ID: 960960516

View in Genome Browser
Species Human (GRCh38)
Location 3:123067398-123067420
Sequence CCAAGCGCTCCCGGACGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960960508_960960516 -8 Left 960960508 3:123067383-123067405 CCGGTGCCCTCGCCGCCAAGCGC 0: 1
1: 0
2: 0
3: 4
4: 107
Right 960960516 3:123067398-123067420 CCAAGCGCTCCCGGACGCAGGGG 0: 1
1: 0
2: 0
3: 6
4: 112
960960507_960960516 -7 Left 960960507 3:123067382-123067404 CCCGGTGCCCTCGCCGCCAAGCG 0: 1
1: 0
2: 0
3: 3
4: 75
Right 960960516 3:123067398-123067420 CCAAGCGCTCCCGGACGCAGGGG 0: 1
1: 0
2: 0
3: 6
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960960516 Original CRISPR CCAAGCGCTCCCGGACGCAG GGG Intronic
900094875 1:936284-936306 CCTAGGGCTCCTGGACGGAGGGG + Intronic
900094924 1:936401-936423 CCTAGGGCTCCTGGACGGAGGGG + Intronic
900991245 1:6099380-6099402 CCAAGCGCTCCGGGCCTCACTGG - Exonic
901877492 1:12175245-12175267 CCAAGTTCTCCCGGAAGCAGAGG - Intronic
901976152 1:12945735-12945757 CCCAGCACTCTGGGACGCAGAGG + Intronic
902009020 1:13256030-13256052 CCCAGCACTCTGGGACGCAGAGG - Intronic
902617909 1:17634008-17634030 CCCTGAGCTCCCGGAGGCAGGGG - Intronic
905118541 1:35663657-35663679 CCCAGCACTTCCGGACGCCGTGG + Intergenic
907414631 1:54305743-54305765 CCAAACTCAGCCGGACGCAGTGG - Intronic
912408841 1:109466335-109466357 CCAGGCGCACCTGGACGCACAGG - Intergenic
912855877 1:113168481-113168503 CCCAGCGCTCTGGGAGGCAGAGG + Intergenic
918267059 1:182853173-182853195 CCCAGCACTTCCGGACGCTGAGG - Intronic
920074670 1:203327503-203327525 CCAAGCCCGCCCTGACGCCGCGG + Intergenic
921140853 1:212304979-212305001 CCCAGCACTCAGGGACGCAGGGG - Intronic
922416242 1:225425853-225425875 ACAAGCCCTTCAGGACGCAGGGG + Intronic
923111380 1:230893150-230893172 CCAAGCACTCTGGGAGGCAGAGG + Intergenic
923561988 1:235048514-235048536 CCAAGGGCAGCCGGGCGCAGTGG + Intergenic
1067107867 10:43377568-43377590 CCCAGCCCTGCAGGACGCAGAGG + Intergenic
1072253724 10:93601201-93601223 CCACGCGCGCCCGGACTCGGCGG - Intronic
1073301384 10:102473147-102473169 CCAAGTGCTGCCGGGTGCAGTGG + Intronic
1076402310 10:130192309-130192331 CCCAGCCCTCCCTGACACAGGGG - Intergenic
1077141067 11:1025135-1025157 CCAGGCCCTCCCTGATGCAGGGG - Intronic
1077172920 11:1176389-1176411 CCATGCGCTCCCGGACTCCCTGG + Intronic
1077627679 11:3787741-3787763 CCCAGCACTCCGGGAAGCAGAGG + Intronic
1082028646 11:47589716-47589738 CCAGGCGCGCCCGGAGGCCGTGG + Exonic
1082059729 11:47849593-47849615 CCCAGCGCTCTGGGAGGCAGAGG + Intergenic
1094679473 12:32655335-32655357 CCAAGCACTTTCGGAGGCAGAGG + Intergenic
1096607579 12:52777670-52777692 CCATGAGCTCCCTGACACAGGGG + Intergenic
1097179899 12:57165866-57165888 TCCAGCGCTCCTGGATGCAGCGG - Exonic
1098826566 12:75305402-75305424 CAAAGTGCTCCTGGACGCAGAGG + Intronic
1102674961 12:114651304-114651326 CCAAGCACTTCGGGAGGCAGAGG - Intergenic
1103527311 12:121577519-121577541 CCCAGCGCTCCAGGAGGCAATGG + Intronic
1103700789 12:122847804-122847826 CCAAGAGCTCCAGGAGTCAGGGG - Intronic
