ID: 960964874

View in Genome Browser
Species Human (GRCh38)
Location 3:123097777-123097799
Sequence ATGGCAAGCTTCTGGCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 157}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960964874_960964885 25 Left 960964874 3:123097777-123097799 CCACCTGGCCAGAAGCTTGCCAT 0: 1
1: 0
2: 0
3: 11
4: 157
Right 960964885 3:123097825-123097847 GAGAGTTATCCCTTCTTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 129
960964874_960964879 -7 Left 960964874 3:123097777-123097799 CCACCTGGCCAGAAGCTTGCCAT 0: 1
1: 0
2: 0
3: 11
4: 157
Right 960964879 3:123097793-123097815 TTGCCATGTTAGACCAGGGCTGG 0: 1
1: 0
2: 1
3: 4
4: 103
960964874_960964883 0 Left 960964874 3:123097777-123097799 CCACCTGGCCAGAAGCTTGCCAT 0: 1
1: 0
2: 0
3: 11
4: 157
Right 960964883 3:123097800-123097822 GTTAGACCAGGGCTGGTGGGAGG 0: 1
1: 0
2: 1
3: 25
4: 264
960964874_960964882 -3 Left 960964874 3:123097777-123097799 CCACCTGGCCAGAAGCTTGCCAT 0: 1
1: 0
2: 0
3: 11
4: 157
Right 960964882 3:123097797-123097819 CATGTTAGACCAGGGCTGGTGGG 0: 1
1: 0
2: 1
3: 3
4: 119
960964874_960964881 -4 Left 960964874 3:123097777-123097799 CCACCTGGCCAGAAGCTTGCCAT 0: 1
1: 0
2: 0
3: 11
4: 157
Right 960964881 3:123097796-123097818 CCATGTTAGACCAGGGCTGGTGG 0: 1
1: 0
2: 1
3: 13
4: 229
960964874_960964887 27 Left 960964874 3:123097777-123097799 CCACCTGGCCAGAAGCTTGCCAT 0: 1
1: 0
2: 0
3: 11
4: 157
Right 960964887 3:123097827-123097849 GAGTTATCCCTTCTTTGATGGGG 0: 1
1: 0
2: 0
3: 12
4: 127
960964874_960964886 26 Left 960964874 3:123097777-123097799 CCACCTGGCCAGAAGCTTGCCAT 0: 1
1: 0
2: 0
3: 11
4: 157
Right 960964886 3:123097826-123097848 AGAGTTATCCCTTCTTTGATGGG 0: 1
1: 0
2: 0
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960964874 Original CRISPR ATGGCAAGCTTCTGGCCAGG TGG (reversed) Intronic