330 GAGTGACAAGTTTGGAGCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 139
960940563_960940565 -7 Left 960940563 3:122930292-122930314 CCTGGATTCAGGAGATGAGTGAC 0: 1
1: 0
2: 2
3: 10
4: 136
Right 960940565 3:122930308-122930330 GAGTGACAAGTTTGGAGCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 139
960940561_960940565 2 Left 960940561 3:122930283-122930305 CCTGCACACCCTGGATTCAGGAG 0: 1
1: 0
2: 1
3: 21
4: 339
Right 960940565 3:122930308-122930330 GAGTGACAAGTTTGGAGCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960940565 Original CRISPR GAGTGACAAGTTTGGAGCCC AGG Intronic
900789848 1:4672685-4672707 GAGTGAGAAGGTGGGATCCCAGG + Intronic
902458591 1:16554165-16554187 GAGGGGCAAGTCTGGGGCCCTGG + Intergenic
902493566 1:16853751-16853773 GAGGGGCAAGTCTGGGGCCCTGG - Intronic
903151777 1:21414925-21414947 GAGGGGCAAGTCTGGGGCCCTGG + Intergenic
907299259 1:53476343-53476365 GAGACATAAGTCTGGAGCCCAGG - Intergenic
907425273 1:54375570-54375592 GAGTGTCAAGTTGTGGGCCCAGG + Intronic
907889143 1:58621171-58621193 AAGTGACAAGATTCAAGCCCAGG + Intergenic
909524769 1:76610529-76610551 GGGTGACAAGTATGAAGGCCTGG + Intronic
909982289 1:82116992-82117014 GAGTGAAAAGGGTGGAGCCTTGG + Intergenic
912465106 1:109867033-109867055 GGGAGACCAGTTGGGAGCCCAGG + Intergenic
913233007 1:116757289-116757311 GTTTGAGAAGTTTGGAGGCCGGG - Intronic
915033072 1:152900921-152900943 GAGAGACAAGGTTGGAGGTCTGG - Intergenic
917927454 1:179801037-179801059 GAGGGAGGAGTTTGGAGCCAGGG - Intronic
922189075 1:223301300-223301322 AAGTGACAAGTCAGGATCCCTGG - Intronic
1068318986 10:55385209-55385231 GAGTGACAATTTTGGCATCCCGG - Intronic
1068319262 10:55389625-55389647 GAGTGACAATTTTGGCATCCCGG + Intronic
1070386985 10:75934632-75934654 GAGAGACAAGTTTGGTGCAGGGG + Intronic
1073076904 10:100829946-100829968 GAGAGACAAACTTGGAGCCATGG - Intergenic
1073954187 10:108848981-108849003 CAGTGACAAGTTTCAAGCACAGG + Intergenic
1076472018 10:130725535-130725557 GTGGAACCAGTTTGGAGCCCGGG + Intergenic
1077672081 11:4166404-4166426 GAGTGTGAAGTCTGGATCCCTGG + Intergenic
1078017875 11:7630677-7630699 GAGTGAGAGGTTTGGAGGCAGGG + Intronic
1081551023 11:44112759-44112781 GAATAACAAGTTTGGGGCCCCGG + Intronic
1083294120 11:61706145-61706167 TGGTGACAAGTTTGGAAACCAGG + Intronic
1083363563 11:62128109-62128131 GAGGCACAAGTTAGGGGCCCAGG - Intronic
1083897820 11:65628990-65629012 AAGGGAGAGGTTTGGAGCCCAGG + Intronic
1084113876 11:67030716-67030738 GGGTGACAAGGTGGGAGCCATGG - Intronic
1084125950 11:67099119-67099141 TGGTGGCAAGTTTAGAGCCCAGG - Intergenic
1086920462 11:92580898-92580920 GAGTTACAATTTAGCAGCCCAGG + Intronic
1088928652 11:114327236-114327258 GAGTGACAAGGCTGGGACCCAGG + Intergenic
1092109391 12:5948309-5948331 GAGGGCCATGTGTGGAGCCCAGG + Intergenic
1096602683 12:52741722-52741744 GAGTGACAAGCATGGACTCCGGG + Intergenic
