ID: 960955432

View in Genome Browser
Species Human (GRCh38)
Location 3:123027625-123027647
Sequence GGGCCCGCGCCCGCTGCGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960955423_960955432 10 Left 960955423 3:123027592-123027614 CCAGCTCTCAGCGCTCCGGTGCA 0: 1
1: 0
2: 1
3: 9
4: 111
Right 960955432 3:123027625-123027647 GGGCCCGCGCCCGCTGCGCTCGG 0: 1
1: 0
2: 1
3: 17
4: 163
960955420_960955432 27 Left 960955420 3:123027575-123027597 CCGCGCAGGAACGGCCTCCAGCT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 960955432 3:123027625-123027647 GGGCCCGCGCCCGCTGCGCTCGG 0: 1
1: 0
2: 1
3: 17
4: 163
960955426_960955432 -5 Left 960955426 3:123027607-123027629 CCGGTGCAGTCCCCACCCGGGCC 0: 1
1: 0
2: 4
3: 23
4: 317
Right 960955432 3:123027625-123027647 GGGCCCGCGCCCGCTGCGCTCGG 0: 1
1: 0
2: 1
3: 17
4: 163
960955422_960955432 13 Left 960955422 3:123027589-123027611 CCTCCAGCTCTCAGCGCTCCGGT 0: 1
1: 0
2: 1
3: 13
4: 149
Right 960955432 3:123027625-123027647 GGGCCCGCGCCCGCTGCGCTCGG 0: 1
1: 0
2: 1
3: 17
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960955432 Original CRISPR GGGCCCGCGCCCGCTGCGCT CGG Intronic
900124866 1:1064821-1064843 GGGCCCGGGGCAGCTGCCCTCGG + Intergenic
900367671 1:2317877-2317899 CGGCCCGCGCCCTCAGCGCAGGG + Intergenic
901930731 1:12595178-12595200 GGGCTCACCCCCGCTGCGCTAGG - Intronic
902290164 1:15430123-15430145 GGGTCCGAGGCTGCTGCGCTGGG - Exonic
903724586 1:25431193-25431215 GGGCCCGCGCCCGCGGAGTGGGG - Intronic
903750426 1:25617528-25617550 GGGCCCGGGCCCGCAGCGACCGG - Exonic
904618852 1:31763824-31763846 GGGACCGCGCCGGCAGGGCTCGG + Intronic
904782991 1:32964539-32964561 CGGCCCGCGGCCGCCGCGCCCGG - Exonic
905639145 1:39576583-39576605 GCGCCCGCCGCCGCAGCGCTTGG - Intronic
910277587 1:85465214-85465236 GGGCCGGCGCCCGGAGCTCTGGG - Intronic
912787693 1:112619932-112619954 GGGCCCGGCCCGGCTGCGTTGGG + Intronic
917345119 1:174021919-174021941 GGGCCCCCGCCGGCTGTTCTGGG - Intronic
919892006 1:201982590-201982612 GGGGGCGGGCCCGCGGCGCTCGG + Intronic
920071352 1:203305398-203305420 GGGCCCGGAGCCGCTCCGCTCGG - Intergenic
920886856 1:209938080-209938102 CGGCCCGCACTCGCGGCGCTCGG + Intergenic
921909058 1:220528189-220528211 CGGCCCGAGCCGGCTGCGCGCGG - Intronic
1064022775 10:11823231-11823253 GGGCCGGGCCCCGCCGCGCTGGG - Intergenic
1065093170 10:22253717-22253739 GAGGGCGCGGCCGCTGCGCTTGG - Intergenic
1067471858 10:46543444-46543466 GGTCCTGCACCCGCTGCCCTGGG - Intergenic
1071617968 10:87094208-87094230 CGGCCCGCTCCAGCTGGGCTGGG + Intronic
1071618105 10:87094711-87094733 CGGGCCGGGCCCGCTGCCCTGGG - Exonic
1073122530 10:101131490-101131512 GCGGCGGCGCTCGCTGCGCTCGG - Exonic
1075263082 10:120979738-120979760 GGGACCGCGCCGGCTGCACCCGG - Intergenic
