ID: 960963918

View in Genome Browser
Species Human (GRCh38)
Location 3:123091517-123091539
Sequence GGCTGGCAGTGCTGAAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 284}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960963915_960963918 0 Left 960963915 3:123091494-123091516 CCACTTTGCAGTGGATCATTGCA 0: 1
1: 0
2: 1
3: 12
4: 114
Right 960963918 3:123091517-123091539 GGCTGGCAGTGCTGAAATCCTGG 0: 1
1: 0
2: 2
3: 30
4: 284
960963912_960963918 26 Left 960963912 3:123091468-123091490 CCACAGGAATCAAACACTGGCCA 0: 1
1: 0
2: 0
3: 18
4: 202
Right 960963918 3:123091517-123091539 GGCTGGCAGTGCTGAAATCCTGG 0: 1
1: 0
2: 2
3: 30
4: 284
960963914_960963918 6 Left 960963914 3:123091488-123091510 CCACAGCCACTTTGCAGTGGATC 0: 1
1: 0
2: 1
3: 7
4: 166
Right 960963918 3:123091517-123091539 GGCTGGCAGTGCTGAAATCCTGG 0: 1
1: 0
2: 2
3: 30
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960963918 Original CRISPR GGCTGGCAGTGCTGAAATCC TGG Intronic
900070608 1:769166-769188 GGCTGGCAGTGGTGTGATCTTGG - Intergenic
901232081 1:7646927-7646949 GGCTGGCAGGACTGACACCCTGG - Intronic
901233255 1:7652815-7652837 TCCTGGCAGAGCTGAAAGCCAGG + Intronic
901669924 1:10850103-10850125 GGCTGGGAGTGGGGAAACCCAGG + Intergenic
902065783 1:13685235-13685257 GGCTGGCAGGCTTGAAATCCAGG - Intergenic
903475150 1:23614400-23614422 GGCTGCCTGGGCTGGAATCCTGG - Intronic
903550815 1:24156570-24156592 GGGTGGCTGTCCTCAAATCCTGG - Exonic
904024565 1:27494219-27494241 GGCTTGCAGTGGTGCAATCATGG + Intergenic
904242448 1:29156948-29156970 GGCAGGCAGTGCTGAAAGGAAGG + Intronic
906365911 1:45209336-45209358 GGCTGGCAGTGGTATAATCTCGG - Intronic
907411038 1:54283404-54283426 AGGTGACAGTGCTGAAAACCAGG - Intronic
908512337 1:64859463-64859485 GGCTGCCAGTTCTGAGATGCAGG + Intronic
910116527 1:83737675-83737697 GGAGGGCAGTGCTGAGATCATGG - Intergenic
910820520 1:91340054-91340076 GGATGGCAGTGGTGCAATCTTGG + Intronic
911658749 1:100475973-100475995 GCCTGGCAGCGTGGAAATCCAGG + Intronic
912747652 1:112258813-112258835 GACATGCAGTGCTGAAATTCTGG - Intergenic
915265048 1:154710626-154710648 GGGTGGCACTGCAGAAATGCAGG + Intronic
915986494 1:160470747-160470769 GGATGGCAGAGCAGAAATACAGG - Intergenic
918052342 1:180985177-180985199 GTCTTGCAGTTCTGAAATCTAGG - Intronic
919427090 1:197446443-197446465 GGGTGGCAGTGCTGAAAGATGGG + Intronic
919777681 1:201204993-201205015 GGCTGGCCATTCAGAAATCCTGG - Intronic
919782017 1:201227174-201227196 GGGTGGCAGTGCTGACTGCCTGG - Exonic
919822604 1:201482443-201482465 GGCTGGGAGTTCTGCAATCGGGG - Intergenic
919871406 1:201824504-201824526 GGCCGGCAGTGCTCACTTCCAGG - Exonic
919980153 1:202637869-202637891 GGGTGGCAGCGCTGACCTCCAGG + Intronic
922051453 1:221994403-221994425 GGAAGGCAGGGCTTAAATCCAGG + Intergenic
922331978 1:224585527-224585549 GGATTGCAGTGATGAAATCATGG + Intronic
923232216 1:231997652-231997674 GGATGGAGATGCTGAAATCCTGG - Intronic
