ID: 960950436

View in Genome Browser
Species Human (GRCh38)
Location 3:122995411-122995433
Sequence GTGGCCACCCTGTCATCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 201}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960950436_960950442 5 Left 960950436 3:122995411-122995433 CCCTGGGATGACAGGGTGGCCAC 0: 1
1: 0
2: 0
3: 13
4: 201
Right 960950442 3:122995439-122995461 GCCACACTAGAGACAGGCTCTGG 0: 1
1: 0
2: 1
3: 10
4: 94
960950436_960950444 6 Left 960950436 3:122995411-122995433 CCCTGGGATGACAGGGTGGCCAC 0: 1
1: 0
2: 0
3: 13
4: 201
Right 960950444 3:122995440-122995462 CCACACTAGAGACAGGCTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 130
960950436_960950439 -1 Left 960950436 3:122995411-122995433 CCCTGGGATGACAGGGTGGCCAC 0: 1
1: 0
2: 0
3: 13
4: 201
Right 960950439 3:122995433-122995455 CACCCTGCCACACTAGAGACAGG 0: 1
1: 0
2: 1
3: 14
4: 132
960950436_960950446 28 Left 960950436 3:122995411-122995433 CCCTGGGATGACAGGGTGGCCAC 0: 1
1: 0
2: 0
3: 13
4: 201
Right 960950446 3:122995462-122995484 GCAGAAGAAGCTGTAATCATGGG 0: 1
1: 0
2: 1
3: 12
4: 196
960950436_960950445 27 Left 960950436 3:122995411-122995433 CCCTGGGATGACAGGGTGGCCAC 0: 1
1: 0
2: 0
3: 13
4: 201
Right 960950445 3:122995461-122995483 GGCAGAAGAAGCTGTAATCATGG 0: 1
1: 0
2: 0
3: 19
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960950436 Original CRISPR GTGGCCACCCTGTCATCCCA GGG (reversed) Intronic
900017881 1:166495-166517 GTGGCCAGCCTGTGTCCCCAGGG + Intergenic
900070362 1:766939-766961 GTGGCCAGCCTGTGTCCCCAGGG + Intergenic
900429935 1:2596695-2596717 GGGGCCACCCGATCATCCCACGG + Intronic
900473973 1:2867862-2867884 GCAGCCACCCTGTCAGGCCACGG - Intergenic
902255858 1:15188211-15188233 GTGGCCGTCTTGTCATCACAAGG - Intronic
903220266 1:21865407-21865429 GAGGACACCCTGGCACCCCAGGG - Intronic
903971073 1:27119244-27119266 CTGGTCACCCTGGCAACCCAGGG - Intronic
910679031 1:89843751-89843773 GCGGCCACCCTGTTCTCTCAGGG - Exonic
911400327 1:97366797-97366819 GTAGCCTCCCTGGCATCTCATGG - Intronic
916002496 1:160630550-160630572 GACCCCACCCTTTCATCCCAAGG + Intronic
917123353 1:171664005-171664027 GTGGCAACACTGTCATTCCTGGG + Intergenic
917612644 1:176704082-176704104 GTGGCCACCCTGCAGCCCCAGGG + Intronic
920330358 1:205203237-205203259 CTGGCCACCTTGGCCTCCCAAGG - Intronic
920588609 1:207194615-207194637 GTGGCCATCCTGTCAGCCTCAGG - Intergenic
920717578 1:208355193-208355215 GTGGACATCCAGGCATCCCAAGG - Intergenic
922105725 1:222512362-222512384 GTGGCCAGCCTGTGTCCCCAGGG + Intergenic
922266068 1:223984993-223985015 GTGGCCAGCCTGTGTCCCCAGGG + Intergenic
924347907 1:243089932-243089954 GTGGCCAGCCTGTGTCCCCAGGG + Intergenic
924788637 1:247222411-247222433 GTGGTCAACCAGACATCCCAGGG + Intergenic
