ID: 960959400

View in Genome Browser
Species Human (GRCh38)
Location 3:123058721-123058743
Sequence GAGCAGCCCGTCCTCCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960959400_960959408 29 Left 960959400 3:123058721-123058743 CCCTCCTGGAGGACGGGCTGCTC No data
Right 960959408 3:123058773-123058795 TCTATGTACTCATTTTTGGAAGG No data
960959400_960959406 25 Left 960959400 3:123058721-123058743 CCCTCCTGGAGGACGGGCTGCTC No data
Right 960959406 3:123058769-123058791 TCCTTCTATGTACTCATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960959400 Original CRISPR GAGCAGCCCGTCCTCCAGGA GGG (reversed) Intergenic
No off target data available for this crispr