923882848 1:238122653-238122675 GGCTGGCAGGCCTGAGACCCAGG + Intergenic
924677537 1:246194970-246194992 AACTGGCAGTGGTGAAAACCTGG - Intronic
1062929329 10:1342094-1342116 GGCTGGCAGTGCCCACATCTTGG + Intronic
1063058818 10:2529609-2529631 GGCTGGTGGGGCTGAAAACCTGG - Intergenic
1063383781 10:5603296-5603318 GGCTGGCAGTTCTGAGATCCGGG + Intergenic
1063566407 10:7175147-7175169 GGCTGGCAGAGCTAACTTCCAGG + Intronic
1063653377 10:7962640-7962662 GACTGGAAGTGGTGAAGTCCAGG - Intronic
1063707242 10:8442472-8442494 GGAGGGCAGTGGTGCAATCCTGG + Intergenic
1064553181 10:16522185-16522207 TGCTGGCAGTGGGGAAATCGGGG - Intergenic
1065040875 10:21694832-21694854 GTCTTGCAAGGCTGAAATCCAGG + Intronic
1066706621 10:38186720-38186742 GGCTGGCAGTGCTGTCATCAAGG - Intergenic
1066785298 10:38996984-38997006 GGCTGGCAGTGCTGTCATCAAGG - Intergenic
1067055570 10:43047959-43047981 GGCAGGCAGTGGTGCAATCATGG + Intergenic
1067446408 10:46350568-46350590 GGCTGGCTGTGCTGTCATCAAGG - Intergenic
1068512686 10:57986072-57986094 GGCTGGCAGGCCTGAGACCCAGG - Intergenic
1069868224 10:71517337-71517359 GGATGACAGGGCTGAGATCCAGG - Intronic
1070134693 10:73682722-73682744 GGCTGGCTGTGCTGTCATCAAGG + Exonic
1070904027 10:80055910-80055932 GCCTGCCAGTGATTAAATCCTGG + Intergenic
1071123814 10:82311479-82311501 CACTGGCTGTGCTGAAATCTGGG + Intronic
1071573386 10:86710004-86710026 TGCTGGCAGTGGTGACAACCCGG - Exonic
1071607046 10:87001686-87001708 GGCTGGCTGTGCTGCCATCAAGG - Intergenic
1074388612 10:113037508-113037530 GGCTTGGAGTGCTGAAATGTGGG + Intronic
1075005393 10:118826637-118826659 GGAAGGCAGGGCTGAAATCCGGG - Intergenic
1075466230 10:122652725-122652747 GGTTGGCAGTCCTGTTATCCTGG + Intergenic
1075574066 10:123565868-123565890 GGCTGGCTTTCCTGAAATCATGG + Intergenic
1075967827 10:126628129-126628151 GCCTGGTAGGGCTGGAATCCAGG - Intronic
1080622314 11:33996964-33996986 GGCGGGCAGTGGCCAAATCCAGG - Intergenic
1082081627 11:48016637-48016659 GGCTGGCAGGGCAGAAATTAGGG - Intronic
1083448644 11:62727600-62727622 GGCTGGAAGTACTGAAAGACCGG - Intergenic
1083958961 11:66003319-66003341 GGCTGGGATTGGTGAAGTCCTGG + Exonic
1084861625 11:72022530-72022552 GCCTGGGATTGCTGAATTCCAGG - Intronic
1086453042 11:86936006-86936028 GGCTGGCAGGGCTGGATTCCTGG - Intronic
1089488522 11:118866093-118866115 GGATTGCAGTGCTGCAATCTTGG + Intergenic
1089610506 11:119666055-119666077 GCCTGGCAGTGCTGCCAGCCTGG + Intronic
1090061296 11:123466223-123466245 GGAGTGCAGTGCTGTAATCCTGG - Intergenic
1090550586 11:127815505-127815527 TGCTGCCAGTGCTGAAATCATGG + Intergenic
1091650571 12:2306065-2306087 GGCTGCCTGGGCTCAAATCCTGG - Intronic
1091776200 12:3186417-3186439 GAGTGGCAGTGCTGAGATCTAGG + Intronic
1093464150 12:19433335-19433357 GGCATGCAGTGGTGAGATCCTGG - Intronic
1094105267 12:26804784-26804806 GGAATGCAGTGCTGCAATCCTGG + Intronic
1094417702 12:30235010-30235032 GGCTGGCAGTGAGGAGGTCCAGG - Intergenic
