ID: 960955171

View in Genome Browser
Species Human (GRCh38)
Location 3:123026649-123026671
Sequence GGGGCGCTCGGGCACAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960955171_960955187 21 Left 960955171 3:123026649-123026671 CCCTCTCTGTGCCCGAGCGCCCC 0: 1
1: 0
2: 1
3: 12
4: 179
Right 960955187 3:123026693-123026715 GATCTCCCGCAGGACGTGAGCGG 0: 1
1: 0
2: 0
3: 3
4: 57
960955171_960955179 -1 Left 960955171 3:123026649-123026671 CCCTCTCTGTGCCCGAGCGCCCC 0: 1
1: 0
2: 1
3: 12
4: 179
Right 960955179 3:123026671-123026693 CCCGCTCCCTCCCTCCTCGCTGG 0: 1
1: 0
2: 7
3: 52
4: 567
960955171_960955185 11 Left 960955171 3:123026649-123026671 CCCTCTCTGTGCCCGAGCGCCCC 0: 1
1: 0
2: 1
3: 12
4: 179
Right 960955185 3:123026683-123026705 CTCCTCGCTGGATCTCCCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960955171 Original CRISPR GGGGCGCTCGGGCACAGAGA GGG (reversed) Intronic
900295522 1:1947202-1947224 GGGGCACCCAGGCCCAGAGAGGG + Intronic
900894336 1:5472926-5472948 TGGACGCTCGGGCAGAGAGCAGG - Intergenic
902817675 1:18925533-18925555 GGAGGTCTCAGGCACAGAGATGG + Intronic
905733430 1:40311444-40311466 GGGGGGCGGGGCCACAGAGATGG - Intronic
906053255 1:42892474-42892496 GTGACGCTAAGGCACAGAGAAGG + Intergenic
907273161 1:53302455-53302477 GGGGCACTGAGGCCCAGAGAGGG + Intronic
907880650 1:58546572-58546594 GGGGCGCCCGGGCAAGGAGTGGG - Intronic
910825626 1:91404547-91404569 GGCGCGCTCGGGCGCAGGGCGGG - Intronic
915837381 1:159188460-159188482 GGGGCGCTAGGACCGAGAGAGGG - Intronic
917796646 1:178537767-178537789 GTGGGGCTCAGGCAAAGAGAAGG - Intronic
919261317 1:195198285-195198307 GGGGCTATCTGTCACAGAGAGGG - Intergenic
923490485 1:234479213-234479235 CGGGCGCGCGGCCGCAGAGAGGG + Intergenic
1062854006 10:770272-770294 GGGGAGCTGGGGCTCAGAGGAGG + Intergenic
1062854035 10:770367-770389 GGGGAGCTGGGGCTCAGAGGAGG + Intergenic
1063995000 10:11611257-11611279 GGGCGGCTCGGGCACAGTGCGGG - Intronic
1066657000 10:37705473-37705495 GGGTGGCTCAGGCCCAGAGAGGG + Intergenic
1071493486 10:86152477-86152499 GGGGCTCTCGGGCGCAGAGCGGG - Intronic
1074859278 10:117497999-117498021 GGGGAGCTGAGGCCCAGAGAGGG + Intergenic
1075263297 10:120980603-120980625 GGGGAGCTGGGGCAGACAGAGGG - Intergenic
1075646804 10:124102265-124102287 GGGAAGCTTGGGCTCAGAGATGG + Intergenic
1076361751 10:129894534-129894556 GAGGAGCTGGGGCACAGAGGCGG - Intronic
1077475432 11:2788127-2788149 GGGGCGCTGGGGCCATGAGATGG - Intronic
1077501869 11:2912968-2912990 GGGGCACTGGAGCTCAGAGAGGG + Intronic
1079108220 11:17587884-17587906 GGGGTGCTCAGGCCCTGAGATGG + Intronic
1083882303 11:65554629-65554651 AGGACGCTGGGGCACAGGGAGGG - Intronic
1084416119 11:69033846-69033868 GGTGTGCTCTGGCACAGAAAGGG - Intergenic
1084453737 11:69255222-69255244 TGGGAGCTGGGGCACAGCGAGGG + Intergenic
1084981467 11:72831063-72831085 GGGGAGCTCAGGGACAGAGGAGG - Intronic