1063935406 10:11072504-11072526 GTGGCTACCGTGGCCTCCCAGGG - Intronic
1065164136 10:22957212-22957234 GAGGCCTCACTGTCATCACACGG - Intronic
1066728447 10:38414974-38414996 GTGGCCAGCCTGTGTCCCCAGGG - Intergenic
1067083046 10:43222373-43222395 GTCCCCACCCTTTCATCACATGG - Intronic
1072446962 10:95507323-95507345 GTGGCGGCTCTGTAATCCCAGGG - Intronic
1075004532 10:118820496-118820518 GTGGCCAAGCTGGCATCTCATGG + Intergenic
1076053935 10:127356203-127356225 TTGGCCTTCCTGCCATCCCAGGG + Intronic
1076227826 10:128794434-128794456 CTGCCGACCCTGTCCTCCCATGG + Intergenic
1076436151 10:130443418-130443440 GGAGCCAGCCTGTCATCCTATGG + Intergenic
1076974483 11:161691-161713 GTGGCCAGCCTGTGTCCCCAGGG + Intergenic
1077376845 11:2209268-2209290 GTGACCACCCTGTCAGAGCAGGG + Intergenic
1077546454 11:3172467-3172489 GTGGCCAGCCTGTGATGCCCAGG + Intergenic
1078360578 11:10664634-10664656 GGGGCCTTCCTGGCATCCCAGGG + Intronic
1079043582 11:17080319-17080341 CTGGCCTCCATGTCATCTCAGGG + Intronic
1083389285 11:62336307-62336329 GTGGGCCCAATGTCATCCCAAGG + Intergenic
1083688140 11:64389923-64389945 GCAGCCAGCCTGTCACCCCAAGG + Intergenic
1084346403 11:68552646-68552668 CAGGCCACACTGTCATCACAGGG - Intronic
1084776355 11:71379386-71379408 GGGGCCATTCTGTCATCCCCAGG - Intergenic
1085018023 11:73188150-73188172 GGGGCCAGCCTGTCCTTCCAAGG - Intergenic
1086620428 11:88881996-88882018 CTGCCCACCTTGGCATCCCAAGG - Intronic
1091396020 12:154615-154637 GATGCCACCCTCTCAGCCCAGGG - Intronic
1101818406 12:108163588-108163610 GTGGTCCCACTGTCATCGCAAGG + Intronic
1102111283 12:110367112-110367134 GCAGCCACCCTGTCTACCCAGGG - Intergenic
1102145155 12:110649693-110649715 GTGCCCACCCCCACATCCCAGGG - Intronic
1103452802 12:121041201-121041223 CTGCTCACCCTTTCATCCCAAGG - Intergenic
1104091740 12:125523445-125523467 GTGGGCCCCATGTCATCACAAGG - Intronic
1104266866 12:127241824-127241846 GTGGCCACAAGGTCATGCCAAGG - Intergenic
1104426466 12:128682258-128682280 GAGCCCCCACTGTCATCCCATGG - Intronic
1104795085 12:131511696-131511718 GTGCCCACCCTGTCCTCCGAGGG + Intergenic
1105403860 13:20118372-20118394 CGGGCCACGCTGTCATCCCTTGG - Intergenic
1107145040 13:37052448-37052470 GTGGCTAGCCAGTCTTCCCAGGG - Intronic
1109802061 13:67393239-67393261 GTGGTCACCTTGTCATCCTGGGG - Intergenic
1112190811 13:97175510-97175532 TTGGCCACCATCTCATTCCAGGG - Intergenic
1113537764 13:111081858-111081880 GCGGCCACCCAGTCCTCCTAGGG + Intergenic
1114484373 14:23054328-23054350 GTCTCCCCTCTGTCATCCCAAGG - Exonic
1116581427 14:46647123-46647145 TTTCCCACCCTCTCATCCCAAGG + Intergenic
1117254901 14:53967866-53967888 GTGGCCACAATGTAATCACAAGG - Intergenic
1118244130 14:64091943-64091965 GTGGCCACTCTGTTCTCCTAAGG + Intronic
1118780626 14:69005408-69005430 CTGGCCATCCTCTCATCCCAAGG + Intergenic
