ID: 960955461

View in Genome Browser
Species Human (GRCh38)
Location 3:123027734-123027756
Sequence CTCTCTCCGAGCGCCGGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 69}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960955461_960955469 -3 Left 960955461 3:123027734-123027756 CCCGACCCGGCGCTCGGAGAGAG 0: 1
1: 0
2: 0
3: 1
4: 69
Right 960955469 3:123027754-123027776 GAGCAGGGAGGAGGAGACCGCGG 0: 1
1: 0
2: 9
3: 112
4: 980
960955461_960955473 11 Left 960955461 3:123027734-123027756 CCCGACCCGGCGCTCGGAGAGAG 0: 1
1: 0
2: 0
3: 1
4: 69
Right 960955473 3:123027768-123027790 AGACCGCGGGAGCAGAAGGAGGG 0: 1
1: 0
2: 0
3: 14
4: 182
960955461_960955479 20 Left 960955461 3:123027734-123027756 CCCGACCCGGCGCTCGGAGAGAG 0: 1
1: 0
2: 0
3: 1
4: 69
Right 960955479 3:123027777-123027799 GAGCAGAAGGAGGGAGGGGGCGG 0: 1
1: 0
2: 44
3: 490
4: 3192
960955461_960955476 15 Left 960955461 3:123027734-123027756 CCCGACCCGGCGCTCGGAGAGAG 0: 1
1: 0
2: 0
3: 1
4: 69
Right 960955476 3:123027772-123027794 CGCGGGAGCAGAAGGAGGGAGGG 0: 1
1: 0
2: 0
3: 42
4: 728
960955461_960955482 25 Left 960955461 3:123027734-123027756 CCCGACCCGGCGCTCGGAGAGAG 0: 1
1: 0
2: 0
3: 1
4: 69
Right 960955482 3:123027782-123027804 GAAGGAGGGAGGGGGCGGTGGGG 0: 1
1: 0
2: 14
3: 294
4: 2312
960955461_960955484 29 Left 960955461 3:123027734-123027756 CCCGACCCGGCGCTCGGAGAGAG 0: 1
1: 0
2: 0
3: 1
4: 69
Right 960955484 3:123027786-123027808 GAGGGAGGGGGCGGTGGGGGAGG 0: 1
1: 4
2: 61
3: 839
4: 6905
960955461_960955472 10 Left 960955461 3:123027734-123027756 CCCGACCCGGCGCTCGGAGAGAG 0: 1
1: 0
2: 0
3: 1
4: 69
Right 960955472 3:123027767-123027789 GAGACCGCGGGAGCAGAAGGAGG 0: 1
1: 0
2: 0
3: 30
4: 266
960955461_960955478 17 Left 960955461 3:123027734-123027756 CCCGACCCGGCGCTCGGAGAGAG 0: 1
1: 0
2: 0
3: 1
4: 69
Right 960955478 3:123027774-123027796 CGGGAGCAGAAGGAGGGAGGGGG 0: 1
1: 0
2: 17
3: 198
4: 1639
960955461_960955483 26 Left 960955461 3:123027734-123027756 CCCGACCCGGCGCTCGGAGAGAG 0: 1
1: 0
2: 0
3: 1
4: 69
Right 960955483 3:123027783-123027805 AAGGAGGGAGGGGGCGGTGGGGG 0: 1
1: 1
2: 20
3: 297
4: 3312
960955461_960955475 14 Left 960955461 3:123027734-123027756 CCCGACCCGGCGCTCGGAGAGAG 0: 1
1: 0
2: 0
3: 1
4: 69
Right 960955475 3:123027771-123027793 CCGCGGGAGCAGAAGGAGGGAGG 0: 1
1: 0
2: 3
3: 21
4: 364
960955461_960955477 16 Left 960955461 3:123027734-123027756 CCCGACCCGGCGCTCGGAGAGAG 0: 1
1: 0
2: 0
3: 1
4: 69
Right 960955477 3:123027773-123027795 GCGGGAGCAGAAGGAGGGAGGGG 0: 1
1: 0
2: 21
3: 258
4: 3357
960955461_960955481 24 Left 960955461 3:123027734-123027756 CCCGACCCGGCGCTCGGAGAGAG 0: 1
1: 0
2: 0
3: 1
4: 69
Right 960955481 3:123027781-123027803 AGAAGGAGGGAGGGGGCGGTGGG 0: 1
1: 0
2: 12
3: 166
4: 1652
960955461_960955480 23 Left 960955461 3:123027734-123027756 CCCGACCCGGCGCTCGGAGAGAG 0: 1
