ID: 960950017

View in Genome Browser
Species Human (GRCh38)
Location 3:122993167-122993189
Sequence TGGTCTGGCCGCAGAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960950014_960950017 -4 Left 960950014 3:122993148-122993170 CCAGCAGCTCCAGACGGCTTGGT 0: 1
1: 0
2: 0
3: 8
4: 113
Right 960950017 3:122993167-122993189 TGGTCTGGCCGCAGAAAAGCAGG 0: 1
1: 0
2: 1
3: 9
4: 106
960950012_960950017 1 Left 960950012 3:122993143-122993165 CCTGACCAGCAGCTCCAGACGGC 0: 1
1: 0
2: 0
3: 22
4: 282
Right 960950017 3:122993167-122993189 TGGTCTGGCCGCAGAAAAGCAGG 0: 1
1: 0
2: 1
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960950017 Original CRISPR TGGTCTGGCCGCAGAAAAGC AGG Intronic
902387845 1:16085902-16085924 TGGTGTGTCCCCAGAAAAGTGGG - Intergenic
902579766 1:17401118-17401140 TGGTCTGACCGCAGAGAGGCAGG + Intronic
905077189 1:35282932-35282954 TGGTGAGGATGCAGAAAAGCTGG - Intronic
906638268 1:47424888-47424910 TGGGCTGGAGGCAGAAAACCTGG + Intergenic
912714618 1:111974162-111974184 TGTTCTGGCCGGAGAAAAGCAGG + Intronic
912933456 1:113983531-113983553 GGGTCTGCCCACAGAACAGCTGG + Intergenic
1065739569 10:28784727-28784749 GGGGCTGGCTGCAGAGAAGCTGG - Intergenic
1065772832 10:29093620-29093642 TGGTCTGTCTGCAGAAACCCTGG - Intergenic
1067012874 10:42730888-42730910 TGGTCTGGCCTCCGAAGAGGTGG + Intergenic
1069757290 10:70781093-70781115 TGGTCTGGCTGGAGTAAAGTAGG - Intronic
1071486272 10:86104573-86104595 TTCTCTGGCCGCAGAGGAGCTGG - Intronic
1073722286 10:106186452-106186474 TGGTGTGACCTAAGAAAAGCTGG + Intergenic
1077722423 11:4642171-4642193 TGGTCTGGCCTGTGAAAAGGTGG - Intergenic
1078822126 11:14892538-14892560 AGGTCTGGCCCCAGAGAGGCAGG - Intergenic
1080201208 11:29672629-29672651 TGGCCTGGTGGCAGAGAAGCAGG - Intergenic
1083637181 11:64126985-64127007 TGGTCTGGGCCCTGAGAAGCCGG - Intronic
1089554634 11:119309686-119309708 TGGACTGGTCCCTGAAAAGCGGG + Exonic
1091350383 11:134889354-134889376 TGCTCTTGTCACAGAAAAGCCGG + Intergenic
1095255658 12:40032608-40032630 AGGTCTGGCCCCAGGAATGCAGG - Intronic
1095532423 12:43204067-43204089 TGGTATGGCCCCAGAAAACTTGG - Intergenic
1096490544 12:52010415-52010437 TGGGCTGGCCCCAGCATAGCTGG + Intronic
1097547292 12:61020383-61020405 TGGTGTGGATGCAGAAAAGAGGG - Intergenic
1100461648 12:94805526-94805548 TGGGGTGGCTGCAGACAAGCTGG - Intergenic
1108275721 13:48807596-48807618 TGGTGTGGCTGGAGAGAAGCGGG - Intergenic
1111952249 13:94718009-94718031 AGGCCTGGCCCCAGAACAGCAGG - Intergenic
1117959426 14:61148346-61148368 TGGCCAGGCCTCAGAAACGCGGG - Intergenic
1128329490 15:66746266-66746288 TTTTCTGGCCCCAGCAAAGCTGG + Intronic
1128462826 15:67884289-67884311 TGGTCTGGCTGTAGAAAACCTGG - Intergenic
1129694090 15:77730829-77730851 AGGCCTGGCCACAGAAAGGCTGG + Intronic
1130955503 15:88624381-88624403 TGCTCTGGCCTGAGAAGAGCTGG + Intronic
1131499842 15:92951579-92951601 TGGTCTGGTTCCAGAAAAACAGG + Intronic
1132276834 15:100573890-100573912 TGGTCTGGCGGCATTAAGGCAGG + Exonic
