ID: 960955515

View in Genome Browser
Species Human (GRCh38)
Location 3:123027926-123027948
Sequence AGGGGGCGCCCTGCATCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 152}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960955503_960955515 26 Left 960955503 3:123027877-123027899 CCGCGGCGGGCGCTGCACCCGCC 0: 1
1: 0
2: 2
3: 17
4: 209
Right 960955515 3:123027926-123027948 AGGGGGCGCCCTGCATCCCGCGG 0: 1
1: 0
2: 0
3: 9
4: 152
960955509_960955515 5 Left 960955509 3:123027898-123027920 CCAGCCTCGAGGCGCGCGGAGGA 0: 1
1: 0
2: 0
3: 4
4: 59
Right 960955515 3:123027926-123027948 AGGGGGCGCCCTGCATCCCGCGG 0: 1
1: 0
2: 0
3: 9
4: 152
960955505_960955515 9 Left 960955505 3:123027894-123027916 CCCGCCAGCCTCGAGGCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 97
Right 960955515 3:123027926-123027948 AGGGGGCGCCCTGCATCCCGCGG 0: 1
1: 0
2: 0
3: 9
4: 152
960955507_960955515 8 Left 960955507 3:123027895-123027917 CCGCCAGCCTCGAGGCGCGCGGA 0: 1
1: 0
2: 0
3: 6
4: 74
Right 960955515 3:123027926-123027948 AGGGGGCGCCCTGCATCCCGCGG 0: 1
1: 0
2: 0
3: 9
4: 152
960955502_960955515 30 Left 960955502 3:123027873-123027895 CCTGCCGCGGCGGGCGCTGCACC 0: 1
1: 0
2: 1
3: 20
4: 204
Right 960955515 3:123027926-123027948 AGGGGGCGCCCTGCATCCCGCGG 0: 1
1: 0
2: 0
3: 9
4: 152
960955510_960955515 1 Left 960955510 3:123027902-123027924 CCTCGAGGCGCGCGGAGGAGCGC 0: 1
1: 0
2: 0
3: 8
4: 90
Right 960955515 3:123027926-123027948 AGGGGGCGCCCTGCATCCCGCGG 0: 1
1: 0
2: 0
3: 9
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960955515 Original CRISPR AGGGGGCGCCCTGCATCCCG CGG Intronic
900121829 1:1051565-1051587 ATGGGGCCTCCTGCGTCCCGAGG + Exonic
900610920 1:3544331-3544353 AGGTGCCGCCCTGCAGCCCCAGG - Intronic
901490619 1:9594650-9594672 AGCGGGAGCCCTGCTTCCCAGGG + Intronic
906409888 1:45569909-45569931 AGAGGATGCCCTGCATCCCTTGG - Exonic
906719805 1:47996897-47996919 AGAGGGCGCCCAGCATCCTGCGG - Intergenic
907194622 1:52676476-52676498 AGGAGGCGCCCTGCACACAGTGG + Intergenic
907274192 1:53308061-53308083 ACTGAGCGCCCTGCATCCTGAGG - Intronic
908867585 1:68568765-68568787 TGGGGACACCCTGCATCCAGTGG + Intergenic
913009477 1:114669626-114669648 AGGGAGCGCCCGGCAGCCTGGGG - Intronic
913048088 1:115090066-115090088 AGGCGGCGCCCTGAGTCCTGTGG + Intergenic
913449402 1:118983074-118983096 AGGGGTCGCCCTGCACTTCGTGG + Intronic
913592200 1:120340963-120340985 CGGGGGCGCGCCGCATCCCCTGG - Intergenic
913651158 1:120914183-120914205 CGGGGGCGCGCCGCATCCCCTGG + Intergenic
924539747 1:244970299-244970321 AGGGGCCGCTCTGAATCCCGGGG - Exonic
