ID: 960964884

View in Genome Browser
Species Human (GRCh38)
Location 3:123097806-123097828
Sequence TCTCTTCCTCCCACCAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 780
Summary {0: 1, 1: 0, 2: 7, 3: 78, 4: 694}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960964884_960964894 21 Left 960964884 3:123097806-123097828 CCAGGGCTGGTGGGAGGAAGAGA 0: 1
1: 0
2: 7
3: 78
4: 694
Right 960964894 3:123097850-123097872 AAATGGAACTAGAGAGGCTGGGG 0: 1
1: 0
2: 2
3: 40
4: 371
960964884_960964888 4 Left 960964884 3:123097806-123097828 CCAGGGCTGGTGGGAGGAAGAGA 0: 1
1: 0
2: 7
3: 78
4: 694
Right 960964888 3:123097833-123097855 TCCCTTCTTTGATGGGGAAATGG 0: 1
1: 0
2: 2
3: 24
4: 519
960964884_960964892 19 Left 960964884 3:123097806-123097828 CCAGGGCTGGTGGGAGGAAGAGA 0: 1
1: 0
2: 7
3: 78
4: 694
Right 960964892 3:123097848-123097870 GGAAATGGAACTAGAGAGGCTGG 0: 1
1: 0
2: 3
3: 49
4: 483
960964884_960964895 30 Left 960964884 3:123097806-123097828 CCAGGGCTGGTGGGAGGAAGAGA 0: 1
1: 0
2: 7
3: 78
4: 694
Right 960964895 3:123097859-123097881 TAGAGAGGCTGGGGTAGTCGTGG 0: 1
1: 0
2: 2
3: 13
4: 165
960964884_960964887 -2 Left 960964884 3:123097806-123097828 CCAGGGCTGGTGGGAGGAAGAGA 0: 1
1: 0
2: 7
3: 78
4: 694
Right 960964887 3:123097827-123097849 GAGTTATCCCTTCTTTGATGGGG 0: 1
1: 0
2: 0
3: 12
4: 127
960964884_960964893 20 Left 960964884 3:123097806-123097828 CCAGGGCTGGTGGGAGGAAGAGA 0: 1
1: 0
2: 7
3: 78
4: 694
Right 960964893 3:123097849-123097871 GAAATGGAACTAGAGAGGCTGGG 0: 1
1: 0
2: 2
3: 23
4: 315
960964884_960964891 15 Left 960964884 3:123097806-123097828 CCAGGGCTGGTGGGAGGAAGAGA 0: 1
1: 0
2: 7
3: 78
4: 694
Right 960964891 3:123097844-123097866 ATGGGGAAATGGAACTAGAGAGG 0: 1
1: 0
2: 2
3: 33
4: 360
960964884_960964886 -3 Left 960964884 3:123097806-123097828 CCAGGGCTGGTGGGAGGAAGAGA 0: 1
1: 0
2: 7
3: 78
4: 694
Right 960964886 3:123097826-123097848 AGAGTTATCCCTTCTTTGATGGG 0: 1
1: 0
2: 0
3: 8
4: 109
960964884_960964885 -4 Left 960964884 3:123097806-123097828 CCAGGGCTGGTGGGAGGAAGAGA 0: 1
1: 0
2: 7
3: 78
4: 694
Right 960964885 3:123097825-123097847 GAGAGTTATCCCTTCTTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960964884 Original CRISPR TCTCTTCCTCCCACCAGCCC TGG (reversed) Intronic