1119766970 14:77196308-77196330 GTGGCCATCCTGGCCGCCCATGG + Intronic
1121715171 14:96068638-96068660 GTGGCCAAGCTTTCCTCCCAGGG - Intronic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122249049 14:100425261-100425283 GTGCACATCCTGTCACCCCATGG + Intronic
1122893094 14:104742027-104742049 CTGGCCTCCCTGTCCTCCCACGG - Intronic
1122938781 14:104972010-104972032 CAGGCCACCCTGGCATCCCGTGG - Intronic
1124002815 15:25772771-25772793 CTGGCCACGCTGTCTTCCCTGGG - Intronic
1124416971 15:29480480-29480502 GTGGCCTCCCTGCCCTACCAGGG - Intronic
1126310051 15:47305314-47305336 GTGATCACCAGGTCATCCCATGG - Intronic
1127660671 15:61097451-61097473 GTAGCCACCCTGTTCTCCAAGGG + Intronic
1128033222 15:64499988-64500010 CTGACCACCCCGTCCTCCCAAGG - Exonic
1128148510 15:65346429-65346451 GTGGCCACCCTTTTACTCCATGG - Intronic
1131370373 15:91876059-91876081 CTGTCCACCTTGTCCTCCCAAGG - Intronic
1132480014 16:162740-162762 TAGGTCACCCTGTCATCACAGGG + Intronic
1133616638 16:7483040-7483062 GTGGCTTCCCTCTCCTCCCACGG - Intronic
1134227650 16:12403932-12403954 GGGGTCATCCTGTCAACCCACGG - Intronic
1136276427 16:29181690-29181712 CTGGCCTCCCGGTCATCACAGGG + Intergenic
1137401206 16:48155770-48155792 GTGGCCACCATTTAGTCCCAAGG - Intronic
1137988389 16:53130101-53130123 GTTGCAACCCTGTCTTCCCGAGG - Intronic
1138458247 16:57133347-57133369 CTGGCCTCCCTGGCAGCCCAGGG - Intronic
1141515723 16:84543709-84543731 GGGGCCACTAGGTCATCCCAGGG + Intronic
1141964921 16:87435453-87435475 GTGGCCACCCCGTGATACCATGG + Intronic
1141978667 16:87535566-87535588 GTGGCCCCAATGTCATCACAGGG - Intergenic
1142283615 16:89161753-89161775 GTGCCCACCCTGTGCTCCTAAGG - Intergenic
1142445783 16:90135967-90135989 GTGGCCAGCCTGTGTCCCCAGGG - Intergenic
1142461733 17:99504-99526 GTGGCCAGCCTGTGTCCCCAGGG + Intergenic
1146479291 17:33191716-33191738 GTAGCTACCCTGTAATCACATGG - Intronic
1147811091 17:43170354-43170376 TTGGCCACCCAGTCCTCCCCTGG + Intergenic
1148199748 17:45742146-45742168 GTGGCATCCCCATCATCCCAAGG + Intergenic
1150959713 17:69900312-69900334 GTTGCCTCCCTGCCAACCCAAGG + Intergenic
1151527599 17:74681568-74681590 TGTGCCACACTGTCATCCCAAGG - Intronic
1152491509 17:80637754-80637776 GTGGAAATTCTGTCATCCCAAGG + Intronic
1152760977 17:82106912-82106934 GTGGGCACCCTAGCATCTCAGGG + Intronic
1155561262 18:27079900-27079922 GTGGACTCCATGTCATCACAAGG - Intronic
1157045793 18:44100323-44100345 GTGGCTGCACTGGCATCCCAGGG + Intergenic
1157258972 18:46162409-46162431 GAGGCCTCCCTGATATCCCAGGG + Intergenic
1158039185 18:53071883-53071905 CTGCCCACCTTGTCCTCCCAAGG - Intronic
1160651432 19:231868-231890 GTGGCCAGCCTGTGTCCCCAGGG + Intergenic
1160888524 19:1364221-1364243 GTGGCACCCCTCCCATCCCAAGG + Intronic