1085302858 11:75468543-75468565 AGGAAGCTGGGGCACAGAGAAGG - Intronic
1086208180 11:84285387-84285409 GTGGGGCTAGGTCACAGAGAAGG - Intronic
1088823413 11:113475087-113475109 AGGGCGCCCGGGGGCAGAGACGG + Exonic
1089397575 11:118145981-118146003 GGGGCGCGCGGGCGCAGCCAGGG + Intronic
1089640681 11:119845391-119845413 GGGACGCTTGGGCACAGGAAGGG + Intergenic
1093906201 12:24694701-24694723 GGGGAACTGAGGCACAGAGAGGG + Intergenic
1097187322 12:57202802-57202824 GGGGGGCTCTGGGACAGAGGTGG - Intronic
1097804057 12:63945713-63945735 GGGGAGCTCTGGAACTGAGATGG + Intronic
1101828214 12:108237201-108237223 GGGGAGCTAAGGAACAGAGAAGG - Intronic
1102029914 12:109734324-109734346 GGGGCGATGGGGCACAGGGACGG + Intronic
1102212904 12:111139829-111139851 GTGGCTCTCGGGCAGAGTGAAGG - Intronic
1102524051 12:113498670-113498692 GGGAAGCTGAGGCACAGAGAGGG + Intergenic
1102677269 12:114667421-114667443 GGCGCGCTCGGGCAGAGGCAGGG - Intergenic
1104051155 12:125194707-125194729 GGGGCACCTGGGCAGAGAGATGG + Intronic
1104863943 12:131941692-131941714 GCGCAGCTGGGGCACAGAGAAGG + Exonic
1112652668 13:101416173-101416195 GGGGCGCTGGGGCTGCGAGAGGG - Intronic
1114183773 14:20385070-20385092 AGGGCGCTCTGTGACAGAGATGG - Exonic
1118749031 14:68793397-68793419 GGGCCGCGCGGGCGCAGAGCGGG + Intronic
1119211882 14:72838074-72838096 GGGGCCATCTGACACAGAGAGGG + Intronic
1119598338 14:75957109-75957131 GGAGCCCGGGGGCACAGAGAGGG - Intronic
1122121292 14:99554859-99554881 GGTGCTCTGGGGCCCAGAGAGGG - Intronic
1122724320 14:103740265-103740287 GGGGCCCTCGGGCTCTGTGATGG + Exonic
1122775863 14:104116795-104116817 GGGGTGCTCGGGCGCACGGAGGG - Intergenic
1123425602 15:20168366-20168388 GGGGCGCTCAGGCACAGCGGTGG - Intergenic
1123534824 15:21174888-21174910 GGGGCGCTCAGGCACAGCGGTGG - Intergenic
1123904676 15:24909877-24909899 GCGGCGCTGGGGCAGGGAGAAGG + Intronic
1126141429 15:45442627-45442649 TGGGCTCTGGGGAACAGAGAAGG + Intronic
1128641630 15:69342655-69342677 GGGGCCTTCTGGCACAGTGATGG + Intronic
1129324402 15:74792578-74792600 GCGGGGGTCAGGCACAGAGAGGG - Intronic
1130680190 15:85989920-85989942 GGGTCGCTGTGTCACAGAGAAGG + Intergenic
1132466078 16:77991-78013 GGGGCGCCGGGGCACAGTGCGGG + Intronic
1132859684 16:2064024-2064046 AGGGCGGCCGGGCACAGACACGG - Intronic
1135694991 16:24577764-24577786 GGGGCGGGCGGGCACTGTGAGGG - Intergenic
1138263726 16:55644323-55644345 AGGGAGCTCGAGCAGAGAGATGG + Intergenic
1138266674 16:55664703-55664725 GGGGAGCTAAGGCTCAGAGAAGG + Intronic
1138267647 16:55671393-55671415 AGAGCTCTCGGGCAAAGAGATGG + Intronic
1138383077 16:56617199-56617221 GGAACGCTCGGGGACGGAGATGG + Intergenic
1139634449 16:68249448-68249470 TGGGGGCTGGGGCACACAGAGGG + Intronic
1141625602 16:85259527-85259549 GGGCAGCCAGGGCACAGAGAGGG + Intergenic
1142013878 16:87733396-87733418 AGGGCGCCCAGGCACAGAGGAGG + Intronic
1142108093 16:88317050-88317072 GTGGGGCTCTGGCAGAGAGAGGG + Intergenic