1096102915 12:48980282-48980304 GGCCGGCAGTGCTGGAAAGCTGG - Intronic
1096162750 12:49393889-49393911 GGCTGGTGGTGTTGAACTCCTGG + Intronic
1096194059 12:49637614-49637636 GGCTGGCAGGGCAGGAAGCCAGG - Exonic
1098181832 12:67855444-67855466 TGCTGCAAGTGCTGATATCCAGG + Intergenic
1098483066 12:70987886-70987908 GTCTCACAATGCTGAAATCCAGG - Intergenic
1098543498 12:71686019-71686041 GGCAGGCACTGCTGGCATCCTGG - Intronic
1102036110 12:109771371-109771393 GGCTGGCAATGGTGAAGTCCAGG + Intergenic
1102158570 12:110749742-110749764 GGAGTGCAGTGCTGAAATCTTGG - Intergenic
1102917721 12:116767266-116767288 GGCTGGCAGTGGTGTGATCATGG + Intronic
1105819893 13:24070855-24070877 GGCCGGCAGTTCTGAGATCCAGG - Intronic
1107787508 13:43970577-43970599 GGCTGGCAGTGGTGGCGTCCAGG - Intergenic
1108027081 13:46189387-46189409 GGCTGGCAGGCCTGAGACCCAGG + Intronic
1108226549 13:48295373-48295395 GGCTTGCTGTCCTGAAATCCAGG - Intergenic
1111452794 13:88440837-88440859 GGCTGGCAGTCTTGAAAACCAGG - Intergenic
1111790181 13:92845425-92845447 GGCTGGCAGGCTTGAAACCCAGG + Intronic
1111819974 13:93200954-93200976 GGATGGTAGTGGTGAAATCTTGG - Intergenic
1113155736 13:107319417-107319439 GGCTGTCAGTGCTTGAATCCAGG - Intronic
1113421352 13:110173927-110173949 GCCAGGCAGTGATGGAATCCCGG - Exonic
1113884668 13:113652265-113652287 TGCCGGCAGTGCTGAGACCCTGG + Intronic
1114551009 14:23532932-23532954 GGCTGTCTGTGCTGAAGGCCTGG + Exonic
1115573258 14:34686888-34686910 GGAGGGCAGTGGTGAAATCTTGG + Intergenic
1117258040 14:54000219-54000241 GACTTTCAGTGCTAAAATCCAGG - Intergenic
1119085417 14:71734308-71734330 GGCTGGCGGTTCTTAAATGCAGG + Intronic
1119114628 14:72008125-72008147 GGATAGTAGTTCTGAAATCCAGG - Intronic
1119599776 14:75967816-75967838 AGCTGTCAGTGCTTGAATCCTGG - Intronic
1121713903 14:96059232-96059254 GGAGGGCAGTGCTGCAATCATGG - Intronic
1121781514 14:96625114-96625136 GGCTGGAATTTCTGAAATTCTGG + Intergenic
1123489103 15:20765556-20765578 AGCTGGCAGGGCTGGAAGCCTGG - Intergenic
1123545602 15:21334643-21334665 AGCTGGCAGGGCTGGAAGCCTGG - Intergenic
1124270238 15:28274147-28274169 GGCTGTCAGTGCTGTGATTCCGG - Intronic
1124533669 15:30526031-30526053 GGCTGGAACTGCTGCAATTCTGG + Intergenic
1124632543 15:31345766-31345788 GGCTGGCAGGGCAGACACCCGGG - Intronic
1124764986 15:32481614-32481636 GGCTGGAACTGCTGCAATTCTGG - Intergenic
1127738994 15:61879457-61879479 GTCTGGGAGTGCTGGGATCCAGG + Intronic
1129176927 15:73847031-73847053 GGCTCACAGAGCTGAAATCAAGG - Intergenic
1129291936 15:74574949-74574971 GGAGGGCAGTGGTGAAATCTTGG - Intronic
1131013955 15:89042219-89042241 GGCTGCCAGGGTTCAAATCCTGG - Intergenic
1131390394 15:92043428-92043450 GGCTGGCAGTCCTGACATCTGGG - Intronic
1133128021 16:3658737-3658759 GGCTGGCAGGGCTGGTAGCCTGG + Exonic
1137061221 16:35793121-35793143 GGCTGACAGCCCTGAAAGCCGGG - Intergenic
1139087725 16:63608232-63608254 GGCTGGCAGTGTTCAAATTCAGG + Intergenic