1161724883 19:5923072-5923094 GTGGCCCCTCCGTCATCTCAGGG + Intronic
1163632483 19:18424531-18424553 CTGGCTGCCCTGTCACCCCAGGG - Intronic
1164283287 19:23788177-23788199 GTGACCTTCCTGTCATGCCAAGG + Intronic
1165453866 19:35899959-35899981 GTGGCCATCCGGAAATCCCAGGG + Intronic
1167053511 19:47094726-47094748 ATGGCCCCCATGTCCTCCCAGGG - Intronic
925210024 2:2037510-2037532 CTGGCCACCTTGGCTTCCCAAGG - Intronic
925249647 2:2421582-2421604 GTGGCCCCCATGCCATCCCAGGG + Intergenic
926692235 2:15745384-15745406 TAGGCCACCCAGTCATCCCTTGG - Intergenic
927153291 2:20207888-20207910 GTGCCCACTCTGTGATCCCCCGG - Intronic
928368906 2:30724627-30724649 CTGGACACCCTGGCATCTCAAGG + Intronic
928682686 2:33718385-33718407 ATGCCCACCTTGTCTTCCCAAGG - Intergenic
930033545 2:47072240-47072262 GCAGCCACCCTGTCCTCCCCTGG + Intronic
930219118 2:48727754-48727776 CTGGCTACACTGTCATCTCATGG + Intronic
930356975 2:50333508-50333530 GTGCCCACCCAGCCATGCCATGG + Intronic
930768975 2:55113049-55113071 CTGGCCACACTGTGATTCCAGGG + Intergenic
934694748 2:96391512-96391534 GTGTTCTCCCTGGCATCCCAGGG + Intergenic
935018409 2:99206282-99206304 TGAGCCACCCTGGCATCCCAGGG + Intronic
935096055 2:99945450-99945472 CTGCCCACCCAGGCATCCCAGGG + Intronic
935274847 2:101467341-101467363 GGGGCCAGCCTGGCTTCCCAGGG + Intronic
942812814 2:180018265-180018287 GAGGCCACTCTCTCATCCCCTGG + Intergenic
943065739 2:183084293-183084315 GTAGACAGCCTGTAATCCCAAGG + Intronic
944972599 2:205011287-205011309 GTAGCCAAGCTGTCATCTCAAGG + Intronic
945176420 2:207048154-207048176 GTGCCCAGCCTGTCCTCCCTGGG - Intergenic
948011466 2:234652421-234652443 CTGACCACCCTGTCATTCCTGGG + Intergenic
948770944 2:240251007-240251029 GTGCCCACCCTTTCTTCTCAGGG - Intergenic
1170316252 20:15044134-15044156 GTGCCAACCCTCTCATCACATGG + Intronic
1172481413 20:35274063-35274085 GTGGTCCGCCTGTCATCCTACGG - Intronic
1175152532 20:56946448-56946470 GTGGCCCCCCTTTAATCACATGG + Intergenic
1175249043 20:57597934-57597956 GTGGCCTCGATGTCATCACAGGG + Intergenic
1176115724 20:63431104-63431126 GTGCCAACCCTGCCCTCCCAGGG - Intronic
1176157463 20:63628844-63628866 GTAGCCACCCTCCCATCCCCAGG - Intergenic
1176385096 21:6135150-6135172 GTGGCCAGGCTCTCATCCCTAGG + Intergenic
1179637725 21:42724177-42724199 GAGCGCACCCTGTCACCCCAAGG + Intronic
1179637772 21:42724407-42724429 GTGGCCACAGTTTCCTCCCAGGG - Intronic
1179722307 21:43322724-43322746 GTGGCCAGACTGTGAGCCCAGGG + Intergenic
1179738377 21:43403102-43403124 GTGGCCAGGCTCTCATCCCTAGG - Intergenic
1180625224 22:17189817-17189839 GTTGGTACCCTGACATCCCAGGG - Intronic
1181370174 22:22409450-22409472 CTGGTCACCTTGTCATACCATGG + Intergenic
1184163277 22:42712158-42712180 GAGGCCACCCTTCCCTCCCAGGG + Intronic
951043706 3:18015439-18015461 GTGGCCACCTTGACACCCTATGG - Intronic