1108527283 13:51296708-51296730 CCAGGCCCTCCTGGATGCAGAGG - Intergenic
1113562593 13:111294255-111294277 AAAAGTGCTCCCTGACGCAGAGG - Exonic
1113676949 13:112214150-112214172 CCATGGGCTCACGGACTCAGTGG + Intergenic
1115559933 14:34573926-34573948 CCATGTGCTCCTGGGCGCAGTGG - Intronic
1121114797 14:91336197-91336219 CCAAGAACTCCCTGATGCAGAGG + Intronic
1123477394 15:20599286-20599308 CCAAGGGCTCCTGGGGGCAGGGG + Intergenic
1123640622 15:22401096-22401118 CCAAGGGCTCCTGGGGGCAGGGG - Intergenic
1123787423 15:23687244-23687266 CGAAGAGCTCCTGGACGCAGAGG - Exonic
1129759484 15:78121217-78121239 CCCAGCCCTCCCAGACACAGGGG + Intronic
1133160969 16:3911458-3911480 CTAAGCTCTGCCGGACTCAGTGG + Intergenic
1141682652 16:85553498-85553520 CCTAGCGCACGCGGGCGCAGGGG - Intergenic
1141688832 16:85585279-85585301 CCAAGGGCTCCAGGAACCAGAGG + Intergenic
1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG + Exonic
1144548171 17:16216211-16216233 CCAGGCCCGACCGGACGCAGTGG + Intronic
1151615067 17:75204796-75204818 CCCAGCACTCCGGGACGCCGAGG - Intergenic
1151660747 17:75516740-75516762 CGAAGAGCTCCCGGGCGCTGGGG - Exonic
1152147984 17:78580695-78580717 CCCAGAGCTCCCAGACACAGGGG + Intergenic
1152525231 17:80884630-80884652 GCAGGCACTCCTGGACGCAGAGG - Intronic
1153163204 18:2231414-2231436 CCAAGCACTTCGGGAGGCAGAGG - Intergenic
1158787330 18:60730563-60730585 CCCAGCACTTCCGGAGGCAGAGG + Intergenic
1160824089 19:1071388-1071410 CCACGTGCTCCCGGACGCGGCGG - Intronic
1160829976 19:1099327-1099349 CCAAGCGCTCTGGGAGGCTGAGG + Intergenic
1161325333 19:3660989-3661011 CAAAGAGCTCCCGGAAGTAGCGG + Exonic
1162727125 19:12696393-12696415 CGAAGCGCTCGGGGACGCGGCGG + Exonic
1162758529 19:12874576-12874598 CCCAGCGCTCCCGGCCCCGGGGG - Exonic
1167612526 19:50514311-50514333 CCTAGCCCTCCCAGAGGCAGCGG + Intronic
1168081063 19:54010829-54010851 CCAAGCGCTTTGGGACGCCGAGG - Intronic
925221113 2:2142261-2142283 CCAAACGCTTAAGGACGCAGTGG + Intronic
938308429 2:130269443-130269465 CAAAGCGCCCCAGGACGCATTGG + Intergenic
938716951 2:134029650-134029672 CCAAGTGCTGCCAGACACAGAGG + Intergenic
944495928 2:200307052-200307074 CCCAGCGCTCCGGGAGGCGGCGG - Intronic
947794209 2:232884055-232884077 CCAAGACCTCCCGGACCCTGAGG - Exonic
1170077803 20:12438763-12438785 CCAAGCACTTTCGGAGGCAGAGG + Intergenic
1170219815 20:13930039-13930061 CCAAGCGCTTCAGGAAGCTGAGG - Intronic
1171058939 20:21937131-21937153 CCAAGGGCTCCTGGGCCCAGGGG + Intergenic
1172101038 20:32484001-32484023 CCCATCGCTCCCGGAGGCTGCGG + Intronic
1173980300 20:47218964-47218986 CCCAGCACTTCCGGAGGCAGAGG + Intronic
1175790523 20:61737499-61737521 CCAAGCCCTCCAGGCTGCAGTGG - Intronic
1175807969 20:61841259-61841281 CGCAGCGCTCCCGGACGGCGGGG + Intronic
1176173724 20:63708033-63708055 CCAAGCACTTCCGGAAGCGGCGG + Intronic
1180935238 22:19621050-19621072 CCAGGAGCTCCGGGAAGCAGAGG - Intergenic
1181713902 22:24709980-24710002 CCAGGCGCGGCCGGGCGCAGTGG + Intergenic
1183130722 22:35832580-35832602 CCAAGCACTCTGGGATGCAGAGG + Intronic