1133230581 16:4364686-4364708 CAGCCTGGCCGCAGACAAGCAGG + Exonic
1133326169 16:4943637-4943659 TGGTCTGGCTGCAGGAACACAGG - Intronic
1133413904 16:5590928-5590950 TGGTCTGAATGCAGAAATGCTGG - Intergenic
1136369751 16:29828975-29828997 TGGCCTGGCCGAGGAAAAACAGG - Intronic
1139355791 16:66366515-66366537 TGGGCTGGCTGCAGATAGGCAGG - Intergenic
1141369677 16:83475259-83475281 AGGTCTGGCCGCTGAAGTGCAGG + Intronic
1142094628 16:88232921-88232943 TGGTCTGGCCGCCGCCTAGCAGG + Intergenic
1143591122 17:7886161-7886183 TGGTCAAGCTGCAGAACAGCTGG - Intronic
1143614192 17:8039702-8039724 TGGTGTGGCCACAGAGTAGCGGG + Intronic
1145124772 17:20291163-20291185 TGGCCTGGCCTCAGAAAATGGGG + Intronic
1147053213 17:37813712-37813734 CAGTCTGGCTGCAGAGAAGCTGG - Intergenic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1151152229 17:72098026-72098048 TGGTCTGGTGGCAGAAAAATGGG + Intergenic
1152465868 17:80465889-80465911 AGGTTTGGCCTCAGCAAAGCAGG - Intergenic
1156462952 18:37331881-37331903 TGGTGTGGCCGCAGAGGATCTGG + Intronic
1159842872 18:73420085-73420107 TGGTTTGGATGAAGAAAAGCTGG + Intergenic
1161033899 19:2073294-2073316 TGCTCAGGCCGGAGAGAAGCGGG + Exonic
1162020091 19:7864361-7864383 TGCTCTGGCCCCAGAGAAGCAGG - Intronic
1165647547 19:37455257-37455279 TGGTAAGGCCTCAGAAAAGACGG + Intronic
1165781078 19:38434655-38434677 TGCCCAGGCCCCAGAAAAGCCGG - Intronic
926123519 2:10257453-10257475 TGGTCTGGCCCCAGAAAAAAGGG + Intergenic
927841049 2:26444452-26444474 TGGTCCAGCCCCAGAATAGCTGG - Intronic
928959025 2:36903954-36903976 TGCTCTTGCCATAGAAAAGCTGG + Intronic
934656965 2:96121432-96121454 TGGGCTGGAAGCAGAACAGCCGG - Intergenic
947659300 2:231854927-231854949 TCGGCTGGCCGCAGAAACCCAGG + Intergenic
948460719 2:238128742-238128764 TGGCCTGGCCGCACTACAGCTGG + Exonic
1168805399 20:669717-669739 AGGTCTGTCAGCAGCAAAGCGGG + Intronic
1173507899 20:43603116-43603138 TGGTCTAGCCTGAGAAAATCTGG - Intronic
1174388378 20:50200691-50200713 TGGGCTGGCCCCAGGAAGGCTGG - Intergenic
1174442675 20:50568417-50568439 TGGTGTGGGAGCAGAAAAGCAGG + Exonic
1175061064 20:56243851-56243873 TGCTCTTGCCCCAGTAAAGCAGG + Intergenic
1178087605 21:29128063-29128085 GGGTCTGCCTTCAGAAAAGCTGG - Intronic
1180700754 22:17780417-17780439 GGGGCTGCCCCCAGAAAAGCTGG + Intergenic
1181603609 22:23966871-23966893 AGCTCTGGCGGAAGAAAAGCTGG - Intergenic
1181604904 22:23974436-23974458 AGCTCTGGCGGAAGAAAAGCTGG + Exonic
1184248751 22:43248686-43248708 TGGCCTGGCTGAAGGAAAGCGGG - Intronic
1184877465 22:47284569-47284591 TGGGCTGGCCACAGAGGAGCAGG - Intergenic
1185311532 22:50158401-50158423 GGCTCTGGCCGTAGAAAAGCTGG - Intronic
960927387 3:122808525-122808547 TGGTGTGGCATGAGAAAAGCAGG + Intronic
960950017 3:122993167-122993189 TGGTCTGGCCGCAGAAAAGCAGG + Intronic
961583070 3:127899263-127899285 TGGGCTGGCCAGAGAGAAGCTGG + Intergenic
963040544 3:141066588-141066610 TCGTCGGGCCCCAGAAAGGCCGG - Exonic
967946494 3:194808024-194808046 TGCTCTACCCGCAGAAAGGCAGG - Intergenic