1139474303 16:67194928-67194950 CCCTGGCAGTGCAGAAGTCCAGG + Exonic
1140670064 16:77269399-77269421 GGCTGGAGTTGCTGAAATTCTGG + Intronic
1141590256 16:85063725-85063747 GGCTGGCGGTGCTGGCATCAGGG - Intronic
1141652234 16:85399217-85399239 AGCTGACAGTGATGAAACCCTGG - Intergenic
1142237897 16:88931279-88931301 GCCTGGCTGTGCTGGAAACCAGG + Intronic
1142737304 17:1908966-1908988 AGCTATCTGTGCTGAAATCCTGG + Intergenic
1143223289 17:5280365-5280387 GGCTGGCAGTGGTGCGATCTTGG + Intergenic
1144142699 17:12364982-12365004 GGCTTTCAGTGCTAAAAACCAGG - Intergenic
1145115827 17:20210374-20210396 GGCTGGCAGTGCTGTGGTTCTGG + Intronic
1146472954 17:33139156-33139178 TGCTGGCAGCCCTGGAATCCAGG - Intronic
1146691216 17:34877530-34877552 GCCTGGCAATGCTGAGACCCTGG + Intergenic
1147402116 17:40186841-40186863 GGCGTGCAGTGCTGCAATCTCGG - Intronic
1148538233 17:48458489-48458511 GGCTGGGAGTGAGGAAATCTGGG - Intergenic
1149828652 17:59851880-59851902 GGCTAGCACTGCTGGAATCTTGG - Intergenic
1149982800 17:61324622-61324644 GGCTGGCAGGGCTGGACGCCAGG - Intronic
1151732062 17:75917557-75917579 GGTGGGCAGTGCTGAGAGCCTGG + Intronic
1152244585 17:79178489-79178511 GGCTGCCTGGGCTGGAATCCAGG + Intronic
1153089104 18:1323749-1323771 GGGTGGGATTGCAGAAATCCAGG + Intergenic
1153853715 18:9123699-9123721 GGCTGGTGGTTGTGAAATCCTGG + Intronic
1154404486 18:14076445-14076467 GAATGACAGTGCTGTAATCCAGG + Intronic
1155319824 18:24608296-24608318 GGGAGGAAGTTCTGAAATCCTGG + Intergenic
1156481924 18:37441717-37441739 GGCTGCCACTCCTGAAACCCTGG - Intronic
1157427347 18:47595287-47595309 GACTGGCAGTGCCGACAGCCTGG - Intergenic
1157797342 18:50587364-50587386 GGCTGGGAGGTCTGAAATCAAGG - Intronic
1159402850 18:67959738-67959760 GGGTGGCAGTGGTGTAATCTTGG - Intergenic
1159663363 18:71126928-71126950 GGAGTGCAGTGGTGAAATCCCGG + Intergenic
1160035957 18:75302069-75302091 GGCTCGCAGGGCTGAAATCAAGG + Intergenic
1160714531 19:570368-570390 GGCTGCCAGTCCTGAACTCCTGG + Intergenic
1160811124 19:1013358-1013380 GGCTGGCGCTGCTGACACCCAGG - Intronic
1161220945 19:3117896-3117918 GGCCGGCAGGGCTGGGATCCGGG - Intronic
1163301627 19:16450999-16451021 GGATGGCAGTGGTGCAATCTTGG + Intronic
1164407378 19:27963316-27963338 GGCTGGCTGTGCTGTCATCTAGG - Intergenic
1164828121 19:31299142-31299164 GGAGTGCAGTGGTGAAATCCCGG - Intronic
1165025548 19:32958626-32958648 GGAGGGCAGTGGTGCAATCCTGG - Intronic
1166325112 19:42044885-42044907 GGCCTGCAGTGGTGAAATCTCGG - Intronic
1166815528 19:45542722-45542744 GGCAGGCAGTGGTGCGATCCTGG + Intronic
1166882031 19:45935514-45935536 GGCTCGCTGTCCTGAAAGCCTGG - Exonic
1166916472 19:46199000-46199022 GGCTGGCAGAGCTGGGCTCCTGG - Intergenic
927003677 2:18825791-18825813 GGATGGCAGTGCTGAGGTCTAGG - Intergenic
928407071 2:31022932-31022954 GACTGTCAGTGCTGAGCTCCTGG - Intronic
929945324 2:46367103-46367125 ATCTGGCAGTTCTGAAATCTAGG + Intronic
930675877 2:54199773-54199795 GGCTGCCTGGGTTGAAATCCTGG - Intronic