924818460 1:247463765-247463787 AGGGGGAGCCCTGCACACTGTGG - Intergenic
1063407698 10:5813036-5813058 CAGGGGCGCCCCGCGTCCCGGGG - Intronic
1071307794 10:84314389-84314411 AAGGGGCGCCCTGCACCAAGAGG + Intergenic
1071371244 10:84953778-84953800 ATGGGGGGCTCTGCATCCTGAGG - Intergenic
1071564712 10:86665739-86665761 AGTGGGCGTCCTACATCCTGGGG - Exonic
1071596669 10:86932919-86932941 TGGGGGCTCCCTGCTTCCAGAGG + Intergenic
1072543151 10:96413645-96413667 AGGGGGCGCCATTCACACCGTGG - Intronic
1075679368 10:124321534-124321556 AGGTGACGCCCTGCATCCGCCGG - Intergenic
1076798562 10:132810380-132810402 GAGGGGCGGCCTGCACCCCGCGG - Intronic
1076817364 10:132921514-132921536 ACGGGGCTCCCTGGATCACGGGG - Intronic
1077041995 11:528926-528948 AGGGGGGGCTCTGCGTCCGGAGG + Intergenic
1077266407 11:1652975-1652997 AGGGGGCGGCGTGCTTTCCGGGG + Intergenic
1077338979 11:2017650-2017672 AGGGGGTGCCCTGGCTGCCGTGG + Intergenic
1077601971 11:3580656-3580678 AGGGGGAGCCCCGCGTCCTGGGG - Intergenic
1078100821 11:8329329-8329351 AGGAGGAGCCCAGCACCCCGGGG + Intergenic
1083800010 11:65041251-65041273 GGTGGGCGCTCAGCATCCCGGGG - Exonic
1083927759 11:65818841-65818863 AGGGAGGTCCCTGCATCCCCAGG - Intergenic
1084257880 11:67955202-67955224 AGGGGGAGCCCCGCGTCCTGGGG - Intergenic
1084814879 11:71640035-71640057 AGGGGGAGCCCCGCGTCCTGGGG + Intergenic
1090073717 11:123565702-123565724 AGAGGGAGCCCTGCACCCAGTGG + Intronic
1202821963 11_KI270721v1_random:72832-72854 AGGGGGTGCCCTGGCTGCCGTGG + Intergenic
1092428115 12:8389999-8390021 AGGGGGAGCCCCGCGTCCTGGGG - Intergenic
1094828307 12:34288452-34288474 AGGGTGAGACATGCATCCCGGGG - Intergenic
1095672493 12:44876755-44876777 GGGGAGTGCCCTGCACCCCGGGG - Exonic
1096217110 12:49803856-49803878 AGGGGCAGCCCTGCCTCCCCAGG + Intronic
1096570769 12:52521844-52521866 CGGGGGCGCCCTGTGGCCCGAGG + Intergenic
1100809705 12:98325662-98325684 AGGGGGCTCCCTGGAAACCGTGG - Intergenic
1103721738 12:122978977-122978999 AGGGGGCGCCCTGTATTTTGGGG + Exonic
1104989983 12:132619568-132619590 AGGGGGCGGCCCGCACCTCGGGG - Exonic
1105547449 13:21361262-21361284 AGAGGGAGCCCTGCACCCCAGGG + Intergenic
1113901959 13:113802503-113802525 AGGGGGCGCCCCTCGTCCCTGGG - Intronic
1116945275 14:50830689-50830711 AGGATGCGCGCTGCAGCCCGCGG - Intronic
1117478140 14:56118217-56118239 AGGGGGCGCCCCGCGGGCCGGGG + Intronic
1121473504 14:94174406-94174428 TGAGGGCGTCCGGCATCCCGGGG + Exonic
1122806645 14:104263202-104263224 AGGGGGCCAGCTGCATGCCGGGG + Intergenic
1124197431 15:27644731-27644753 AGTGGGAGCCCTGCTTCCCTGGG + Intergenic
1125547099 15:40513831-40513853 AGGGGGAGCCCAGCCTCCCTTGG - Intergenic