968520681 4:1033477-1033499 TGGTCTTGCCGCAACAAAGGCGG - Intergenic
968854063 4:3105415-3105437 TGGTTCGGCCTCAGAAATGCAGG + Exonic
969371238 4:6732852-6732874 TGGCCAGGCCGCAGGAAGGCAGG + Intergenic
975846991 4:78535323-78535345 TGGAATGGCCGCAGAACAGTAGG - Intronic
979404019 4:120286880-120286902 TGGTCTGGCCTCTGAAAAACTGG - Intergenic
985741821 5:1622023-1622045 TGGTCTTGCAGCTGAAAACCCGG - Intergenic
992997388 5:82346813-82346835 TGGGCGGGCAGCAGAAAAGGTGG - Intronic
994416260 5:99475824-99475846 TACTCTGGCCCCAGGAAAGCAGG + Intergenic
994463708 5:100099348-100099370 TACTCTGGCCCCAGGAAAGCAGG - Intergenic
998666322 5:144302138-144302160 TGCTCTGGGGTCAGAAAAGCTGG - Intronic
1002603329 5:180367847-180367869 TGTTCTGGAAGCAGAAAGGCTGG + Intergenic
1002616126 5:180457621-180457643 TGGTCGGGACACAGAAAAGAGGG + Intergenic
1004543796 6:16577114-16577136 AGGTCTGGGCAGAGAAAAGCGGG - Intronic
1005941260 6:30561986-30562008 TGGCCTGGCCCCGGAAAAGGAGG - Exonic
1017130406 6:151103698-151103720 TGCTGTGGCCTCAGAAAAGATGG - Intergenic
1019144666 6:169969057-169969079 TGGTTTGGACGAGGAAAAGCTGG + Intergenic
1022388500 7:29923827-29923849 TGATCTGGCTTCAGAAAAGGAGG + Intronic
1027342797 7:77227230-77227252 TTTTATGGCCACAGAAAAGCAGG - Intronic
1027443671 7:78246824-78246846 TGGCCTGGCTCCAGAAAAGAAGG - Intronic
1034171397 7:149065782-149065804 TGGTCTCGCGGAGGAAAAGCAGG + Intergenic
1037997537 8:23364245-23364267 GGGTCTGCCTGCTGAAAAGCAGG + Intronic
1038920431 8:32077421-32077443 TGGTCTAGCTTCAGAAATGCAGG - Intronic
1039971790 8:42326567-42326589 GGGCCTGGCAGCAGAAAGGCAGG - Intronic
1040285898 8:46100211-46100233 TGGTCGGGCCGCAGAAACTCAGG - Intergenic
1040294319 8:46141419-46141441 TGGTCAGGCCGCAGGAACTCAGG - Intergenic
1040336948 8:46420894-46420916 TGGTCGGGCCGCAGGAACTCAGG + Intergenic
1040737446 8:50526122-50526144 TGGTCTGGCTGCAGAACTGCAGG + Intronic
1050836899 9:10093455-10093477 TGGCATGGCAGCAGAAAAACGGG + Intronic
1055222311 9:73951252-73951274 TGGTAAGGCTGCAGAAAAACGGG - Intergenic
1059994158 9:119892956-119892978 TGCTCTGGACCCAGAAAAGAGGG - Intergenic
1060225925 9:121790909-121790931 GGTTCTTGCCCCAGAAAAGCGGG - Intergenic
1060559932 9:124534502-124534524 TGGACAGGCCCCAGAACAGCAGG + Intronic
1061340097 9:129973254-129973276 GAGTCTGGCCTCAGAAAACCTGG + Intronic
1062234882 9:135503031-135503053 TGGCCTGGGCTGAGAAAAGCGGG - Intronic
1062414680 9:136442319-136442341 TAGTCTGGATGCTGAAAAGCAGG + Intronic
1194978258 X:100414227-100414249 TGCCCTGGCTGCAGAAAAGTGGG + Intergenic
1196775560 X:119333929-119333951 GGGACTGGCCGCAGTAGAGCAGG - Intergenic
1197378513 X:125710589-125710611 TGGTCTAGCCGCAGACTTGCAGG + Intergenic
1198257234 X:134934293-134934315 AGGTCAGGAAGCAGAAAAGCAGG + Intergenic
1199871898 X:151905355-151905377 TGGTCTGGTTGAAGAAAAGAGGG + Intergenic
1200844469 Y:7817192-7817214 TGGTCTGGGCCTAGAAAAGAGGG + Intergenic
1201941352 Y:19463632-19463654 TGGTCTGGCAGGAAAGAAGCAGG - Intergenic