930877747 2:56238364-56238386 GGAGGGCAGTGCTGCAATCTTGG - Intronic
932146301 2:69320735-69320757 GGCATGCAGTGCTGCAATCTTGG - Exonic
934730784 2:96655758-96655780 GGATTGCAGTGGTGCAATCCCGG + Intergenic
936345793 2:111673908-111673930 GGCCGGCAGTGTTTAAATGCTGG - Intergenic
936625362 2:114142549-114142571 GGCTTTCAGGGCTGAGATCCAGG - Intergenic
937530292 2:122819760-122819782 GGAGTGCAGTGCTGCAATCCCGG + Intergenic
937681391 2:124648340-124648362 GGGTGGGTGTGCTGAGATCCTGG - Intronic
938998780 2:136709199-136709221 GGCTGGCTTTGCTTAAATTCAGG + Intergenic
940019160 2:149139095-149139117 TGCTGGCAGTCCTGAACTCAAGG + Intronic
940367810 2:152868213-152868235 GGCTTGCTGTGGTAAAATCCAGG - Intergenic
942004184 2:171681116-171681138 GACTGGCAGTGCGGAAATTCAGG - Intergenic
943665241 2:190602245-190602267 GGCTGGCAGGCCGGAAATTCAGG + Intergenic
945294772 2:208159799-208159821 GGCTGGTAGTGTTGATCTCCTGG + Intergenic
947508098 2:230725313-230725335 GGCTGGGATTGGTGAAGTCCTGG - Intronic
1168819419 20:763050-763072 GGAAGGCAGGGCCGAAATCCTGG + Intronic
1169119062 20:3084497-3084519 AGCGGGCAGTGCTGACACCCTGG - Intronic
1171542971 20:25978586-25978608 GGCTGTCAGGGCTGTAAGCCTGG - Intergenic
1171846011 20:30275231-30275253 GGCTGTCAGGGCTGTAAGCCTGG - Intergenic
1172018746 20:31897659-31897681 GCCTGGCAGGGATGAAAGCCTGG + Intronic
1172459873 20:35109519-35109541 GGCTGGCAGGTTTGAAACCCAGG + Intergenic
1172986608 20:38996597-38996619 GGAGGCCAGTTCTGAAATCCAGG + Intronic
1173429160 20:42970456-42970478 GACAGGTTGTGCTGAAATCCTGG + Intronic
1173555700 20:43964134-43964156 GGCTGCCAGGGTTCAAATCCTGG - Intronic
1173749197 20:45463260-45463282 GGCTGGCATGACTGAAAGCCTGG + Intergenic
1173815784 20:45987242-45987264 GTCTGCCAGAGCTCAAATCCTGG - Intergenic
1174381030 20:50155531-50155553 GACTGGTAGTGCAGGAATCCAGG - Intergenic
1174830524 20:53807970-53807992 GCCTGTCTGGGCTGAAATCCTGG + Intergenic
1175818450 20:61895868-61895890 GTGTGGCAGTGCTGACATCATGG + Intronic
1176236478 20:64056016-64056038 GGCTGGCAGGGCTGCATTTCTGG + Intronic
1176652471 21:9563520-9563542 GGCTGCCTGTGCTTAGATCCTGG - Intergenic
1178601357 21:33997537-33997559 GGCTGGCAGTCTGGAAACCCAGG + Intergenic
1178623595 21:34197604-34197626 GGCTGGTCTTGCTGAACTCCTGG - Intergenic
1178806853 21:35846496-35846518 CGCTGGCTGTGCTGAAAGCGTGG + Intronic
1178935596 21:36859071-36859093 GGATTGCAGTGGTGAGATCCTGG + Intronic
1179899351 21:44380987-44381009 GGATGGGGGTGCTGAAAGCCAGG + Intronic
1181007690 22:20021714-20021736 GGCTGGCAGGGCTGCACTCAGGG + Intronic
1181481370 22:23201311-23201333 TGCTGGCAGTGCTTACCTCCTGG + Intronic
1182194567 22:28502730-28502752 GGCTGTCAGTGCAGAAATCCTGG + Intronic
1183831868 22:40422517-40422539 GGCAGGCAGTGCTGAAAGCAGGG + Intronic
1184127399 22:42497373-42497395 GCCAGGCAGTGGTGCAATCCTGG - Intergenic
1184374471 22:44103048-44103070 GGGTGGCACTGCAGACATCCAGG - Intronic