1125689602 15:41585481-41585503 AGCCGGCGCCCTGCAGGCCGCGG + Intergenic
1128119190 15:65133419-65133441 CGGGGCCGCCCTGGAGCCCGCGG - Exonic
1131621235 15:94070524-94070546 AGGTGGCGCCCTGCACCCGGCGG - Intergenic
1132037783 15:98501183-98501205 AGGTGATGCCCTGCATCCCAGGG - Intronic
1133370121 16:5240371-5240393 AGGGGGAGCCCCGCGTCCTGGGG + Intergenic
1136572709 16:31106150-31106172 AAGGGGCGCCCTGCATCTCTGGG - Exonic
1137673242 16:50291460-50291482 TGGGGGCTCCCTGGATCACGCGG + Intronic
1139505798 16:67397549-67397571 AGGCTGAGCCCTGGATCCCGAGG - Intronic
1139511287 16:67429996-67430018 AGAGGGGTCCCTGCTTCCCGTGG - Intergenic
1203145324 16_KI270728v1_random:1794895-1794917 AGGGTGGGCCCTGCAGGCCGTGG + Intergenic
1143679514 17:8465917-8465939 GGGGGGCTCCCTGCATCGCTGGG + Intronic
1143781605 17:9232242-9232264 AGGCAGCAGCCTGCATCCCGAGG + Intronic
1144692953 17:17280890-17280912 AGGGGGCTCCCGGCGGCCCGAGG + Intronic
1145272440 17:21411982-21412004 AGGGGGCTCCCAGCACCCCTGGG + Intronic
1145310648 17:21699447-21699469 AGGGGGCTCCCAGCACCCCTGGG + Intronic
1147147071 17:38491548-38491570 GGGGGGCGCCCGGCAGCCCCTGG + Intronic
1152624593 17:81382405-81382427 AGGGGCCACCCAGCATCCCCGGG + Intergenic
1152640841 17:81448543-81448565 GGGGGACGCCCTCCACCCCGGGG - Intronic
1154194765 18:12257546-12257568 TGGCGGCGCCCTGCCTCCCTCGG + Intronic
1157803384 18:50639081-50639103 AGGGGGCGCCCTGGTACCCCAGG + Intronic
1160726482 19:619933-619955 AGGGTGTGCCCTGCTGCCCGGGG - Intronic
1160867629 19:1262759-1262781 TGGGGGCCCCCTTCACCCCGGGG + Intronic
1163597079 19:18226400-18226422 CGGGGGGGCCCTGCATCGCCAGG + Intronic
1163695454 19:18761290-18761312 AGTGTGTGACCTGCATCCCGGGG + Intronic
1164877994 19:31706253-31706275 AGGGGAGTCCCTGCATCCCTGGG + Intergenic
1165744824 19:38224321-38224343 AGGGGGCCCCCGGGACCCCGCGG + Intronic
1166893691 19:46009922-46009944 AGGGGGCGCCCTCCACCCTTTGG + Intronic
1166944824 19:46390355-46390377 GCGGGGCGGCCTGCATCCCAGGG + Exonic
1167590417 19:50401798-50401820 GGGGGGCCCCCACCATCCCGCGG + Exonic
1167645614 19:50703545-50703567 AGGGCCCGCTCTCCATCCCGAGG - Exonic
1168398263 19:56066869-56066891 GGAGGGCTCCCTGCTTCCCGTGG - Intergenic
925315840 2:2922356-2922378 ATGGTGTGCCCTGCATCCCATGG - Intergenic
925395020 2:3527148-3527170 GGGGGGCGCCCTGCAGACTGGGG - Intergenic
928409532 2:31043944-31043966 AGCGTGCTCCCTGCATCCCAGGG + Intronic
937294400 2:120800975-120800997 TGGGGGCACCCTGCATTCCCCGG + Intronic
938114287 2:128592604-128592626 AGAGGGCGCCATGCAGCACGGGG - Intergenic
940883537 2:158969251-158969273 GGGGGGCGCCCAGGACCCCGCGG - Intronic
