ID: 960964885

View in Genome Browser
Species Human (GRCh38)
Location 3:123097825-123097847
Sequence GAGAGTTATCCCTTCTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 129}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960964876_960964885 17 Left 960964876 3:123097785-123097807 CCAGAAGCTTGCCATGTTAGACC 0: 1
1: 0
2: 1
3: 3
4: 49
Right 960964885 3:123097825-123097847 GAGAGTTATCCCTTCTTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 129
960964875_960964885 22 Left 960964875 3:123097780-123097802 CCTGGCCAGAAGCTTGCCATGTT 0: 1
1: 0
2: 2
3: 9
4: 179
Right 960964885 3:123097825-123097847 GAGAGTTATCCCTTCTTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 129
960964874_960964885 25 Left 960964874 3:123097777-123097799 CCACCTGGCCAGAAGCTTGCCAT 0: 1
1: 0
2: 0
3: 11
4: 157
Right 960964885 3:123097825-123097847 GAGAGTTATCCCTTCTTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 129
960964884_960964885 -4 Left 960964884 3:123097806-123097828 CCAGGGCTGGTGGGAGGAAGAGA 0: 1
1: 0
2: 7
3: 78
4: 694
Right 960964885 3:123097825-123097847 GAGAGTTATCCCTTCTTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 129
960964880_960964885 6 Left 960964880 3:123097796-123097818 CCATGTTAGACCAGGGCTGGTGG 0: 1
1: 0
2: 1
3: 20
4: 210
Right 960964885 3:123097825-123097847 GAGAGTTATCCCTTCTTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960964885 Original CRISPR GAGAGTTATCCCTTCTTTGA TGG Intronic
900732779 1:4273535-4273557 GAGAATTATCCCCCCTTTCATGG + Intergenic
908604874 1:65786379-65786401 GAGAATTATCCATTCTTCAACGG + Intergenic
908879555 1:68715352-68715374 AACAGTTATGCCTACTTTGAGGG + Intergenic
910434469 1:87191270-87191292 AACAGTTATCTCTACTTTGAGGG + Intergenic
911488421 1:98531406-98531428 GAGAGTAATCACTCCTATGAAGG + Intergenic
912426333 1:109595189-109595211 GAGACTAATGGCTTCTTTGATGG - Exonic
915255676 1:154627126-154627148 GACAGGTATCCCTTTTTGGAAGG + Intronic
917916409 1:179706821-179706843 TATAGTTATCTATTCTTTGAAGG + Intergenic
918011153 1:180587678-180587700 GAGAGTTATACGTTCTTAGAGGG - Intergenic
918871046 1:189975646-189975668 GATATTTATCCCTTCTCAGATGG + Intergenic
919300720 1:195761281-195761303 GAGATTAATCCCTTTCTTGAAGG + Intergenic
919445274 1:197696986-197697008 GAAAATTAATCCTTCTTTGAAGG - Intronic
919614012 1:199782454-199782476 GAGTGTTATTGCTTCTCTGAAGG + Intergenic
919899979 1:202037080-202037102 CAGAGTGATCCCTTCTCTCAAGG + Intergenic
920820132 1:209372685-209372707 GAGAGTTCTCTCTTCCTTGGAGG + Intergenic
922114970 1:222604474-222604496 GTGACTTTTTCCTTCTTTGAAGG + Intergenic
922970236 1:229729797-229729819 GATAGTTATCCCCTCATGGAAGG - Intergenic
1065191548 10:23215279-23215301 AAAAGATATCTCTTCTTTGATGG - Intronic
1066074454 10:31859097-31859119 GAGAGTTATTCCCTCTGAGAAGG + Intronic
1067176990 10:43957098-43957120 GAGAGTACTCCCTATTTTGAGGG - Intergenic