1075798050 10:125135062-125135084 GCGCCCCCACTCGCTGCGCTGGG + Intronic
1076683062 10:132185242-132185264 GGGCCCGAGCCAGCAGAGCTAGG - Intergenic
1076729378 10:132430895-132430917 GGGGCCACGCGGGCTGCGCTTGG + Intergenic
1077037974 11:504395-504417 CCGCCCGCGCCCGCTCCGCCCGG + Intronic
1077172614 11:1174708-1174730 GGGCCCCCGTCCTCTGTGCTGGG + Intronic
1077517278 11:3009609-3009631 GGGCCAGGGCCCTCTGCACTGGG - Intronic
1083657041 11:64234719-64234741 CGGCCCCCGCCCGCCGCGCCCGG + Exonic
1084225354 11:67711757-67711779 GGCCCCGAGCCCGCTGGACTCGG - Intergenic
1084263171 11:67991604-67991626 GGCCCCGAGCCCGCTGGACTCGG - Exonic
1085519523 11:77129958-77129980 GGGCCCGGGCCCGCCCCGCTAGG - Intronic
1090626983 11:128616348-128616370 GGAACTGGGCCCGCTGCGCTGGG - Intergenic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1096491483 12:52015290-52015312 GGACCCTCTCCCGCTGCTCTGGG - Exonic
1100540000 12:95548734-95548756 GGGCGCGCGGCCGCGGCGATTGG - Intronic
1103060579 12:117855367-117855389 GGGACCGCGGCAGCTGTGCTGGG + Intronic
1103433051 12:120904204-120904226 GGGCCCGCGCTCACTGCGCGCGG + Exonic
1104713774 12:131003829-131003851 TTGCCCTCGCCTGCTGCGCTTGG + Intronic
1104929227 12:132329437-132329459 GGGGCCGCGCCCTCTGAGCGGGG - Intergenic
1108228774 13:48317372-48317394 GAACCCGTGCGCGCTGCGCTCGG - Intronic
1112012120 13:95301319-95301341 CGGCCCGCGCCCGCCCCGCCCGG - Exonic
1113507245 13:110825739-110825761 GGGCCAGCGCCTGCTGCTCAGGG - Intergenic
1113962357 13:114132868-114132890 CGGCCCGGGCCCGCTGAGCGAGG + Intergenic
1118849228 14:69571942-69571964 GGGCCCGCTCCCGCAGCTCCCGG + Exonic
1122982204 14:105196912-105196934 GGGGCCGTGCCCGCCCCGCTGGG + Intergenic
1129440605 15:75578685-75578707 GGGCCCGAGGCCGCCGCGTTGGG - Intronic
1129524279 15:76204115-76204137 TGGGCCGAGCCCGCTGGGCTGGG - Exonic
1130656418 15:85794695-85794717 GCGCCCCCGCTCCCTGCGCTGGG - Intronic
1131095001 15:89649203-89649225 GGGCGCGCCCCCGCTGCTCCAGG + Exonic
1131977500 15:97961011-97961033 GGCCCTGCGCGCGCTGCGCCTGG + Exonic
1132252076 15:100341687-100341709 CGGCCCGCGCCTCCTCCGCTCGG + Intronic
1132558616 16:583552-583574 GGGCCCGGGCCCGCTGGGGACGG - Exonic
1132560307 16:590468-590490 GGGCCCGAGCCCGGCGAGCTGGG + Intronic
1133097685 16:3458321-3458343 GCGCCCGCGCCCCCGGCGCACGG + Intronic
1133240522 16:4411766-4411788 GGGCCCGCGGCCGCTGCAGCTGG + Intronic
1136003664 16:27314144-27314166 GGGCCCGAGCCCGCGACTCTCGG + Intronic
1136007656 16:27341985-27342007 GGGCCAGCGCCCACAGAGCTGGG - Intronic
1137268084 16:46884831-46884853 GCGCTCGCGCCGGCTGCGCTCGG - Exonic
1137787446 16:51150754-51150776 GGGCCGGCGCCGGGAGCGCTAGG + Intronic
1139882745 16:70188322-70188344 GGGGCCGCGGCCGCAGCGCCCGG + Intergenic
1140369765 16:74407197-74407219 GGGGCCGCGGCCGCAGCGCCCGG - Intergenic