1: 0
2: 0
3: 1
4: 69
Right 960955480 3:123027780-123027802 CAGAAGGAGGGAGGGGGCGGTGG 0: 1
1: 0
2: 19
3: 268
4: 2410
960955461_960955470 -2 Left 960955461 3:123027734-123027756 CCCGACCCGGCGCTCGGAGAGAG 0: 1
1: 0
2: 0
3: 1
4: 69
Right 960955470 3:123027755-123027777 AGCAGGGAGGAGGAGACCGCGGG 0: 1
1: 0
2: 3
3: 48
4: 520
960955461_960955471 7 Left 960955461 3:123027734-123027756 CCCGACCCGGCGCTCGGAGAGAG 0: 1
1: 0
2: 0
3: 1
4: 69
Right 960955471 3:123027764-123027786 GAGGAGACCGCGGGAGCAGAAGG 0: 1
1: 0
2: 1
3: 25
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960955461 Original CRISPR CTCTCTCCGAGCGCCGGGTC GGG (reversed) Intronic
902405772 1:16182545-16182567 CACTCACTGAGCGCCGGCTCTGG - Intergenic
905027360 1:34859801-34859823 CTCTCTCGGAGCGCAGGGATTGG + Exonic
905040045 1:34948183-34948205 CTCTGCCCGACCGCCGCGTCTGG + Intergenic
907081803 1:51630272-51630294 GTCTCTCCCGGCGCTGGGTCAGG + Intronic
914004150 1:143717827-143717849 CTCTCGCGGAGAGCAGGGTCTGG + Intergenic
914845612 1:151282242-151282264 CTCCCTCCGCGCTCCAGGTCTGG - Intronic
915393059 1:155562043-155562065 CTCTCTCAGAGATCCAGGTCCGG + Intronic
919029930 1:192228194-192228216 ATCTCTCCGGGGGCCGGGTGCGG - Intergenic
920674603 1:208030396-208030418 CCCTCTCCCAGCGCTGGGCCGGG + Intronic
922290976 1:224208566-224208588 CTCTCTCCTAGGGCCTGGACGGG - Intergenic
923108021 1:230868845-230868867 CCCTCTCAGAGCGCCGGGCGCGG - Intronic
1075736810 10:124669388-124669410 CTCTCTCTGAGCCCCGTGCCCGG + Intronic
1076058236 10:127392744-127392766 CCCACCCCCAGCGCCGGGTCGGG + Intronic
1076818118 10:132924533-132924555 CTCTGTCCCAGCTCCGGGCCAGG - Intronic
1083595411 11:63916518-63916540 CTCGCTCCGAGTGCCGAGCCCGG + Exonic
1084122580 11:67078052-67078074 GCCTCTCCCAGTGCCGGGTCTGG - Intergenic
1084169111 11:67391984-67392006 CTCTCCGCGACCTCCGGGTCCGG - Exonic
1092114047 12:5985766-5985788 CTCTGTCAGAGGGCTGGGTCAGG - Intronic
1092644187 12:10551468-10551490 CTCCCTCCGAGCCACGGGGCAGG - Intergenic
1104815740 12:131644537-131644559 CTCTCTCCCAGAGGCTGGTCTGG - Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1112394251 13:99014050-99014072 CTCTGTCAGAGCTCTGGGTCTGG - Intronic
1119921322 14:78448991-78449013 CTCTCTCCGCGCCCAGGGTGGGG - Intronic
1120953290 14:90061454-90061476 CTCTCTCCGTGCGCCCGCCCTGG + Intergenic
1131055147 15:89370620-89370642 CTCTCTCCGAGGGCCGTTTAAGG - Intergenic
1133580859 16:7143317-7143339 CTCTCCCTGAGAGCTGGGTCGGG - Intronic
1138344568 16:56312035-56312057 GTCTCCCCGAGGGCAGGGTCAGG - Intronic
1143473398 17:7190281-7190303 CTCTCTCCTAAGGCAGGGTCTGG - Exonic
1143596304 17:7916257-7916279 CACTCTCCTGGGGCCGGGTCGGG + Intergenic
1147989518 17:44324441-44324463 TTCTCTCCGGGCCCCGGGTCTGG - Intronic
1149512737 17:57256582-57256604 CTCTCTGCGAGCGGCGGAGCCGG - Exonic