1068555090 10:58449633-58449655 GTGAGTTATCTATTCTTTAATGG - Intergenic
1077887274 11:6395343-6395365 CAGTGTTATCACTTCCTTGAAGG + Exonic
1079884980 11:25976147-25976169 GACAATTATCCCATCTTTGTGGG + Intergenic
1082851199 11:57766544-57766566 GTCATTTAACCCTTCTTTGAGGG - Intronic
1090904278 11:131061016-131061038 GATAATTATCCCTGCCTTGAAGG + Intergenic
1090948666 11:131453315-131453337 AAGAGTTCTCCTCTCTTTGAAGG - Intronic
1091719896 12:2805129-2805151 TAAAGTTATACCTTCTTTGTAGG - Exonic
1092017541 12:5171731-5171753 GAGATTTTTCCTGTCTTTGAAGG + Intergenic
1092717682 12:11408109-11408131 GTGAGTTATCCATTCTGTGAAGG + Intronic
1095531382 12:43190441-43190463 GAGCTTTAGCCCTTCTCTGATGG - Intergenic
1098353039 12:69583666-69583688 AAGAGTTTTCTCTTCTTTGTAGG - Intergenic
1100305248 12:93344393-93344415 GAGGGTTATCCCTGGTCTGAGGG - Intergenic
1100755408 12:97745886-97745908 GAGAGGTTTCAGTTCTTTGAGGG - Intergenic
1101298599 12:103453140-103453162 GGGAGTTAACACTTCTTTTATGG - Intronic
1102075435 12:110056298-110056320 GAGAGTTCTCTCTTCATTCAGGG - Intronic
1105530040 13:21210926-21210948 GAGAGTTCTGCCTTCGTGGATGG - Intergenic
1105675640 13:22668940-22668962 GAAAGTTTTCCTTTCTTTCATGG - Intergenic
1109771416 13:66979179-66979201 TGGAGTTTTCACTTCTTTGAGGG + Intronic
1109940033 13:69349686-69349708 GATAGAAGTCCCTTCTTTGAAGG + Intergenic
1112792909 13:103023021-103023043 GATACTTATCCCTTTTTTTATGG + Intergenic
1114736155 14:25046197-25046219 GGGTGTTACCCCTGCTTTGAGGG - Intronic
1118929824 14:70231144-70231166 GAGTGTTATGCCAGCTTTGACGG + Intergenic
1118954765 14:70470273-70470295 GAGTGTTATGCCAGCTTTGATGG - Intergenic
1121023871 14:90600157-90600179 GAGAAATATGCCTGCTTTGAGGG - Intronic
1122148636 14:99709165-99709187 GAGAGTTATTGTTTCTTTGAAGG - Intronic
1125956513 15:43794109-43794131 AAGAGTTCTCCCTTTTTTGGTGG - Exonic
1126214549 15:46139401-46139423 GAGAGTTGACTCATCTTTGAAGG + Intergenic
1127114820 15:55715593-55715615 GACATTTATCTCTTCTTTTAAGG - Intronic
1137454984 16:48611088-48611110 GAGAGTGATTTCTTCTGTGAGGG + Intronic
1140159817 16:72477405-72477427 TAGATTCATCCCTTCTCTGATGG + Intergenic
1143272141 17:5683657-5683679 GAGAGTAATACCTTCTTGGGGGG - Intergenic
1145116676 17:20216775-20216797 GAGAGTGATTCCTTTTTTCAAGG + Intronic
1145170413 17:20651659-20651681 GAGAGTGATCCCGACTTTGGAGG - Intergenic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1149059276 17:52403391-52403413 GAGAGAAATCCCTGCTTTGATGG + Intergenic
1155540959 18:26867723-26867745 GAGGGTGACCCCTTCCTTGATGG - Intergenic
1156877199 18:42029339-42029361 CAGAGTTATGCGTTCTTTGCTGG + Exonic
1158883442 18:61803490-61803512 GAGAATTACCCTTTCTTTGGGGG - Intergenic
1160370109 18:78365011-78365033 GAGAAATATCCCTGCTATGATGG + Intergenic
925534600 2:4902682-4902704 GTGAGTTTTCCCTTCGTGGAAGG + Intergenic