1142157542 16:88539499-88539521 GGGGCCCTCGTGCACAGTCAGGG - Intergenic
1142163363 16:88570708-88570730 GTGGCCCTCGGGCCCAGGGAAGG + Intronic
1203120222 16_KI270728v1_random:1529651-1529673 GGGGGGCTCAGGCACAGCGGGGG + Intergenic
1144286524 17:13780169-13780191 GGGCAGCTGAGGCACAGAGAAGG + Intergenic
1145940033 17:28738466-28738488 GGGACGCTAAGGCTCAGAGAGGG + Intronic
1147158452 17:38557357-38557379 AGGACACTGGGGCACAGAGAGGG + Intronic
1147646590 17:42038041-42038063 GGGGAGGAAGGGCACAGAGAAGG - Intronic
1148139184 17:45316610-45316632 GGGGCACTGGGGCGCAGAGCAGG + Intronic
1148153627 17:45410673-45410695 GGGGCGCGCTTGCACAGACAGGG + Intronic
1149868058 17:60161591-60161613 GGGGGGCTCGGGGTGAGAGAAGG - Intronic
1150854068 17:68733868-68733890 AGTGCACTCTGGCACAGAGAGGG + Intergenic
1151917115 17:77126604-77126626 GGCACACTCGGGCACACAGAGGG - Intronic
1152492997 17:80650426-80650448 GGGGCGCTCCCGCCCAGAAAGGG - Intronic
1153265133 18:3262279-3262301 GGGGCGCGGGGGTACGGAGACGG - Intronic
1156289230 18:35731039-35731061 GGTGCGCTTGTGCCCAGAGAAGG - Intergenic
1157139331 18:45089888-45089910 TGGGCCCTGGGGCACATAGAGGG + Intergenic
1159241698 18:65750804-65750826 GGAGCGCGCGGCCAGAGAGAGGG - Intronic
1160200752 18:76793218-76793240 GGGGAGATAGGGTACAGAGAGGG - Intergenic
1160770392 19:828414-828436 GGGGCATTGGGGCTCAGAGAAGG + Intronic
1161221410 19:3119843-3119865 GGGGCAGTAGGGCACAGAGGAGG - Intronic
1161399544 19:4061274-4061296 GGGGAGATCAGGCCCAGAGAGGG + Intronic
1161815103 19:6495079-6495101 GGGGCTCTAGGGTTCAGAGATGG + Exonic
1162901150 19:13796018-13796040 GGGGCGCTGAGGGGCAGAGATGG - Intronic
1163014622 19:14446697-14446719 GGGAAGCTCTGGCCCAGAGAGGG - Intronic
1163606967 19:18280962-18280984 GGGGCCCTCGGGCACGGCCACGG - Exonic
1165801240 19:38551819-38551841 GGAGGGCTCAGGCACAGTGAAGG - Intronic
1167041838 19:47027330-47027352 GGGGACCTGGGGCAGAGAGAGGG - Intronic
1167041847 19:47027352-47027374 GGGGACCTGGGGCAGAGAGAGGG - Intronic
1167511773 19:49898966-49898988 AGGACCCTGGGGCACAGAGAGGG + Intronic
926063498 2:9819741-9819763 GGGTGGCTGGGGCACAGAGCTGG + Intergenic
926298058 2:11582532-11582554 GGGGCCCTCCTGCACAGAGCAGG - Intronic
927213156 2:20650966-20650988 GGGGCGCCCGGGCGGAGAGGCGG - Intronic
927427673 2:22998945-22998967 GGGTGGCTGGGGCAGAGAGAAGG - Intergenic
927475641 2:23412399-23412421 TGGGCACTGGGGGACAGAGAAGG + Intronic
928689258 2:33782277-33782299 GGGGTGCTGGGGCAGGGAGAGGG - Intergenic
930699363 2:54444116-54444138 GGGACTCTGAGGCACAGAGAGGG - Intergenic
931358808 2:61560197-61560219 GGGAGGCTGGGCCACAGAGAGGG - Intergenic
932430166 2:71669281-71669303 GGGGGGCTCTGGCTCAGGGAAGG + Intronic
932599157 2:73112316-73112338 GGGGCGCGGGGGCACAGAAACGG - Intronic
936068074 2:109347330-109347352 GGGACACTGAGGCACAGAGAGGG - Intronic
937258104 2:120568898-120568920 CAGGCTCTGGGGCACAGAGAAGG - Intergenic
937298563 2:120824488-120824510 CGAGCGCTGGGGCTCAGAGATGG + Intronic