1184444897 22:44541305-44541327 GGCTGGCAGTGCTCATCTACAGG - Intergenic
1184754782 22:46509630-46509652 CGCTGGCACTGCTGATATTCAGG - Intronic
1185355319 22:50365778-50365800 GGATTGCAGTGGTGCAATCCTGG + Intronic
950464693 3:13146413-13146435 GCCTGGCTGTGCTAAATTCCTGG - Intergenic
950543060 3:13623686-13623708 GCCTGCCTGTGCTGAAATCCTGG + Intronic
951694226 3:25428776-25428798 GACTCGCAGTGTAGAAATCCAGG - Exonic
958844351 3:99248123-99248145 GGATGGCAGAGCAGAAATACAGG - Intergenic
960963918 3:123091517-123091539 GGCTGGCAGTGCTGAAATCCTGG + Intronic
962361714 3:134748694-134748716 GATGGGCAGTGCTGAAGTCCTGG + Intronic
963160311 3:142144321-142144343 GGCTGGCAGTGGTGCAATCTCGG - Intronic
966024560 3:175259975-175259997 GGAGTGCAGTGGTGAAATCCTGG - Intronic
966183023 3:177204057-177204079 GGCCGGCAGTGCTGGGGTCCTGG + Intergenic
968504913 4:967235-967257 GGCTGGGAGTGCTGTGATCTCGG - Exonic
968562020 4:1289263-1289285 GGCGGGCAGCGCTGGCATCCAGG - Intergenic
969133849 4:5013756-5013778 GGCTAGAAGTTCTGAAATCGAGG - Intergenic
969617757 4:8263258-8263280 GGCTAGCGATGCTGCAATCCAGG - Intergenic
970865159 4:20749963-20749985 GGCTGGCAATGCTGTAGTCTTGG + Intronic
973243651 4:47986353-47986375 GGCTGGCAGTGGTGCAATCTCGG - Intronic
973646655 4:52956931-52956953 GGCTGGAGTTGCTGAAATCCTGG + Intronic
974638560 4:64598103-64598125 TGCTGGTATTTCTGAAATCCAGG - Intergenic
977623287 4:99162285-99162307 GGCTGGCAGGTCTAAAATCAAGG + Intergenic
979185883 4:117792273-117792295 GACTGCCTGGGCTGAAATCCTGG - Intergenic
979389298 4:120108680-120108702 GACAGGCAGTGATGAAATCGGGG - Intergenic
979536196 4:121823461-121823483 CGCTGGCGGTACTGAAGTCCGGG - Exonic
981080818 4:140637396-140637418 GGCTGGCTGTACAGAAGTCCTGG - Intronic
981250911 4:142599204-142599226 TGCTGCCACTACTGAAATCCAGG + Intronic
982210025 4:153026883-153026905 GGCTGGCAGAGATGATATCCTGG - Intergenic
986721797 5:10565144-10565166 GGCTGCCCGTGCTGCAATCCAGG + Intronic
987096950 5:14558673-14558695 GTCTGGCAGTGGTGCAATCTCGG - Intergenic
991978860 5:72211087-72211109 GACTTTCAGTGCTGAAATCAGGG - Intergenic
993248152 5:85478888-85478910 GTATGACAGTGCTGAAAACCTGG + Intergenic
993806676 5:92419122-92419144 TGCTGCCAGTACTGAGATCCTGG - Intergenic
996189675 5:120524151-120524173 GCTTAGCAGTGTTGAAATCCTGG - Intronic
996730132 5:126709402-126709424 GGAGGGCAGTGGTGAAATCTCGG + Intergenic
997025777 5:130059286-130059308 GGCTGGCAGGCTTGAAATTCAGG - Intronic
997641651 5:135452472-135452494 GGCTGGCAGAACTGAAACCCAGG - Intergenic
997726100 5:136120900-136120922 GGCTGGCAGTGTTGGAGTCCAGG + Intergenic
999092740 5:148951921-148951943 GGGTGGCAATGCTGGGATCCTGG - Intronic
1000025122 5:157352383-157352405 GGCGGGCAGTGTTGGCATCCAGG - Intronic
1000248362 5:159469215-159469237 GGCTGGCAATGTGGAAATGCTGG + Intergenic
1000369408 5:160520294-160520316 GGATGGCAGAGCAGAAATGCAGG + Intergenic
1000780836 5:165478750-165478772 GGATGGCAGTGGTGCAATCTTGG + Intergenic