942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG + Intergenic
946692345 2:222319253-222319275 AGGGGGCGCCCCGCCTCCGGGGG + Intergenic
948613762 2:239185300-239185322 AGGGGGTGCCCTGTATCTCCTGG + Intronic
948840342 2:240645563-240645585 AGGGGGCGGCGGGCATCCTGGGG + Intergenic
1172304490 20:33871436-33871458 GGATGGCGCCCTGCAGCCCGGGG - Intergenic
1173864802 20:46307229-46307251 AGGGGGTGCCCTGCACCTCGGGG + Intronic
1175267583 20:57711779-57711801 AGGGGTCCCCCAGCATCCCTTGG + Intergenic
1180716190 22:17873908-17873930 AGGGGGCTCCCTGCCCCCTGGGG + Intronic
1181555771 22:23670960-23670982 AGGGGGTGCCCAGCAGCCCTGGG + Intergenic
1183744434 22:39684928-39684950 ACGGGGGACCCTGCAGCCCGAGG - Intronic
1184036208 22:41919559-41919581 AGGGGGCGCCCGGGCTCCTGAGG + Intergenic
1184362236 22:44025344-44025366 AATGGGGGACCTGCATCCCGGGG - Intronic
1184771410 22:46598919-46598941 AGGAGCCGCCCTGCACCCAGAGG + Intronic
1185081179 22:48710232-48710254 AGTGTGCGCCCTGCATACGGGGG - Intronic
1185081273 22:48710655-48710677 GGGGGGCTCACTGCCTCCCGTGG - Intronic
1185218699 22:49618038-49618060 AGGGGGCAGGCAGCATCCCGGGG - Intronic
957072809 3:75579690-75579712 AGGGGGAGCCCCGCGTCCTGGGG - Intergenic
960877957 3:122315594-122315616 AGAGGGCGTTCTGTATCCCGGGG - Intergenic
960955515 3:123027926-123027948 AGGGGGCGCCCTGCATCCCGCGG + Intronic
961281264 3:125767067-125767089 AGGGGGAGCCCCGCGTCCTGGGG + Intergenic
961873112 3:130002518-130002540 AGGGGGAGCCCCGCGTCCTGGGG - Intergenic
967795644 3:193596103-193596125 TGGGGGCGGAATGCATCCCGTGG - Intronic
968491400 4:892380-892402 AGGGGCCTCCCTGCTCCCCGTGG + Intronic
968922911 4:3531962-3531984 AGGTGGCGGCCGGCACCCCGAGG - Intronic
970333258 4:15004587-15004609 AGGGGGCGCCCGGCCAGCCGCGG - Intronic
972726792 4:41751810-41751832 AGGGGGCGCCCGGCAGCAGGGGG - Intergenic
973018801 4:45173198-45173220 GGGGGGTCCCCTGCCTCCCGTGG + Intergenic
973110338 4:46390171-46390193 AGGGGGGGCCCTGCCTTCCCGGG - Intronic
984841975 4:184077249-184077271 AGGTGGTACCCTGCATCACGAGG - Intergenic
985073503 4:186191254-186191276 AGGACGCGCCCCGCCTCCCGGGG + Intergenic
985631759 5:1017677-1017699 CGGGGCCGCCCTGCAGCCCCAGG + Intronic
997297458 5:132777036-132777058 AGGGGCCGCCCTGCAGCTGGCGG - Intronic
998026330 5:138819602-138819624 AAGTGGTGCCCTGCATCCCAAGG - Intronic
1001512598 5:172334365-172334387 AGAGGGCGCCCTGCACCCTCAGG + Exonic
1002929641 6:1624411-1624433 AGCTGCCGCCCTGCAGCCCGGGG + Intronic
1003911463 6:10747648-10747670 AGCACGCGCCCTGCATCCCGGGG - Intergenic
1004178674 6:13362689-13362711 AAGAGTCGCCCTGCTTCCCGAGG - Exonic