1183380113 22:37486401-37486423 CCAGGCGGTCCCGGAGGCTGCGG - Exonic
954217890 3:49134431-49134453 CCCAGCGCTTTCGGAGGCAGAGG - Intergenic
954375833 3:50193756-50193778 CCAGGCGCTCCAGGTCGGAGAGG - Exonic
960960516 3:123067398-123067420 CCAAGCGCTCCCGGACGCAGGGG + Intronic
960961053 3:123070607-123070629 CCAAGTGCTCCTGGACACAGGGG + Intronic
961005815 3:123404668-123404690 ACAAGAGCTCCCAGCCGCAGGGG + Intronic
961861659 3:129921248-129921270 CCCAGCGCTCTCGGAGGCCGAGG + Intergenic
963252915 3:143119316-143119338 CCCACCGCTCCAGGGCGCAGAGG + Exonic
968320729 3:197765744-197765766 CCAAGCACTCTCGGAGGCTGAGG + Intronic
989059744 5:37398370-37398392 CCAAGTGCGGCCGGGCGCAGTGG - Intronic
992119853 5:73581299-73581321 CCAAGCACTTCGGGAGGCAGAGG - Exonic
1002512738 5:179733315-179733337 CCAAGCGCGCCGGGAAGCACAGG + Exonic
1005654757 6:27923961-27923983 CCAAGCTCTCAGGGAGGCAGAGG - Intergenic
1006219615 6:32477360-32477382 CCAAGCACTTCGGGAGGCAGAGG + Intergenic
1012873480 6:104698399-104698421 CCAAGAGCTCACGGACCCATGGG - Intergenic
1015315131 6:131808293-131808315 CCCAGCCCTCCCGGGCGCCGGGG - Intronic
1017213598 6:151883491-151883513 CCAAGAGTGCTCGGACGCAGAGG - Intronic
1017666582 6:156725081-156725103 CCCAGCGCTTCCGGAGGCTGAGG + Intergenic
1017863649 6:158423024-158423046 CCAAGCTCTCAGGGAGGCAGAGG + Intronic
1018600887 6:165539669-165539691 CCCAGCGCTCCGGGAGGCTGGGG + Intronic
1024424554 7:49210916-49210938 CCCAGCGCTCTGGGAGGCAGAGG + Intergenic
1029476754 7:100789557-100789579 CCCAGCGCTCCGGGAAGCTGAGG + Intronic
1033070164 7:138194652-138194674 CCCAGCACTTCCGGAGGCAGAGG - Intergenic
1035169547 7:157009984-157010006 CCACGCGCATCCGGGCGCAGCGG - Exonic
1035212073 7:157336404-157336426 CCACGCGCTCCCGTTCGCCGGGG + Intronic
1035432737 7:158834430-158834452 CCAAGAGGTGCCGGGCGCAGTGG - Intergenic
1036184555 8:6612583-6612605 ACCAGCGGTGCCGGACGCAGTGG - Intronic
1036701504 8:11016401-11016423 CCTAGTGCCACCGGACGCAGCGG + Intronic
1041487251 8:58392648-58392670 CCAAGGGCTCCAGGAGGCAGGGG - Intergenic
1041573063 8:59359522-59359544 CCAAGCCATCCCGGATGAAGTGG + Intergenic
1047396099 8:124500454-124500476 CCAAGCACTCTGGGAGGCAGAGG + Intronic
1048581000 8:135729761-135729783 CCATGGGCTCCTGGACTCAGAGG - Intergenic
1049025942 8:139988955-139988977 CCAAGTGCTCCTGGGCTCAGAGG + Intronic
1049178440 8:141207931-141207953 CCAGGAGCTCTCGGAAGCAGGGG + Intronic
1049242864 8:141547481-141547503 CCAAGCGCTCCCCAGGGCAGAGG - Intergenic
1050273744 9:3974593-3974615 CCAATCGCTCCCTAATGCAGAGG + Intronic
1054906690 9:70419385-70419407 CCCCGCGCTCCCGGGTGCAGGGG - Intergenic
1057537603 9:95929217-95929239 TCAAGGGCTCCCTGACACAGTGG - Intronic
1058888492 9:109341374-109341396 CCAAGCACTTCGGGAGGCAGAGG - Intergenic
1060142915 9:121226089-121226111 CCAGGCTCTGCCGGGCGCAGTGG - Intronic
1060300885 9:122373963-122373985 CCAAGTCCTCCAGGATGCAGAGG - Intronic
1061138999 9:128753063-128753085 CCAAGCGCTCCTGAACCCTGAGG + Intronic
1197612625 X:128656171-128656193 CTAAGCCCTCCCAGAAGCAGAGG + Intergenic