ID: 960964885

View in Genome Browser
Species Human (GRCh38)
Location 3:123097825-123097847
Sequence GAGAGTTATCCCTTCTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 129}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960964874_960964885 25 Left 960964874 3:123097777-123097799 CCACCTGGCCAGAAGCTTGCCAT 0: 1
1: 0
2: 0
3: 11
4: 157
Right 960964885 3:123097825-123097847 GAGAGTTATCCCTTCTTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 129
960964884_960964885 -4 Left 960964884 3:123097806-123097828 CCAGGGCTGGTGGGAGGAAGAGA 0: 1
1: 0
2: 7
3: 78
4: 694
Right 960964885 3:123097825-123097847 GAGAGTTATCCCTTCTTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 129
960964880_960964885 6 Left 960964880 3:123097796-123097818 CCATGTTAGACCAGGGCTGGTGG 0: 1
1: 0
2: 1
3: 20
4: 210
Right 960964885 3:123097825-123097847 GAGAGTTATCCCTTCTTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 129
960964876_960964885 17 Left 960964876 3:123097785-123097807 CCAGAAGCTTGCCATGTTAGACC 0: 1
1: 0
2: 1
3: 3
4: 49
Right 960964885 3:123097825-123097847 GAGAGTTATCCCTTCTTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 129
960964875_960964885 22 Left 960964875 3:123097780-123097802 CCTGGCCAGAAGCTTGCCATGTT 0: 1
1: 0
2: 2
3: 9
4: 179
Right 960964885 3:123097825-123097847 GAGAGTTATCCCTTCTTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960964885 Original CRISPR GAGAGTTATCCCTTCTTTGA TGG Intronic