1007790870 6:44307377-44307399 AGGGGGTGCCCTGCAGCCCTGGG + Exonic
1018628844 6:165805203-165805225 AGTGGGTGCCCTGCGACCCGAGG - Intronic
1018686665 6:166308568-166308590 AGCGCGCGCCAGGCATCCCGGGG + Intergenic
1019595460 7:1856395-1856417 TGGGGGCCCCCTGCCTCCAGCGG + Intronic
1019717027 7:2543829-2543851 AGGGGCAGCCCTGCCTGCCGGGG - Exonic
1019745098 7:2695376-2695398 AGGTGGGGCCCTGCTTCCCATGG + Intronic
1019828284 7:3301480-3301502 GGGGGGCGCCGCGCCTCCCGCGG + Exonic
1021572814 7:22082998-22083020 AGGCGGCGCCCAGCCTCCCGGGG + Intergenic
1029200635 7:98836985-98837007 AGGGGGCGCCCAGACTCCAGAGG - Intergenic
1029205944 7:98869550-98869572 AGGGGGCTCCCCGCACCCCCTGG - Intronic
1030820574 7:114086748-114086770 AGGCAGCGCCCTGCTTGCCGGGG + Intronic
1034560609 7:151877275-151877297 AGGGGGCGCCCGGAGTCCAGCGG + Intergenic
1035021894 7:155805205-155805227 AGGGGGCGCCCTGGGCCCAGGGG + Intronic
1035752089 8:2003040-2003062 ACGGGGCGCCCTGCTCCCCTCGG - Exonic
1036830103 8:12014560-12014582 AGGGGGAGCCCCGCGTCCTGGGG - Intronic
1036899186 8:12658852-12658874 AGGGGGAGCCCCGCGTCCTGGGG - Intergenic
1042637504 8:70894605-70894627 AAGTGGTGCCCTGCATCCCAGGG - Intergenic
1049360670 8:142211245-142211267 AGGGGGCGCACTGTCTCCTGGGG + Intergenic
1049676551 8:143891808-143891830 GCGGGGTGCCCAGCATCCCGGGG + Intergenic
1049753351 8:144296303-144296325 AGGGGTGGCCCTGCCTGCCGTGG - Intronic
1049854392 8:144852544-144852566 ATGGGGCGCCGTGAAGCCCGTGG - Intronic
1053306241 9:36986487-36986509 AGCGGGCGGCCTCCTTCCCGGGG + Intronic
1056008697 9:82302538-82302560 AAGCAGCACCCTGCATCCCGAGG - Intergenic
1056078244 9:83062905-83062927 AGGGAGGGCCCTGCGCCCCGCGG - Exonic
1056773756 9:89497555-89497577 CGGGGGCGCGCTGCATACCCGGG - Intronic
1057519928 9:95752304-95752326 AGGCGCCGCTCTGCCTCCCGGGG - Intergenic
1060390027 9:123269106-123269128 AGGCGTCGCACTGCCTCCCGAGG + Intergenic
1061006353 9:127930558-127930580 ACGGGGCGCCAGGTATCCCGAGG - Intronic
1061055060 9:128218170-128218192 AGGGGGCGCCCTCTGTCCCAGGG - Intronic
1061144826 9:128791503-128791525 TGGGGCCGCCCTGCCTCCTGCGG + Intronic
1061388443 9:130303890-130303912 AGGGGCCGCCATCCATCTCGTGG + Intronic
1188090003 X:25952872-25952894 ATGCGGCACCCTGCATCCTGGGG - Intergenic
1199996959 X:153031584-153031606 AGGGGGCTCCCTGAAGCCGGTGG + Intergenic
1200034238 X:153317937-153317959 AGGGGGCTCCCTGAAGCCAGTGG - Intergenic
1200044826 X:153395885-153395907 AGGGGGCTCCCTGAAGCCAGTGG - Intergenic
1200145885 X:153926381-153926403 AAGGGGCGCCCTGCCCCCCCAGG - Intronic
1201018001 Y:9624529-9624551 AGGGGATGCCCTGCAGCCTGCGG - Intergenic