1141694209 16:85612216-85612238 GGGGACGCGCCCGCCGCGATGGG + Intronic
1143150825 17:4807025-4807047 TGTCCCGCCCCCGCTGCCCTCGG - Intergenic
1143548616 17:7614909-7614931 GGGCACCCGCCCGCTGCGCGCGG + Intronic
1144656810 17:17042369-17042391 GGGGCCGCGCCCGACGCGATCGG - Intergenic
1144763837 17:17722465-17722487 GGGCCCGCGCCACCTCCGCCAGG + Intronic
1144831426 17:18133413-18133435 GGGCCCGCACCCTCTGGACTTGG + Intronic
1144851258 17:18245215-18245237 GCGGCCGCGCCGGCTGCGCCTGG - Exonic
1145969664 17:28949697-28949719 GCCCGCGCGCCCGCTGCCCTCGG - Intronic
1148332886 17:46822486-46822508 GGGGGCGCGCCCGCGCCGCTGGG - Intronic
1148341319 17:46875158-46875180 TGGCCCGGGCCTGCAGCGCTGGG + Exonic
1148397749 17:47323876-47323898 GGTCCTGGGCCCGCTCCGCTCGG + Intronic
1152571359 17:81122641-81122663 GGGCCCGGGCCCGGTGCGGCGGG - Exonic
1152809546 17:82375080-82375102 GGGGGCGCGCGCGCTGCGCCTGG + Exonic
1153219161 18:2847165-2847187 CGGGGCGCGCCCGCTGCGCGCGG + Exonic
1153688231 18:7567338-7567360 GAGCCCGCGCCGGCTGCGCGCGG - Exonic
1153900734 18:9614821-9614843 GCGCCCCCGTCCGCAGCGCTCGG - Intronic
1157362829 18:47034696-47034718 GGCCCTGAGCCCGCTGCGCCCGG - Exonic
1160045014 18:75378757-75378779 GGGCCCCCACCCTCTGAGCTCGG - Intergenic
1160454765 18:78992733-78992755 GGGGCCGGGCCCGGTGCGCTCGG - Exonic
1160779720 19:872425-872447 GGGCCCGGGCCCGCAGCTGTAGG - Intronic
1160991863 19:1863388-1863410 GGGCCCGCGCCCTCGGGGCCGGG + Exonic
1161063761 19:2227825-2227847 GGGCCCGAGCCCGCTGCAGGCGG + Intronic
1161080626 19:2308245-2308267 GGGCGCGCGGGGGCTGCGCTGGG + Intronic
1161346122 19:3769657-3769679 GGGCCCCCTCCTGCTGCACTGGG + Exonic
1161401264 19:4067040-4067062 GGGGCTTCGCCCGCTGCGCCGGG + Intergenic
1162374194 19:10295445-10295467 GGGCGCGCGCCAGCTGATCTGGG - Exonic
1163708632 19:18832393-18832415 GCGCCCGCGCCCGCGCCGCCCGG - Exonic
1164615623 19:29665433-29665455 GGGTCCCCGCCCGCTCCGCCCGG - Exonic
1166094449 19:40530440-40530462 GGGCGCGCGGCCGCCGCGCGGGG + Intronic
1166222843 19:41376716-41376738 CGCCCCGGGCCCGCTGCGCGCGG - Exonic
1167049722 19:47070992-47071014 GCGCCCCCACCCGCTGCCCTCGG + Intronic
1167072771 19:47230534-47230556 GGGCGCGCGCCCGCTGGGGGCGG - Intronic
926320347 2:11744949-11744971 GGACACGCTCCCGCTGGGCTTGG - Intronic
927717661 2:25362972-25362994 GGGCCCACTCCAGCTGCCCTAGG - Intergenic
932625563 2:73293344-73293366 GGGGCCTCGCCCGCTGGGCTTGG + Exonic
932901929 2:75710928-75710950 GGGCGCGCTCCCGCCGCGCCTGG + Exonic
938072890 2:128317734-128317756 GGGTCCCCGCCCGCTGCCCTCGG - Intronic
940971973 2:159904797-159904819 GGCCCCGCCCCCGCCGCCCTCGG + Intergenic
948402306 2:237692648-237692670 GCGCCCGCTCCCACCGCGCTGGG - Intronic
948499785 2:238383304-238383326 GGGCCCGGGCCCACTGCCCTTGG - Intronic
