ID: 960964876

View in Genome Browser
Species Human (GRCh38)
Location 3:123097785-123097807
Sequence GGTCTAACATGGCAAGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 49}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960964876_960964886 18 Left 960964876 3:123097785-123097807 CCAGAAGCTTGCCATGTTAGACC 0: 1
1: 0
2: 1
3: 3
4: 49
Right 960964886 3:123097826-123097848 AGAGTTATCCCTTCTTTGATGGG 0: 1
1: 0
2: 0
3: 8
4: 109
960964876_960964883 -8 Left 960964876 3:123097785-123097807 CCAGAAGCTTGCCATGTTAGACC 0: 1
1: 0
2: 1
3: 3
4: 49
Right 960964883 3:123097800-123097822 GTTAGACCAGGGCTGGTGGGAGG 0: 1
1: 0
2: 1
3: 25
4: 264
960964876_960964885 17 Left 960964876 3:123097785-123097807 CCAGAAGCTTGCCATGTTAGACC 0: 1
1: 0
2: 1
3: 3
4: 49
Right 960964885 3:123097825-123097847 GAGAGTTATCCCTTCTTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 129
960964876_960964888 25 Left 960964876 3:123097785-123097807 CCAGAAGCTTGCCATGTTAGACC 0: 1
1: 0
2: 1
3: 3
4: 49
Right 960964888 3:123097833-123097855 TCCCTTCTTTGATGGGGAAATGG 0: 1
1: 0
2: 2
3: 24
4: 519
960964876_960964887 19 Left 960964876 3:123097785-123097807 CCAGAAGCTTGCCATGTTAGACC 0: 1
1: 0
2: 1
3: 3
4: 49
Right 960964887 3:123097827-123097849 GAGTTATCCCTTCTTTGATGGGG 0: 1
1: 0
2: 0
3: 12
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960964876 Original CRISPR GGTCTAACATGGCAAGCTTC TGG (reversed) Intronic