1101496169 12:105256379-105256401 TAGTGAGAAGTCTTGAGCCCTGG - Intronic
1102496392 12:113322297-113322319 GAGGGTCAAGGTTGGAACCCAGG + Intronic
1104824077 12:131695904-131695926 GAGTGTCAAGATTGGAAACCAGG - Intergenic
1105026133 12:132850381-132850403 GAGTGAAGAGTTTGGATTCCTGG + Intronic
1111115335 13:83769114-83769136 GAGTGACAAAATTGAAGACCTGG + Intergenic
1112797743 13:103075344-103075366 GAGTGAGAAGTTTCCATCCCTGG - Intergenic
1113811719 13:113146780-113146802 GACTTGCAAGTTTGGAGCCCGGG - Intronic
1115701943 14:35962270-35962292 GAGAGACAAGTTTTGAACCCAGG + Intergenic
1121558596 14:94857455-94857477 GAGAGTCAAGTTTGGAGGTCAGG - Intergenic
1130809401 15:87360614-87360636 GAGGAGCAAGATTGGAGCCCTGG - Intergenic
1130935267 15:88464787-88464809 CAGAGAGAAGTTTGGAGACCAGG - Exonic
1135627824 16:24011451-24011473 CAGAGCCAAGATTGGAGCCCAGG - Intronic
1135909201 16:26543884-26543906 GAGTGACAAGTTTGGGGAAGTGG - Intergenic
1136475964 16:30513553-30513575 GAGAGACAGGACTGGAGCCCAGG - Intronic
1140476165 16:75240148-75240170 GAGTGACAAGGATGGTGGCCAGG - Intronic
1141212703 16:81996014-81996036 GCCTGAGAAGCTTGGAGCCCAGG + Exonic
1141656428 16:85419138-85419160 GAGTGACGTGATGGGAGCCCAGG + Intergenic
1142934548 17:3317513-3317535 GAGTGAGAAGTTGGGAGGCCGGG + Intergenic
1147042898 17:37731763-37731785 CAGTGACCAAGTTGGAGCCCAGG + Exonic
1148773368 17:50079497-50079519 GAGTGACAGGTGGGGGGCCCTGG - Exonic
1152667158 17:81577807-81577829 GACTGAGAGGTTTGGAGGCCTGG - Intronic
1153036599 18:769064-769086 TAGTGACATGTTTGTAGCCTAGG + Intronic
1155035367 18:22021055-22021077 GAGATACAAATTTGGAGACCTGG + Intergenic
1155070124 18:22307746-22307768 AAATGGCAAGTGTGGAGCCCTGG + Intergenic
1156874375 18:41989643-41989665 AAGTAACAAGTTTGTAGCCTAGG + Intronic
1157499440 18:48179550-48179572 GAGTGACCAGCTTGGAAGCCAGG + Intronic
1158932729 18:62336764-62336786 GAGTGAAGAGTCTGCAGCCCTGG - Intronic
1159061279 18:63517310-63517332 TAGTGACAGCTTTGGAGACCAGG + Intergenic
1160409451 18:78665714-78665736 GAGAGACAAGTCCGGTGCCCTGG - Intergenic
1161134321 19:2610912-2610934 AAGTGTCAAGTTTAGTGCCCAGG - Intronic
1161616089 19:5271052-5271074 CTGTGACCAGCTTGGAGCCCTGG - Intronic
1164334270 19:24295861-24295883 GATTGATAAGTTTGGAGACACGG + Intergenic
1165194338 19:34089913-34089935 GATAGACAAGTCTGGAGCTCAGG + Intergenic
1166387923 19:42392348-42392370 GAGTGTCATGCTGGGAGCCCTGG - Intergenic
932133670 2:69210011-69210033 CAGTGACAAGGTTGGAGTCCCGG + Intronic
935364221 2:102272183-102272205 AAGGGACAAGAATGGAGCCCTGG - Intergenic
937271592 2:120656429-120656451 GAATCACACGTGTGGAGCCCAGG + Intergenic
937682362 2:124657614-124657636 GAGGGAAAGGTTTGGAGCCATGG - Intronic
943844178 2:192622311-192622333 GAGGGAAAAGTGTGCAGCCCAGG - Intergenic
944932988 2:204539578-204539600 GAAATACAAGTTTGGAGCTCAGG - Intergenic
