ID: 960959408

View in Genome Browser
Species Human (GRCh38)
Location 3:123058773-123058795
Sequence TCTATGTACTCATTTTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960959402_960959408 25 Left 960959402 3:123058725-123058747 CCTGGAGGACGGGCTGCTCACCC No data
Right 960959408 3:123058773-123058795 TCTATGTACTCATTTTTGGAAGG No data
960959404_960959408 4 Left 960959404 3:123058746-123058768 CCAGCTTCATTCTCCTGAAGCTG No data
Right 960959408 3:123058773-123058795 TCTATGTACTCATTTTTGGAAGG No data
960959400_960959408 29 Left 960959400 3:123058721-123058743 CCCTCCTGGAGGACGGGCTGCTC No data
Right 960959408 3:123058773-123058795 TCTATGTACTCATTTTTGGAAGG No data
960959401_960959408 28 Left 960959401 3:123058722-123058744 CCTCCTGGAGGACGGGCTGCTCA No data
Right 960959408 3:123058773-123058795 TCTATGTACTCATTTTTGGAAGG No data
960959405_960959408 -9 Left 960959405 3:123058759-123058781 CCTGAAGCTGTCCTTCTATGTAC No data
Right 960959408 3:123058773-123058795 TCTATGTACTCATTTTTGGAAGG No data
960959403_960959408 5 Left 960959403 3:123058745-123058767 CCCAGCTTCATTCTCCTGAAGCT No data
Right 960959408 3:123058773-123058795 TCTATGTACTCATTTTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960959408 Original CRISPR TCTATGTACTCATTTTTGGA AGG Intergenic
No off target data available for this crispr