937631896 2:124110902-124110924 GGGGAGCTGAGGCACAGAGCAGG + Intronic
942367620 2:175244326-175244348 GGGCCCCTGGGGCACAGACAGGG - Intergenic
943658639 2:190534721-190534743 GTGGCGCGGGGGCTCAGAGAAGG + Exonic
945973601 2:216253809-216253831 GGGGCCCTCTCCCACAGAGAGGG - Intergenic
946196643 2:218036095-218036117 GGGAACCTGGGGCACAGAGAGGG - Intronic
946249961 2:218405883-218405905 AGGGCTCTCAGTCACAGAGAAGG - Exonic
946432443 2:219632846-219632868 GGGACAGTCAGGCACAGAGAGGG - Intronic
948601767 2:239111548-239111570 GGGGGGCTCCTGCACAGACACGG + Exonic
948830639 2:240596833-240596855 AGGGCCCTCGGGGACCGAGAAGG - Exonic
948838545 2:240637762-240637784 GGGGCTCCAAGGCACAGAGAGGG + Intergenic
948896715 2:240931090-240931112 GGGCCGCTGGGACGCAGAGAAGG + Exonic
949044188 2:241863441-241863463 TGGGCGCTCTGGCCCACAGAGGG - Intergenic
1168965254 20:1894775-1894797 CGGGCGCTCGCTCGCAGAGAAGG + Intronic
1169557858 20:6768642-6768664 GGGGCGGTGGGGCTCGGAGATGG - Exonic
1171013430 20:21521125-21521147 TGGGCCCTCGGGCACAGAGAGGG + Intergenic
1171034649 20:21705570-21705592 GGGGCGCTGGGGCGCAGTGACGG + Intergenic
1171217404 20:23362286-23362308 GGGGCGCGCGGACAAAGAGGCGG - Intronic
1172305639 20:33878334-33878356 GTGGCGCTAGGGAACAGAGAAGG + Intergenic
1172610942 20:36252084-36252106 GGGAGGCTCGGGCACAGTGCTGG + Intronic
1173013216 20:39201130-39201152 GAAGCTCTCAGGCACAGAGATGG + Intergenic
1174528974 20:51195986-51196008 AGGTCACTGGGGCACAGAGAAGG + Intergenic
1175446580 20:59024275-59024297 GGTGAGCTCGGCCACGGAGAGGG - Exonic
1175687215 20:61040379-61040401 GGGACTCCAGGGCACAGAGAGGG + Intergenic
1175795400 20:61767499-61767521 GAGGCGCCCAGGCAGAGAGAGGG + Intronic
1175890534 20:62313959-62313981 GTGGCGAGTGGGCACAGAGACGG + Intronic
1176072451 20:63234278-63234300 TGGGCGCTGGAGGACAGAGAGGG + Intergenic
1176424534 21:6539996-6540018 CGGGCCCTGGGACACAGAGAGGG - Intergenic
1178301390 21:31456314-31456336 GGGACACTGTGGCACAGAGAGGG + Intronic
1179553960 21:42160659-42160681 GGGTCGCTCGGGAGCAGAGATGG + Intergenic
1179700027 21:43148311-43148333 CGGGCCCTGGGACACAGAGAGGG - Intergenic
1181925583 22:26355984-26356006 GGGGCTCTGAGGCCCAGAGAGGG - Intronic
1182450593 22:30418241-30418263 GGGAAGCTGGGGCATAGAGAAGG + Intronic
1184192613 22:42904842-42904864 GGGGTGCCCAGGCACAGAGATGG - Intronic
1184757255 22:46524047-46524069 GAGGCCCTGGGGCACAGAGCTGG - Intronic
949511102 3:4767901-4767923 AGGGGACTGGGGCACAGAGATGG + Intronic
950530340 3:13549277-13549299 GGGGCGCTCGGACGCACCGACGG + Intronic
950668474 3:14511387-14511409 GGGGCACTGGGGCACAGGAAGGG - Intronic
952656060 3:35786746-35786768 GGGGTCCTCGGGCACAAGGAAGG - Intronic
954424186 3:50434694-50434716 GGGGCCCTGAGGCCCAGAGAAGG - Intronic
954519905 3:51215609-51215631 GGGTAGCTTGGGCATAGAGAAGG + Intronic
955985363 3:64568242-64568264 GGGGAGCTCGGGGACTGGGAGGG - Intronic