949032532 2:241803863-241803885 GGGGCCGCGGCGGCTGCGCGGGG + Exonic
1168892857 20:1306022-1306044 GAGCCGCCGCCCGCTGGGCTGGG - Exonic
1169266851 20:4172274-4172296 GGGGCCGCGCCAGCTGCGACGGG - Intronic
1171011997 20:21513946-21513968 AGGCCGGGGCCCGCGGCGCTCGG - Exonic
1172876145 20:38165376-38165398 GGGCCCACGCCGCCAGCGCTGGG + Intronic
1175429197 20:58890644-58890666 GCGCCCGCGGCCTCTGCGCTTGG - Intronic
1179522310 21:41953531-41953553 TGGCCAGCGCCCACTGCGCCAGG + Exonic
1181160466 22:20957137-20957159 GGGCCCGCGGCCACGGCGTTTGG + Intergenic
1182705205 22:32272672-32272694 GGGCATGTGCCTGCTGCGCTGGG + Intergenic
1183489993 22:38111050-38111072 GGGGCCACGCCCTCTGAGCTTGG + Intergenic
1183525014 22:38317525-38317547 GGGCCCGCGCCCTCCGCGCTGGG + Intronic
1183545893 22:38454829-38454851 GGGACCGCGCGCGCGGCGCCGGG + Intronic
1184557256 22:45240223-45240245 GGGCCCGACCCTGCCGCGCTGGG + Intronic
1184644444 22:45888659-45888681 GAGCCCACGCCCCCTGCCCTCGG + Intergenic
1185278594 22:49960575-49960597 GGCCCCGCGCCCGCCGCACCCGG + Exonic
950038156 3:9902195-9902217 GGGCCCGCTCCCTCTGCTCCAGG + Intergenic
953485122 3:43287061-43287083 GGCCCCGCGCCCTGGGCGCTTGG + Intronic
954583631 3:51716932-51716954 GGGCCAGGGACCGCTGGGCTTGG + Intronic
955291059 3:57692853-57692875 TGGCCGGGGCCTGCTGCGCTGGG - Exonic
955916387 3:63912316-63912338 CGGCCCGCCACCGCGGCGCTGGG - Intronic
957078609 3:75619540-75619562 GGCCCCGAGCCCGCTGGACTCGG - Intergenic
960955432 3:123027625-123027647 GGGCCCGCGCCCGCTGCGCTCGG + Intronic
961665024 3:128489279-128489301 GGGGGCGCGCCCGCGGAGCTGGG - Intronic
968051560 3:195658263-195658285 GTGCCCGCGCCCCCTGCCCGGGG + Intergenic
968104261 3:195990090-195990112 GACCCGGCGCCCGCTCCGCTCGG + Intergenic
968230445 3:197002459-197002481 GGCCCCGCACCCGCTGGGCCTGG - Exonic
968302562 3:197627680-197627702 GACCCGGCGCCCGCTCCGCTCGG + Intergenic
968479098 4:826012-826034 GGCCGGGCGCGCGCTGCGCTCGG + Intronic
968511358 4:997299-997321 GAGGCCGGGCCCGCTGGGCTGGG - Intronic
968571932 4:1346678-1346700 GGGCCCGCGCCCGCCCGTCTGGG + Intergenic
969021692 4:4143514-4143536 GGCCCCGAGCCCGCTGGACTCGG - Intergenic
969732175 4:8963901-8963923 GGCCCCGAGCCCGCTGGACTCGG + Intergenic
973686784 4:53378058-53378080 GGGCACGCGCACGCCGCGCTCGG - Intronic
975883588 4:78939316-78939338 GAGCCCGCGGACGCTGCGCGAGG + Exonic
982082984 4:151808180-151808202 GGGCAGGCTCCCGCTGCCCTGGG - Intergenic
983296480 4:165874104-165874126 GCGCCGGGGGCCGCTGCGCTGGG + Intronic
985111899 4:186555156-186555178 GGGCCCGCGCCGCCTCCCCTGGG - Intronic
985497624 5:218496-218518 GACCCGGCGCCCGCTCCGCTCGG - Intronic
985566107 5:618531-618553 GGGCCTGGGGCCACTGCGCTGGG + Intronic
987108547 5:14664240-14664262 AGGCCCAAGCCCGCTGGGCTCGG + Intergenic