953498258 3:43407493-43407515 GAGGCAGCCCTGTTATCCCAGGG - Intronic
954278807 3:49560963-49560985 GTGGCCAGCCTGGGAGCCCAAGG - Intronic
954289167 3:49640097-49640119 TTGGCCACCCAGTCATCACCAGG - Intronic
955351984 3:58200376-58200398 GTGGCTGTCCTGCCATCCCAGGG + Intronic
955398464 3:58574121-58574143 GTGGTCACACTGCCATTCCAGGG - Intronic
955671918 3:61411171-61411193 GAGGCAACCCTGTTACCCCATGG + Intergenic
956678804 3:71759122-71759144 GAGTCCACCCTGTTTTCCCAAGG + Intergenic
960950436 3:122995411-122995433 GTGGCCACCCTGTCATCCCAGGG - Intronic
961072597 3:123948699-123948721 GCGGCCACCCTGCCCTCCAAAGG - Exonic
961281375 3:125767500-125767522 GTGGCCAGCCTGTCCTCCTGGGG + Intergenic
961584871 3:127914203-127914225 CTGGCCACCCAGTCAACACAGGG + Intergenic
962579359 3:136783889-136783911 GTGATCACTCTGGCATCCCAAGG + Intergenic
968366398 3:198188097-198188119 GTGGCCAGCCTGTGTCCCCAGGG - Intergenic
969277671 4:6147829-6147851 ATGGCCACCCTGGCCTCACAGGG + Intronic
970217786 4:13777981-13778003 GTGGCCATACTGTCTTTCCATGG + Intergenic
970362124 4:15320710-15320732 GTGCCCACCCTGTGATGCTATGG + Intergenic
972427956 4:38952660-38952682 ATGGCCACACTGTAGTCCCAGGG - Intergenic
975516254 4:75251555-75251577 GTGGCCACAATGACATCCAAAGG - Intergenic
975849827 4:78560685-78560707 GTTGCAACCCTGTGATCACAGGG + Intronic
978372180 4:108039905-108039927 ATTGCCACTCTGTCATCCAAAGG - Intergenic
978767907 4:112423292-112423314 GTGGCCTCCTTATCATCCCTTGG - Intronic
980462129 4:133127769-133127791 ATGTCCACTCTGCCATCCCAAGG - Intergenic
984955401 4:185040540-185040562 GTGGCCACTCTGTCCTCACAGGG - Intergenic
985732375 5:1556518-1556540 ATGGCCACCCTGGCCTCCCCAGG + Intergenic
985851362 5:2391156-2391178 ATGGGCACGCTGTCATCGCATGG + Intergenic
986597638 5:9440054-9440076 GTGAGCACCCTGTCTTCCCCAGG - Intronic
986649904 5:9953043-9953065 GTGGCCCCCGTGTAATCACAGGG - Intergenic
988725687 5:33924136-33924158 CTGGCCTCCCTTTCATCCAAGGG + Intergenic
990771993 5:59257893-59257915 GTTGCTAGCCTGTCTTCCCAGGG - Intronic
991083031 5:62621470-62621492 GGCTCCACCCTGTCCTCCCACGG + Intronic
991501784 5:67284100-67284122 TTGGCCACCCTATTATCTCATGG - Intergenic
994097622 5:95861250-95861272 GTGGCCCTTCTGACATCCCATGG - Intergenic
997588534 5:135058995-135059017 GTGGCCTCCCCGACACCCCAGGG + Intronic
998639568 5:143994549-143994571 GTGACCACACAGTCATCACAAGG + Intergenic
1001683773 5:173577442-173577464 GTGCCCACCCAGCCATGCCATGG - Intergenic
1002088843 5:176792822-176792844 GAGGGGACCCTGTCATCCCCAGG - Intergenic
1002725623 5:181293320-181293342 GTGGCCAGCCTGTGTCCCCAGGG - Intergenic
1003829806 6:9995338-9995360 GTCACCACCCAGTCTTCCCATGG - Intronic
1004360624 6:14967703-14967725 GTCTCCATCCTGTCTTCCCAGGG - Intergenic