926589859 2:14729143-14729165 AAGGGTTAACCCTTCTTTGTAGG - Intergenic
928051439 2:28000613-28000635 GGGAGTTATGCCCTCTTTGAGGG + Intronic
928304263 2:30153415-30153437 GATAGTAATCCCATTTTTGAGGG + Intronic
928932162 2:36636083-36636105 GAGATTTATCCCCACTTGGATGG - Intronic
929381030 2:41354154-41354176 GAGATTTAGACCTTCTTTTATGG - Intergenic
936339575 2:111618946-111618968 GAGAGATGTCCCATCTCTGAGGG - Intergenic
936630993 2:114202532-114202554 GATTGTTATCCATCCTTTGATGG - Intergenic
944076197 2:195733857-195733879 GAAAATTATCACATCTTTGAAGG - Intronic
946706751 2:222465861-222465883 GAGAGGTGTTGCTTCTTTGAGGG - Intronic
947098711 2:226595319-226595341 GAAAGTTCTTCTTTCTTTGAAGG - Intergenic
1170293214 20:14794138-14794160 GTGAGTTCTCCAGTCTTTGAGGG - Intronic
1171016834 20:21549484-21549506 GAGAATTTTCCCATCTTTAAGGG - Intergenic
1173185830 20:40839562-40839584 GTGAGTTAGCCCTGCATTGAGGG + Intergenic
1174290534 20:49505501-49505523 GGGAATTGGCCCTTCTTTGAAGG + Exonic
1178086470 21:29117294-29117316 GAAAGCTATTCCTTCTCTGATGG + Intronic
1178489756 21:33041945-33041967 GAGAGTTCTCCTTCCTTTTAAGG + Intergenic
1179305247 21:40148153-40148175 TAGAGTTATGCGTTATTTGATGG + Intronic
950983535 3:17334616-17334638 AAGAGTTAGGCTTTCTTTGAAGG - Intronic
952055734 3:29443123-29443145 TGGACTTATCCCTTCTTTAAGGG + Intronic
952877968 3:37963542-37963564 GAGAGTTTGACCTTCTTTGCAGG + Intronic
953509772 3:43524228-43524250 GAAAGTCATTCCTTCTATGAGGG - Intronic
956918698 3:73903177-73903199 GAGAGTGATGCTTTATTTGAAGG + Intergenic
957717984 3:83956684-83956706 GAGAGTCTTCTCTTCTTGGAAGG + Intergenic
957868446 3:86055657-86055679 GAGAGTTATTCCTTCATTAATGG - Intronic
960964885 3:123097825-123097847 GAGAGTTATCCCTTCTTTGATGG + Intronic
962854084 3:139328837-139328859 GACAGTAATCCCTACTTTGTAGG - Intronic
964877082 3:161379586-161379608 GAGATTTATTGCTTCATTGAAGG + Intergenic
965972097 3:174571926-174571948 TGGGGTTATCCATTCTTTGAAGG - Intronic
967476399 3:189925561-189925583 CAGGGTTATCCTTTCTTTGCTGG - Intergenic
967478917 3:189952265-189952287 AAATGTTATCCCTTCTTTTAAGG - Intergenic
967969542 3:194988795-194988817 GAAAATAATCCCTTCTTTGTGGG + Intergenic
969891163 4:10261194-10261216 GTGAGTTTTCCCATCTTTGTTGG + Intergenic
969953162 4:10861205-10861227 GATAGGTATCCATTCTTTTAAGG - Intergenic
972025354 4:34369741-34369763 GGCAGCTATTCCTTCTTTGAAGG - Intergenic
972076730 4:35099634-35099656 AAGTTTTATCCCTTCTCTGAAGG + Intergenic
972784718 4:42315646-42315668 GAGAGCCATCCCTGGTTTGAGGG + Intergenic
982078052 4:151758408-151758430 CAGTGTGATTCCTTCTTTGAAGG - Intronic
982843992 4:160226413-160226435 GTGAGTTATCTCTTCGTTGTTGG + Intergenic
983484460 4:168317733-168317755 GAGGCTTATACCTTCTTTAAAGG + Intronic
986202055 5:5587802-5587824 GAGAGTCATCCTTTCATAGAGGG + Intergenic
989271091 5:39533774-39533796 CAGAGTTAGCCCTTCTTTTAAGG + Intergenic