960955171 3:123026649-123026671 GGGGCGCTCGGGCACAGAGAGGG - Intronic
961381363 3:126498330-126498352 GGGGCACTGGGACACAGAGAGGG - Intronic
966378771 3:179323115-179323137 GGGGCGCGCGGGGAGGGAGAGGG + Intronic
969616476 4:8255846-8255868 GGGGCACGGGGCCACAGAGAAGG + Intergenic
978532487 4:109729574-109729596 GGGGCACCCGGGCCCAGCGAGGG - Intronic
982653463 4:158117251-158117273 GTCCCGCTCAGGCACAGAGATGG + Intergenic
987292747 5:16523965-16523987 GGGGCGCTGAGGCAGAGAGGTGG - Intronic
992088514 5:73298523-73298545 GGGGTGCTGGGGGACGGAGAAGG + Intergenic
994716199 5:103324232-103324254 GGGGTACTGGGGCACAGAGTTGG - Intergenic
997297072 5:132775133-132775155 GGGTGGCCAGGGCACAGAGAGGG - Intronic
998104111 5:139457435-139457457 GGGGCGAGCGGGAACAGACAAGG - Intronic
1001397607 5:171428308-171428330 CAGGGGCTGGGGCACAGAGAGGG + Intronic
1002044037 5:176532231-176532253 GGGCCACTCGTGCACAGAGCAGG + Intronic
1002092419 5:176813122-176813144 TGCGTGCGCGGGCACAGAGAGGG - Intronic
1002423724 5:179163929-179163951 GGGGTGCATGGGCACAGGGAGGG + Intronic
1006073786 6:31516274-31516296 TGGGTGCTGGGGCAGAGAGAGGG - Intergenic
1009192336 6:60644282-60644304 GAGGCCCTCAGGCACAGAGAAGG + Intergenic
1018396166 6:163379606-163379628 GGGAAGCTGGGCCACAGAGAGGG - Intergenic
1018875113 6:167815661-167815683 GGGGCGCTGGGTCCCACAGAGGG - Intergenic
1019795127 7:3043462-3043484 GGGGGGCAGGGGGACAGAGATGG + Intronic
1023566075 7:41524913-41524935 GTGGCACTGGAGCACAGAGATGG - Intergenic
1026979245 7:74516927-74516949 GGGGCTCGGGGGCACAGAGGAGG - Intronic
1029592995 7:101519668-101519690 GGGTGGCTGAGGCACAGAGAGGG - Intronic
1034692754 7:153027137-153027159 GGGACGCCCGGGCATAGAGCAGG - Intergenic
1035079568 7:156204709-156204731 GGAGGGCTCAGGCACTGAGATGG - Intergenic
1035455718 7:159007394-159007416 GGGGAGGGCGGGCGCAGAGACGG + Intergenic
1035472768 7:159120726-159120748 GGTGCGGTGGGACACAGAGATGG - Intronic
1038205017 8:25458052-25458074 GGGGCGCTCGGGGACAGCACAGG - Intronic
1039465274 8:37780921-37780943 GGGGCACTGGGGCCCAGAGAAGG + Intergenic
1040423377 8:47260853-47260875 CGGGCGCTCGGGCGCAGGGCGGG - Exonic
1040602162 8:48896212-48896234 CGGGGGCAGGGGCACAGAGAGGG + Intergenic
1043392845 8:79808241-79808263 AGGAGGCTGGGGCACAGAGAGGG + Intergenic
1045976008 8:108131351-108131373 GGGGCGCGCGCACACCGAGAAGG - Intergenic
1047204508 8:122792667-122792689 GGGGAACTGAGGCACAGAGAAGG + Intronic
1055596186 9:77867127-77867149 GGGATGCTCAGGCAAAGAGATGG - Intronic
1058058656 9:100473636-100473658 GCGGCTCCCGGGCAGAGAGAAGG - Exonic
1060554967 9:124503511-124503533 GCAGCGCCTGGGCACAGAGAGGG - Intronic
1060662158 9:125410875-125410897 GGCGAGCGCGGGCACAGCGAGGG + Intergenic
1062544177 9:137054255-137054277 GGGGCGCCCGGGCTCAGACCCGG - Intergenic
1196900534 X:120378631-120378653 GGGGTGCTGGGTCACAGAGTGGG - Intronic
1200233920 X:154459212-154459234 CGGGAGCTCTGGCACTGAGAGGG + Intronic