947687820 2:232105784-232105806 GACTGACATGTTGGGAGCCTGGG - Intronic
1168837108 20:884764-884786 GACTGACAAGTTTGGTCTCCAGG - Intronic
1174334514 20:49849431-49849453 GTGTGGCAAGCTGGGAGCCCGGG - Intronic
1174417463 20:50376964-50376986 GAGAGCCAAGTGAGGAGCCCAGG - Intergenic
1175921753 20:62453465-62453487 GTGGGAGAAGTGTGGAGCCCTGG + Intergenic
1176338916 21:5624693-5624715 GAGTGGCCAATCTGGAGCCCAGG - Intergenic
1176340324 21:5687766-5687788 GAGTGGCCAATCTGGAGCCCAGG - Intergenic
1176472578 21:7119919-7119941 GAGTGGCCAATCTGGAGCCCAGG - Intergenic
1176504503 21:7636690-7636712 GAGTGGCCAATCTGGAGCCCAGG + Intergenic
1176922037 21:14699324-14699346 AATTGACAAGTTTTGACCCCGGG - Intergenic
1177380888 21:20342940-20342962 GAGAGAGGAGTTTGTAGCCCGGG + Intergenic
1178213784 21:30569504-30569526 GAGTGACAACTTTTGGGCTCCGG - Intergenic
1182063840 22:27416755-27416777 GATGGGCAAGTTTTGAGCCCTGG - Intergenic
1182472618 22:30557685-30557707 GAGTGGAAAGTTTGGGGCCCTGG - Intronic
1182935064 22:34213439-34213461 TTCTGACAAGTTTGGAGCCAAGG - Intergenic
1184312706 22:43658441-43658463 GAGTGACAAAATTGGAGACCCGG + Intronic
1184976181 22:48064074-48064096 GAGTGATGAGTGTGGGGCCCAGG + Intergenic
1203239588 22_KI270733v1_random:2224-2246 GAGTGGCCAATCTGGAGCCCAGG - Intergenic
954603632 3:51892101-51892123 GAGGGACCAGTATGGAACCCAGG + Intergenic
958462626 3:94418510-94418532 GGGTGAGAAGACTGGAGCCCAGG - Intergenic
960940565 3:122930308-122930330 GAGTGACAAGTTTGGAGCCCAGG + Intronic
960993024 3:123324034-123324056 GACATTCAAGTTTGGAGCCCTGG + Intronic
962356642 3:134699769-134699791 GCATGACAAGTCTGCAGCCCAGG - Intronic
963069753 3:141293133-141293155 AAGGGACATGTTTGTAGCCCTGG + Exonic
964374601 3:156036768-156036790 GAATGACAAGTGTGAATCCCAGG - Intergenic
967875083 3:194263125-194263147 GAGTGGAAAGCTTGGGGCCCAGG - Intergenic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
969448256 4:7257630-7257652 GGGTGACAAGCCTGGAGCTCAGG - Intronic
970274842 4:14387225-14387247 GAGTTGAAAGTTTGGAGCCCAGG - Intergenic
972378759 4:38499239-38499261 GAGTGACAAGCTTAGGGTCCTGG + Intergenic
973586127 4:52393368-52393390 AACTTACAATTTTGGAGCCCAGG + Intergenic
976205282 4:82618322-82618344 GAGTGACAAGTTTGGATTCCAGG + Intergenic
979552211 4:122003715-122003737 GAGCGACAGGTTTTGAGACCTGG + Intergenic
983421048 4:167517372-167517394 GTGTTACAGGTTTGTAGCCCAGG - Intergenic
984466674 4:180108613-180108635 GAGTTCCAAGGATGGAGCCCTGG - Intergenic
986713171 5:10502548-10502570 CACTTACAAGTTTGGAGTCCAGG + Intergenic
987609763 5:20187487-20187509 GATTGTAAAATTTGGAGCCCAGG - Intronic
993834448 5:92799766-92799788 CAGTAACAGGTTTGTAGCCCAGG + Intergenic
995837093 5:116409857-116409879 CAGTCACAAGTTTGCAGCCCAGG - Intronic
1002319191 5:178364947-178364969 GAGTGAGCAGCTCGGAGCCCAGG - Intronic
