ID: 960955138

View in Genome Browser
Species Human (GRCh38)
Location 3:123026522-123026544
Sequence GGCAAAGGAGTCGGCTCCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960955134_960955138 -2 Left 960955134 3:123026501-123026523 CCTTGTTTAAAGTTTGCGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 87
Right 960955138 3:123026522-123026544 GGCAAAGGAGTCGGCTCCGTTGG 0: 1
1: 0
2: 0
3: 2
4: 59
960955132_960955138 1 Left 960955132 3:123026498-123026520 CCTCCTTGTTTAAAGTTTGCGGT 0: 1
1: 0
2: 0
3: 7
4: 67
Right 960955138 3:123026522-123026544 GGCAAAGGAGTCGGCTCCGTTGG 0: 1
1: 0
2: 0
3: 2
4: 59
960955130_960955138 4 Left 960955130 3:123026495-123026517 CCTCCTCCTTGTTTAAAGTTTGC 0: 1
1: 0
2: 0
3: 12
4: 180
Right 960955138 3:123026522-123026544 GGCAAAGGAGTCGGCTCCGTTGG 0: 1
1: 0
2: 0
3: 2
4: 59
960955129_960955138 26 Left 960955129 3:123026473-123026495 CCAGAACGGCGCTGCAGGTGATC 0: 1
1: 0
2: 0
3: 0
4: 38
Right 960955138 3:123026522-123026544 GGCAAAGGAGTCGGCTCCGTTGG 0: 1
1: 0
2: 0
3: 2
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960955138 Original CRISPR GGCAAAGGAGTCGGCTCCGT TGG Intronic