1150003624 17:61456539-61456561 GCCTCTCCGAGCGCTGGGCCCGG - Exonic
1152020960 17:77780021-77780043 CTCTCCCCCAGCCCCGGGACAGG + Intergenic
1155654246 18:28176776-28176798 CTCCGTCCGGGCGCCGGGGCAGG - Intronic
1160921858 19:1524342-1524364 GTCCCTGCGAGCGCGGGGTCTGG + Intronic
1161339227 19:3731601-3731623 CTCACTCCTATCGCCGGGGCTGG - Intronic
1166761109 19:45224889-45224911 CTCTGGCCGAGCGCCTGGCCCGG - Exonic
1167601702 19:50458765-50458787 GTCTTTCGGAGCGCAGGGTCAGG - Intronic
1167978688 19:53254671-53254693 CCCTCTCGGAGCGACGGGACTGG + Intronic
925610387 2:5696816-5696838 CCCTCCCCGCGCGCCGGCTCAGG + Exonic
932621845 2:73269385-73269407 CTCTCGCCGGGCGCCGGGCACGG + Exonic
1172118993 20:32586589-32586611 CTCTCTCCGAGCGCGGTGAAAGG - Intronic
1172320912 20:33994382-33994404 CTCTCTCCGCGGGCCAAGTCTGG + Intronic
1179018443 21:37615992-37616014 CTCCCTCCGCACGCCAGGTCTGG - Exonic
1180122356 21:45762306-45762328 CTCTCTCCAATCGCCTGCTCAGG - Intronic
1180166406 21:46033086-46033108 CCCTCTCCGAGGCCCGGGACTGG - Intergenic
1181651085 22:24259639-24259661 CTGTCTCCGAGGGCCAGGCCTGG + Intergenic
1181695962 22:24592941-24592963 CGCCCTACGAGCGCCGGGTGCGG - Exonic
1183666610 22:39249851-39249873 CCCTCTCCTAGCGCTGGCTCTGG - Intergenic
1185395144 22:50582943-50582965 CTCTCTCCGTGCCCCGGCCCGGG + Exonic
950686354 3:14621333-14621355 ATCTCTCTGAGCGCAGGTTCTGG - Intergenic
952867208 3:37862048-37862070 CTCTCCCAGAGCGCGGGGCCGGG + Intronic
958798617 3:98732480-98732502 CCCTCGCCGGGCGCCGGGACCGG - Intronic
960955461 3:123027734-123027756 CTCTCTCCGAGCGCCGGGTCGGG - Intronic
962456399 3:135569096-135569118 CTCTCTCCAACCGCCATGTCGGG + Intergenic
981093626 4:140756957-140756979 CTCTAACCGAGCTCCAGGTCTGG - Intergenic
985805229 5:2038708-2038730 TTCTCTCCGCGGGCCGGGCCGGG + Intergenic
1014632496 6:123803755-123803777 CGCTCGCCGCGCGCCGGCTCCGG - Intergenic
1015651351 6:135464614-135464636 CTCTCTCAGAGCCCTTGGTCTGG + Intronic
1022471039 7:30682093-30682115 GGCTCTCGGAGCGCGGGGTCAGG + Intronic
1023937232 7:44748746-44748768 CCCGCCCCGAGCGCCGGCTCGGG + Intronic
1024639395 7:51316962-51316984 CGCTCGCCGCGGGCCGGGTCGGG - Intergenic
1029708256 7:102286633-102286655 CTCTCTCCGGGCCCCAGGACCGG + Intronic
1039064910 8:33599499-33599521 CTCCCTCCGCGCGCGGGGCCCGG - Intronic
1039591908 8:38756929-38756951 CCCTCTCCGCCCGCTGGGTCCGG - Intronic
1039981350 8:42411769-42411791 CACTCTCCTAGCGCCAGGCCTGG - Intergenic
1048275466 8:133062539-133062561 CTGCCTCCGAGGCCCGGGTCAGG + Intronic
1062229725 9:135475067-135475089 CTTTCTGCGGGCTCCGGGTCCGG + Intergenic
1187412486 X:19063261-19063283 ATCTCCCAGAGCCCCGGGTCGGG + Intronic
1190862424 X:54357649-54357671 CTCTCTCCTAGCGCCCCGGCCGG + Intronic
1201637891 Y:16145737-16145759 CTCTCTCTGATGGCTGGGTCTGG - Intergenic