1001444718 5:171774506-171774528 GCGTGGGACTGCTGAAATCCAGG - Exonic
1001599536 5:172920019-172920041 GGCTGCCTGTGTTAAAATCCTGG - Intronic
1003561522 6:7184637-7184659 GGCTGGCAGTGCTGTGCTGCAGG - Intronic
1004224949 6:13776663-13776685 GGCTGGGAGGTCTGAAATCATGG - Intergenic
1006205864 6:32342213-32342235 GGATGGCAGTGTTGCGATCCTGG + Intronic
1007108128 6:39297255-39297277 GCCTGCCTGTGTTGAAATCCTGG - Intergenic
1008706436 6:54166005-54166027 GGCTGGGAGGTCTAAAATCCAGG - Intronic
1008735544 6:54539272-54539294 TGCTGGCACTGCTGTACTCCAGG + Intergenic
1010455524 6:76050096-76050118 GAGTGGCAGTTCTGAAATACTGG + Intronic
1011747160 6:90417599-90417621 GGCTGCTAGTGCTGAAGTCTGGG + Intergenic
1013131235 6:107234905-107234927 GGCTGGAAGTGCTGATTTTCAGG - Intronic
1013196567 6:107849435-107849457 GGCTGGCAGTGGTGTAATCTCGG - Intergenic
1013768632 6:113601769-113601791 GGCTGGGAATGCTGAGATCAAGG - Intergenic
1014851200 6:126341419-126341441 GGGTGGCAGTGGAGAAGTCCAGG - Intronic
1015708020 6:136109286-136109308 GGAAGGCAGTGGTGCAATCCTGG - Intronic
1016109975 6:140210713-140210735 GGAGTGCAGTGGTGAAATCCCGG - Intergenic
1016469693 6:144362166-144362188 GGGTGGGAATGCTGAGATCCTGG + Intronic
1016914573 6:149232963-149232985 GGCAGGCACAGCTGACATCCTGG + Intronic
1017047531 6:150361228-150361250 TGCTGCCAGTGCTCTAATCCAGG + Intergenic
1017923992 6:158895323-158895345 TGCAGGTAGTGCTGAAATCCTGG - Exonic
1018553051 6:165020939-165020961 GTCTTGCAAGGCTGAAATCCAGG + Intergenic
1018773328 6:166991710-166991732 GGCTAGCAGGCTTGAAATCCAGG - Intergenic
1018840726 6:167514403-167514425 GGCTGGCAGAGCTGGGATACTGG + Intergenic
1019479362 7:1259588-1259610 GGCTGACCCTGCTGCAATCCAGG + Intergenic
1020203612 7:6099091-6099113 GGCAGACAGTCCTGAAAACCAGG - Intergenic
1023499504 7:40832575-40832597 GGCTAGGAGTGCTCACATCCGGG - Intronic
1025294351 7:57763694-57763716 GGCTGTCAGGGCTGTAAGCCTGG - Intergenic
1026843945 7:73686875-73686897 GCATGGCAGGGCTGATATCCAGG - Exonic
1027221775 7:76218727-76218749 GGATTGCAGTGGTGAAATCTCGG + Intronic
1028169249 7:87575950-87575972 GGTTGACAGAGCTGAATTCCTGG - Intronic
1029091951 7:98055451-98055473 GGATTGCAGTGGTGCAATCCTGG - Intergenic
1030582218 7:111372065-111372087 GACTGGCAGTTGTGTAATCCTGG - Intronic
1031002437 7:116432498-116432520 GATTGGCACTGCTGCAATCCAGG - Intronic
1031003043 7:116439458-116439480 GACTGGCAGAGCTCAGATCCTGG + Intronic
1031067991 7:117128228-117128250 GGTTGGCAGTGGTGAGGTCCAGG + Intronic
1033562282 7:142544201-142544223 GGCTGGGAGAGATGAGATCCTGG + Intergenic
1037526360 8:19728073-19728095 GGCTGCCAGGGCTTAAATCTGGG + Intronic
1040005767 8:42619406-42619428 GGGTGCCAGTGCTGAAGGCCAGG - Intergenic
1040552458 8:48449084-48449106 GGCTGTCAGTGGCCAAATCCAGG - Intergenic
1041078177 8:54188037-54188059 GGCTGGCAGTGGTGCGATCTCGG - Intergenic
1042945832 8:74153645-74153667 GGCAGGCTGTGCTGAAAATCAGG + Intergenic