1005189548 6:23204615-23204637 CTGGCCAGGCTGTCGTCCCATGG + Intergenic
1006464211 6:34181696-34181718 CTGTCCACCCTGGCCTCCCAAGG - Intergenic
1007179121 6:39915682-39915704 GTAGCCACCCTGGGATGCCAGGG - Intronic
1007677645 6:43610548-43610570 GTGGCTACCCTGTCATTCTGTGG - Exonic
1007764270 6:44151793-44151815 GCGGCCACCGGGTCACCCCAAGG + Intronic
1011134600 6:84086706-84086728 GAGGCTACCCTGTGCTCCCATGG - Intronic
1011277552 6:85644153-85644175 CTGGCCTTCGTGTCATCCCAAGG - Intergenic
1011937769 6:92802171-92802193 ATGCCTACCCTTTCATCCCAAGG + Intergenic
1013298312 6:108780164-108780186 GTGGGCACCCAGACGTCCCATGG - Intergenic
1018731273 6:166652977-166652999 GTGGACACTCTGCCTTCCCAGGG + Intronic
1018907425 6:168083652-168083674 CTGGCCACCCTGTCTCCCAAGGG - Intergenic
1019170482 6:170130774-170130796 GTGGCCACCCTGCCCACCCAAGG - Intergenic
1020613454 7:10429198-10429220 CTGGGCAGACTGTCATCCCAGGG - Intergenic
1021202442 7:17741663-17741685 GTGGCTACCCTGGGAGCCCAAGG - Intergenic
1028143013 7:87292076-87292098 CTGGACACCCTGTGATCACAGGG + Intergenic
1032095624 7:128937385-128937407 GTCGCCTTCCAGTCATCCCAGGG - Intergenic
1034140187 7:148808202-148808224 GAGGCCACCGGGTCATCCCAAGG + Intronic
1035181383 7:157091905-157091927 ATGGACCCCATGTCATCCCAGGG + Intergenic
1035186506 7:157130206-157130228 GTGGACCCCATGTCATCCCAGGG + Intergenic
1035372382 7:158387632-158387654 GTGGCCACCGCGTCTTCCCAGGG - Intronic
1038241961 8:25818255-25818277 GAGCCCACCCTGCCAGCCCAAGG - Intergenic
1039885288 8:41650732-41650754 GGGGCCACCCTGTCCGGCCAGGG - Intergenic
1048057954 8:130886649-130886671 GAGGGCACCCTGGCATCCCAAGG - Intronic
1048984817 8:139729764-139729786 GTGGCTGCCCTGGCCTCCCATGG - Intergenic
1049383355 8:142328758-142328780 GTGGCCACGTTGCGATCCCATGG - Intronic
1049617882 8:143583845-143583867 GTGGGCCCACTGTCATCACAAGG + Intronic
1051894618 9:21974775-21974797 GTGGCCAGCCAGTCAGCCGAAGG + Exonic
1057791293 9:98126841-98126863 GTGGGCACCCCGTCCTCACATGG - Intronic
1058880406 9:109280824-109280846 GTTGCCACCGAGTCATCCTATGG - Intronic
1060975790 9:127764250-127764272 GGGGCCACTCTTTCACCCCATGG + Intronic
1061811408 9:133164400-133164422 CTGGCCACACTTTCTTCCCACGG + Intergenic
1062195124 9:135268848-135268870 GTGGGAACCCTGCCCTCCCACGG + Intergenic
1062402204 9:136377673-136377695 CTGGCCACCCTGGCCCCCCAAGG - Exonic
1062750764 9:138250963-138250985 GTGGCCAGCCTGTGTCCCCAGGG - Intergenic
1185721674 X:2387585-2387607 GTGGCCACCATGTCATCAGCAGG - Intronic
1187855854 X:23635906-23635928 GTGGTCATACTGACATCCCACGG - Intergenic
1188741353 X:33786339-33786361 GAGGCCAGCCAGTTATCCCAGGG + Intergenic
1195751984 X:108169089-108169111 GCAGCCACACTGTCTTCCCAGGG + Intronic
1200145546 X:153924563-153924585 GTGGCCACCCCGCCCTCACATGG - Intronic