992627430 5:78648460-78648482 GGGCCCGCGCGCGCTGCGGGAGG - Intronic
997402169 5:133611866-133611888 CGGCCCGGGCCCGGTGCCCTTGG - Intronic
1001250663 5:170144421-170144443 GGGCCCGCACCCTCTGCATTCGG + Intergenic
1001639507 5:173234890-173234912 GGGCCCGAGGCGGCTGCGCCGGG - Exonic
1002046242 5:176543214-176543236 GGCCCTGCGCCCGGGGCGCTCGG + Intronic
1002091751 5:176810373-176810395 TGGCCCGCGCGCGCTGCGCGGGG + Intergenic
1007769737 6:44183264-44183286 GGGCCCGCGGCCCCTGGCCTAGG - Intronic
1013117798 6:107115526-107115548 GGGCCCGCGCTGGCTGCCCGGGG + Intergenic
1017146598 6:151240636-151240658 GGGGCCGCCGCCGCTGGGCTCGG - Exonic
1019472682 7:1229792-1229814 GGGCCCCAGCCCTGTGCGCTCGG + Intergenic
1020225012 7:6272754-6272776 GGGCCGGCGGCGTCTGCGCTGGG + Intergenic
1020274245 7:6615359-6615381 GGCACAGCGCGCGCTGCGCTCGG + Intergenic
1020309106 7:6855544-6855566 GGCCCCGAGCCCGCTGGACTCGG - Intergenic
1021231008 7:18086597-18086619 GGGCGCGCGGCCGACGCGCTGGG - Intergenic
1023838677 7:44082959-44082981 GTGCCCGATCCCTCTGCGCTCGG + Intergenic
1024520940 7:50304023-50304045 GGGCCCGGGCGCGGTGCGCGCGG + Intergenic
1026807094 7:73435457-73435479 GGCCCCGCGGCCGCTGCGCATGG - Exonic
1033253096 7:139777510-139777532 GGCCCCGCGCCCGCAGCCCCCGG - Intronic
1034219271 7:149431686-149431708 CCGCCCCCGCCCGCTGGGCTCGG + Exonic
1034435064 7:151059560-151059582 GGGACCGCGCACGGTGCGCCGGG + Intronic
1035336684 7:158133821-158133843 GAGCCCGGGGCCGCTGCGTTTGG - Exonic
1036768737 8:11564756-11564778 GGGCCCGCGCCGGGAGCTCTGGG + Intergenic
1038566198 8:28622302-28622324 CGACCGGCGCCCTCTGCGCTAGG + Intronic
1042246397 8:66712792-66712814 GGCTCCGCGCCCGCCGCGCCGGG + Intronic
1048553977 8:135457618-135457640 CGGCCCGCGCCCGGAGCGCGGGG + Exonic
1050377188 9:4985325-4985347 GGGCCGGCGCCCGGCTCGCTTGG + Exonic
1050898230 9:10910915-10910937 GAGCCCGCTCCCTCTGCTCTTGG + Intergenic
1051629259 9:19127373-19127395 GGGCCCGGGACCGGTTCGCTGGG + Intronic
1057488562 9:95505898-95505920 GCGGCCGCGGCCGCCGCGCTGGG - Intronic
1057546259 9:96021885-96021907 GGCCCCGCAGCCGCTGCGCTCGG - Intergenic
1058058588 9:100473362-100473384 AGGCCCGGGCCCGCGGCGCTCGG - Exonic
1060176306 9:121499675-121499697 GGGCCGGCGCGCGGTGAGCTGGG + Intergenic
1062022614 9:134326549-134326571 GGGCCCGGGCCGGCCGCGCCGGG + Intronic
1062517495 9:136943828-136943850 GGGCCCCGGGCCCCTGCGCTTGG - Intronic
1185471696 X:387415-387437 GGGTGCGCGCCCGCCGAGCTCGG + Intergenic
1185747532 X:2584419-2584441 GGCCCGGCGGCCGCTGGGCTGGG + Intergenic
1188811402 X:34657290-34657312 GCGCCCGCGCCCGCTCCTCCCGG + Intergenic
1196965200 X:121047721-121047743 CGGGCCGGGCCCGCTGCCCTGGG + Exonic
1201290829 Y:12420334-12420356 GGGTCCGCGCCCACTGCGTGCGG - Intergenic