ID: 960964875

View in Genome Browser
Species Human (GRCh38)
Location 3:123097780-123097802
Sequence AACATGGCAAGCTTCTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 179}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960964875_960964886 23 Left 960964875 3:123097780-123097802 CCTGGCCAGAAGCTTGCCATGTT 0: 1
1: 0
2: 2
3: 9
4: 179
Right 960964886 3:123097826-123097848 AGAGTTATCCCTTCTTTGATGGG 0: 1
1: 0
2: 0
3: 8
4: 109
960964875_960964888 30 Left 960964875 3:123097780-123097802 CCTGGCCAGAAGCTTGCCATGTT 0: 1
1: 0
2: 2
3: 9
4: 179
Right 960964888 3:123097833-123097855 TCCCTTCTTTGATGGGGAAATGG 0: 1
1: 0
2: 2
3: 24
4: 519
960964875_960964887 24 Left 960964875 3:123097780-123097802 CCTGGCCAGAAGCTTGCCATGTT 0: 1
1: 0
2: 2
3: 9
4: 179
Right 960964887 3:123097827-123097849 GAGTTATCCCTTCTTTGATGGGG 0: 1
1: 0
2: 0
3: 12
4: 127
960964875_960964881 -7 Left 960964875 3:123097780-123097802 CCTGGCCAGAAGCTTGCCATGTT 0: 1
1: 0
2: 2
3: 9
4: 179
Right 960964881 3:123097796-123097818 CCATGTTAGACCAGGGCTGGTGG 0: 1
1: 0
2: 1
3: 13
4: 229
960964875_960964879 -10 Left 960964875 3:123097780-123097802 CCTGGCCAGAAGCTTGCCATGTT 0: 1
1: 0
2: 2
3: 9
4: 179
Right 960964879 3:123097793-123097815 TTGCCATGTTAGACCAGGGCTGG 0: 1
1: 0
2: 1
3: 4
4: 103
960964875_960964885 22 Left 960964875 3:123097780-123097802 CCTGGCCAGAAGCTTGCCATGTT 0: 1
1: 0
2: 2
3: 9
4: 179
Right 960964885 3:123097825-123097847 GAGAGTTATCCCTTCTTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 129
960964875_960964882 -6 Left 960964875 3:123097780-123097802 CCTGGCCAGAAGCTTGCCATGTT 0: 1
1: 0
2: 2
3: 9
4: 179
Right 960964882 3:123097797-123097819 CATGTTAGACCAGGGCTGGTGGG 0: 1
1: 0
2: 1
3: 3
4: 119
960964875_960964883 -3 Left 960964875 3:123097780-123097802 CCTGGCCAGAAGCTTGCCATGTT 0: 1
1: 0
2: 2
3: 9
4: 179
Right 960964883 3:123097800-123097822 GTTAGACCAGGGCTGGTGGGAGG 0: 1
1: 0
2: 1
3: 25
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960964875 Original CRISPR AACATGGCAAGCTTCTGGCC AGG (reversed) Intronic