ID: 960959406

View in Genome Browser
Species Human (GRCh38)
Location 3:123058769-123058791
Sequence TCCTTCTATGTACTCATTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960959400_960959406 25 Left 960959400 3:123058721-123058743 CCCTCCTGGAGGACGGGCTGCTC No data
Right 960959406 3:123058769-123058791 TCCTTCTATGTACTCATTTTTGG No data
960959403_960959406 1 Left 960959403 3:123058745-123058767 CCCAGCTTCATTCTCCTGAAGCT No data
Right 960959406 3:123058769-123058791 TCCTTCTATGTACTCATTTTTGG No data
960959402_960959406 21 Left 960959402 3:123058725-123058747 CCTGGAGGACGGGCTGCTCACCC No data
Right 960959406 3:123058769-123058791 TCCTTCTATGTACTCATTTTTGG No data
960959401_960959406 24 Left 960959401 3:123058722-123058744 CCTCCTGGAGGACGGGCTGCTCA No data
Right 960959406 3:123058769-123058791 TCCTTCTATGTACTCATTTTTGG No data
960959404_960959406 0 Left 960959404 3:123058746-123058768 CCAGCTTCATTCTCCTGAAGCTG No data
Right 960959406 3:123058769-123058791 TCCTTCTATGTACTCATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960959406 Original CRISPR TCCTTCTATGTACTCATTTT TGG Intergenic
No off target data available for this crispr