989716076 5:44465061-44465083 GAGATTTATCCATTTTTTGTAGG + Intergenic
990710898 5:58579020-58579042 GATAGTTATCTCTCCTTTGCTGG - Intergenic
992534658 5:77687266-77687288 CAGATTAATCCTTTCTTTGATGG - Intergenic
993799564 5:92315772-92315794 GAGAGTTAAGCCTTATTTCATGG + Intergenic
996346971 5:122498090-122498112 CAGAGTGCTCCCATCTTTGAGGG - Intergenic
996368021 5:122723468-122723490 GCAAATTCTCCCTTCTTTGAGGG + Intergenic
996823950 5:127660369-127660391 GAGAGTTAGCACTTCTTACAGGG - Intergenic
997391171 5:133517855-133517877 CAGAATTATCTCTTCTTTGCGGG + Intronic
1002342699 5:178527279-178527301 GAGAGCTCTCCCTTCTGTGCTGG + Intronic
1005531786 6:26714637-26714659 GAGTGTTATCCTTTCATTCATGG - Intergenic
1005539009 6:26787028-26787050 GAGTGTTATCCTTTCATTCATGG + Intergenic
1005791424 6:29305976-29305998 GAGAATTAAACGTTCTTTGACGG + Intergenic
1008336611 6:50313245-50313267 GAGAGGTTTCTCATCTTTGAGGG + Intergenic
1009009847 6:57829254-57829276 GAGTGTTATCCTTTCATTCATGG + Intergenic
1009635498 6:66259733-66259755 GTGAGATATCCCTGGTTTGAGGG + Intergenic
1011989602 6:93497506-93497528 TAGTGTTATCCTTTCCTTGATGG - Intergenic
1014575477 6:123064932-123064954 GAGACCTATTGCTTCTTTGAAGG - Exonic
1021510923 7:21431183-21431205 GATATTTATCTCTTCTTTGAGGG + Intronic
1023310173 7:38878374-38878396 GGGAATTTTCCATTCTTTGAAGG - Intronic
1024764468 7:52640735-52640757 GGGAATTGTCCTTTCTTTGAAGG - Intergenic
1029019430 7:97348664-97348686 GAGAGTTATCCCTTATACAATGG - Intergenic
1029907408 7:104105212-104105234 GATAGTTTTCCCTTCTTTCCTGG - Intergenic
1035281280 7:157779916-157779938 GAGAGTTTTCCATTCCTCGAGGG - Intronic
1036055120 8:5243621-5243643 GAAAGTTAGCCATTCTATGAAGG + Intergenic
1037270834 8:17128660-17128682 CATAGTTTTCCCTTCTTTCAAGG - Intergenic
1042426320 8:68652359-68652381 GAGGGTTTTCACTTTTTTGATGG + Intronic
1042732144 8:71947902-71947924 GATAGTTATCCACTCTTAGAGGG - Intronic
1043519602 8:81030066-81030088 GAGAGTTCTCTCTTCTTTCTTGG + Exonic
1044620372 8:94185361-94185383 CAAAGTTATCCCTTCTTAGCAGG - Intronic
1044876433 8:96672369-96672391 GAGAAATATCCCTGCCTTGATGG + Intronic
1045781687 8:105872111-105872133 GAAAGTTATCCATTATTTCATGG - Intergenic
1047746109 8:127846231-127846253 GAGAGTTCTCCATTTTTTCACGG + Intergenic
1052046294 9:23798037-23798059 CAGAGTTCTCCCTTCTTTGCCGG - Intronic
1054837859 9:69698915-69698937 TAGAGTTCTCCCTTCATGGATGG + Intergenic
1056272193 9:84957090-84957112 GAAAGTTCTCCCTTCCTTGATGG + Intronic
1058779709 9:108320536-108320558 AACATTTATCCCTTCTTTGAGGG + Intergenic
1059033562 9:110728360-110728382 GACAGTTACCCTTTCTTTCAAGG - Intronic
1061598754 9:131650850-131650872 GCTGGTTTTCCCTTCTTTGATGG + Exonic
1197756365 X:129998105-129998127 GTGAGCTATCCCTACTTTGGGGG - Intronic
1202042295 Y:20698024-20698046 GAGAGACCTGCCTTCTTTGATGG - Intergenic