1003120028 6:3311859-3311881 GTGTGCCAATTTTGTAGCCCTGG + Intronic
1011185531 6:84671580-84671602 AAGTGAAAAGTTTAGAGCCTTGG - Intergenic
1011722770 6:90176270-90176292 GAATGACAATTCTGGAGCTCAGG + Intronic
1012160553 6:95880088-95880110 GAGAGAAAAGACTGGAGCCCTGG + Intergenic
1018793802 6:167170780-167170802 GGGTCACAAGTTTGGGGCCGAGG + Intronic
1018822534 6:167384301-167384323 GGGTCACAAGTTTGGGGCCGAGG - Intronic
1019808857 7:3149536-3149558 AAGGGACAAGTTTGGAGCCAGGG - Intronic
1023166887 7:37351743-37351765 TAATGACAAGTTTGGAACTCAGG - Intronic
1028239438 7:88401459-88401481 CAGTAACAAGTTTGTAGCCTAGG - Intergenic
1028746948 7:94337888-94337910 AAGCGAGCAGTTTGGAGCCCTGG + Intergenic
1030338568 7:108351281-108351303 GACTTACAGGTTTGGAGCCTAGG - Intronic
1032365969 7:131300337-131300359 GAGAGACAAGTTTGGAGGGTGGG + Intronic
1033033859 7:137852265-137852287 GACTCACAAGTTTGGTGCTCAGG - Intergenic
1033287410 7:140054392-140054414 GAGTGTCAAGTATTGAGCCTTGG - Intronic
1035629460 8:1097008-1097030 GAGAGTCAAGCTGGGAGCCCGGG + Intergenic
1035629483 8:1097098-1097120 GAGAGTCAAGCTGGGAGCCCAGG + Intergenic
1036946831 8:13101966-13101988 GAGTGGCAAGCATGGAGCGCTGG + Intronic
1038803752 8:30772083-30772105 GAGTCACAAGTTGCAAGCCCAGG + Intergenic
1041629225 8:60065796-60065818 AAGTGTCAACTTTAGAGCCCAGG - Intergenic
1042685445 8:71433814-71433836 GAGTGACAAGTGAGAAGCCACGG + Intronic
1044045754 8:87429933-87429955 GAGGGACAAGTTTGGAGTTGAGG + Intronic
1047214779 8:122867270-122867292 GAGTGAAAAGTCTTCAGCCCAGG + Intronic
1051783391 9:20714871-20714893 TAGTGACAAGTGTGAAGCCTAGG - Intronic
1051961144 9:22764305-22764327 GAGTCACAAAATTGGAGCACTGG + Intergenic
1053389729 9:37725853-37725875 GAGTGACAAGATTCCAGCACAGG - Intronic
1055729732 9:79268024-79268046 GATGGACAAGTTTGGGACCCTGG + Intergenic
1057790022 9:98118722-98118744 GAGTGAGAGGTTGGGAGCCCAGG - Intronic
1058367318 9:104224128-104224150 GCTTGAGAAGTTTCGAGCCCTGG - Intergenic
1059243825 9:112832375-112832397 GAGGGAAAAGCTTGGACCCCTGG + Intronic
1059443864 9:114326159-114326181 CAGTGCCAGGGTTGGAGCCCTGG + Intronic
1059445070 9:114332936-114332958 CAGTGCCAGGGTTGGAGCCCTGG + Intronic
1060387066 9:123240837-123240859 GATATACAAGTTTGGAGTCCAGG - Intronic
1203422743 Un_GL000195v1:10227-10249 GAGTGGCCAATCTGGAGCCCAGG + Intergenic
1186274048 X:7920861-7920883 GATTGAAAAGTTAGGAGACCTGG + Intronic
1189072611 X:37880482-37880504 TAGTGACAAGAGTGGATCCCAGG - Intronic
1189109723 X:38276245-38276267 AAGTGCAAAGTTAGGAGCCCTGG - Intronic
1193774960 X:85629991-85630013 GATTGAAAAGTCAGGAGCCCAGG - Intergenic
1194283076 X:91976597-91976619 GAGTGACAAGTTAAGAGTCTTGG - Intronic
1195537576 X:106026293-106026315 GAGTGACAAATTTGAAGACATGG + Intergenic
1197095705 X:122592085-122592107 GAGTGAGAAGGTTGTAGCCAGGG + Intergenic