ID: 960964880

View in Genome Browser
Species Human (GRCh38)
Location 3:123097796-123097818
Sequence CCACCAGCCCTGGTCTAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 210}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960964880_960964885 6 Left 960964880 3:123097796-123097818 CCATGTTAGACCAGGGCTGGTGG 0: 1
1: 0
2: 1
3: 20
4: 210
Right 960964885 3:123097825-123097847 GAGAGTTATCCCTTCTTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 129
960964880_960964887 8 Left 960964880 3:123097796-123097818 CCATGTTAGACCAGGGCTGGTGG 0: 1
1: 0
2: 1
3: 20
4: 210
Right 960964887 3:123097827-123097849 GAGTTATCCCTTCTTTGATGGGG 0: 1
1: 0
2: 0
3: 12
4: 127
960964880_960964891 25 Left 960964880 3:123097796-123097818 CCATGTTAGACCAGGGCTGGTGG 0: 1
1: 0
2: 1
3: 20
4: 210
Right 960964891 3:123097844-123097866 ATGGGGAAATGGAACTAGAGAGG 0: 1
1: 0
2: 2
3: 33
4: 360
960964880_960964888 14 Left 960964880 3:123097796-123097818 CCATGTTAGACCAGGGCTGGTGG 0: 1
1: 0
2: 1
3: 20
4: 210
Right 960964888 3:123097833-123097855 TCCCTTCTTTGATGGGGAAATGG 0: 1
1: 0
2: 2
3: 24
4: 519
960964880_960964892 29 Left 960964880 3:123097796-123097818 CCATGTTAGACCAGGGCTGGTGG 0: 1
1: 0
2: 1
3: 20
4: 210
Right 960964892 3:123097848-123097870 GGAAATGGAACTAGAGAGGCTGG 0: 1
1: 0
2: 3
3: 49
4: 483
960964880_960964886 7 Left 960964880 3:123097796-123097818 CCATGTTAGACCAGGGCTGGTGG 0: 1
1: 0
2: 1
3: 20
4: 210
Right 960964886 3:123097826-123097848 AGAGTTATCCCTTCTTTGATGGG 0: 1
1: 0
2: 0
3: 8
4: 109
960964880_960964893 30 Left 960964880 3:123097796-123097818 CCATGTTAGACCAGGGCTGGTGG 0: 1
1: 0
2: 1
3: 20
4: 210
Right 960964893 3:123097849-123097871 GAAATGGAACTAGAGAGGCTGGG 0: 1
1: 0
2: 2
3: 23
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960964880 Original CRISPR CCACCAGCCCTGGTCTAACA TGG (reversed) Intronic