1044478755 8:92660066-92660088 GTCTGGCTGTGCTAAAATCAAGG - Intergenic
1044877192 8:96681335-96681357 GGCTGGAGCTGCTGAAATGCAGG - Intronic
1045520706 8:102900636-102900658 TGCTGGCTGTGTTGGAATCCTGG - Intronic
1047228133 8:122973781-122973803 GGCAGGAAGGGCTGAAATCCAGG + Exonic
1048616709 8:136082805-136082827 GGGTGGTTGTGCTGAAATACTGG - Intergenic
1049707794 8:144050870-144050892 GGCGGGCAGTGCCTACATCCAGG - Intergenic
1049713854 8:144080291-144080313 CGCTGGCAGTGCTGGATGCCGGG + Exonic
1050214899 9:3311831-3311853 GGCTTGCAGTGGTGCAATCTTGG - Intronic
1053527530 9:38845121-38845143 GGCTGGCAGAGCTGGGATCGGGG + Intergenic
1054162068 9:61680611-61680633 GGCTGTCAGGGCTGTAAGCCTGG + Intergenic
1054199755 9:62069550-62069572 GGCTGGCAGAGCTGGGATCGGGG + Intergenic
1054638600 9:67518807-67518829 GGCTGGCAGAGCTGGGATCGGGG - Intergenic
1054865221 9:69993304-69993326 GGCAGGCAGTTCTGAAAAGCTGG - Intergenic
1054921428 9:70546540-70546562 GCCTGGCAATGGTGAAAGCCTGG + Intronic
1056958194 9:91099352-91099374 AGCAGGCAGTGGTTAAATCCTGG + Intergenic
1057182831 9:93039136-93039158 GGCTGGCGGTTCTGAAGGCCAGG - Intergenic
1058454816 9:105129189-105129211 AGCAGGCAAAGCTGAAATCCAGG + Intergenic
1060984175 9:127810132-127810154 GGCAGGCAGTCCTGAAGCCCTGG + Intronic
1061083807 9:128387579-128387601 ACCTGGCACTGCTGAAGTCCTGG - Intronic
1062016028 9:134291831-134291853 GCAGGGCTGTGCTGAAATCCAGG + Intergenic
1062040401 9:134401855-134401877 GGCTGCCAGTGCTGAAGCCCAGG - Exonic
1203630201 Un_KI270750v1:67061-67083 GGCTGCCTGTGCTTAGATCCTGG - Intergenic
1185700400 X:2227133-2227155 GCCAGGCAGTGCTGAGAACCGGG + Intronic
1185717099 X:2351684-2351706 GGCTCTCAGTGCTGGAACCCTGG + Intronic
1187673712 X:21694216-21694238 GGCTGGCTGTGGTGATATGCTGG + Intergenic
1187832859 X:23400425-23400447 GGAGGGCAGTGGTGAAATCTCGG - Exonic
1188317108 X:28688417-28688439 GGCTAGTAGTGTTGAACTCCTGG + Intronic
1188542365 X:31265290-31265312 GGCTTGCATTGCTGGAATACTGG + Intronic
1188620144 X:32210814-32210836 GGCTGCGAGTGCTGAAAGCAAGG + Intronic
1190090209 X:47430665-47430687 GGAGGGCAGTGGTGAAATCTCGG - Intergenic
1193928102 X:87516063-87516085 TGCTGGCAGACTTGAAATCCAGG + Intergenic
1195966325 X:110433147-110433169 CGCTGAGAGTGCTGAAAACCAGG + Intronic
1196403302 X:115338421-115338443 GGCGGGCAGTGGTGCAATCGTGG - Intergenic
1196920356 X:120579065-120579087 GGCTGGAAGTTCTGAATGCCTGG - Intergenic
1197737392 X:129861868-129861890 GGATTGCAGTGCTGCAATCTTGG + Intergenic
1198652275 X:138875797-138875819 GGCTGGCAGTGCTGAGACACAGG - Intronic
1199551612 X:149067542-149067564 GGCTGGCAGCCTGGAAATCCAGG + Intergenic
1199552748 X:149076451-149076473 GGCTGTCATTGATAAAATCCAGG + Intergenic
1199685996 X:150266216-150266238 GGCTGGCATTGGTGAAAAGCAGG - Intergenic
1200933949 Y:8722055-8722077 GGATGAGAGTTCTGAAATCCAGG - Intergenic
1200963191 Y:9013612-9013634 GGCTGACAGTTCTGAGAGCCGGG - Intergenic