ID: 960965858

View in Genome Browser
Species Human (GRCh38)
Location 3:123104296-123104318
Sequence CTGGAGTTCTTCAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 284}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960965844_960965858 11 Left 960965844 3:123104262-123104284 CCCAGCATCCCCAAGCAGGACTG 0: 1
1: 0
2: 4
3: 19
4: 198
Right 960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG 0: 1
1: 0
2: 2
3: 39
4: 284
960965851_960965858 1 Left 960965851 3:123104272-123104294 CCAAGCAGGACTGGGGCAGAATC 0: 1
1: 0
2: 1
3: 18
4: 195
Right 960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG 0: 1
1: 0
2: 2
3: 39
4: 284
960965850_960965858 2 Left 960965850 3:123104271-123104293 CCCAAGCAGGACTGGGGCAGAAT 0: 1
1: 0
2: 0
3: 15
4: 167
Right 960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG 0: 1
1: 0
2: 2
3: 39
4: 284
960965849_960965858 3 Left 960965849 3:123104270-123104292 CCCCAAGCAGGACTGGGGCAGAA 0: 1
1: 0
2: 1
3: 23
4: 221
Right 960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG 0: 1
1: 0
2: 2
3: 39
4: 284
960965845_960965858 10 Left 960965845 3:123104263-123104285 CCAGCATCCCCAAGCAGGACTGG 0: 1
1: 0
2: 4
3: 25
4: 223
Right 960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG 0: 1
1: 0
2: 2
3: 39
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960965858 Original CRISPR CTGGAGTTCTTCAGGGCAGA GGG Intronic
900418358 1:2545237-2545259 CAGGAGGTCTCCAGGGCATAGGG + Intergenic
901921266 1:12539489-12539511 CTGGGGCTCTTCTGGGCTGAAGG - Intergenic
903575136 1:24335178-24335200 CTGTGGGTCTTCAGGGGAGAGGG - Intronic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
910689949 1:89955455-89955477 ATGAAGGTCTTCAGGGAAGAGGG - Intergenic
910777392 1:90890974-90890996 CTGGACTTCTTCAGGGCTAAAGG - Intergenic
913657528 1:120975470-120975492 GTGGAGTTATTCTGGGAAGAGGG - Intergenic
913662509 1:121016788-121016810 GTGTAATTCTGCAGGGCAGAAGG + Intergenic
914008878 1:143758553-143758575 GTGGAGTTATTCTGGGAAGAGGG - Intergenic
914013887 1:143799984-143800006 GTGTAATTCTGCAGGGCAGAAGG + Intergenic
914046766 1:144100196-144100218 CTGAAGTACTTCATGGCAGCAGG + Intergenic
914131343 1:144860490-144860512 CTGAAGTACTTCATGGCAGCAGG - Intergenic
914163936 1:145161213-145161235 GTGTAATTCTGCAGGGCAGAAGG - Intergenic
914522094 1:148426743-148426765 GTGGAGTTATTCTGGGAAGAGGG - Intergenic
914652510 1:149708603-149708625 GTGTAATTCTGCAGGGCAGAAGG + Intergenic
914726471 1:150331816-150331838 CTGAACTTCTTTAGGACAGAAGG + Intronic
914826729 1:151142717-151142739 CTGGCTTGCTTCAGGGGAGAGGG - Intronic
917164056 1:172091599-172091621 CTGGAACTCTTCAGGGAACAAGG + Intronic
918045626 1:180939305-180939327 CTGAAGTTCTGGAGAGCAGATGG - Intronic
918210235 1:182343912-182343934 CTGGTGTTCTTAAAGGAAGAGGG + Intergenic
919933233 1:202235222-202235244 CTGGAGCTCCTCAGGGCACCTGG - Intronic
920912026 1:210227825-210227847 CTGGAAAGCTGCAGGGCAGATGG + Intergenic
923276011 1:232396986-232397008 CTGGAGATTTTCAGGGAATAAGG - Intergenic
923750456 1:236741928-236741950 GTGGAGTGCCTCAGGGCAGAGGG - Intronic
924300048 1:242627774-242627796 CTGGAGTTTTTCAGGTGAGCAGG - Intergenic
1064186434 10:13166108-13166130 CAGGAGTGCTTCAGAGGAGAGGG + Intronic
1066253394 10:33655565-33655587 CTGGAGTTCTTGAGGAAAGGAGG - Intergenic
1066261336 10:33732540-33732562 CTGGAGTTCTCAGGTGCAGAAGG - Intergenic
1067690276 10:48497327-48497349 GTGGGGTTCTCCAGGGCAGCTGG + Intronic
1068803059 10:61163320-61163342 TTGGAGGTCTGCAGGGCAGAAGG + Intergenic
1069643044 10:69968601-69968623 CTGGAGGCCTTGGGGGCAGAGGG - Intergenic
1071107989 10:82121130-82121152 CTGGAGTTACACAGAGCAGATGG - Intronic
1074892378 10:117746424-117746446 CAGGACTTCTTCAATGCAGAGGG - Intergenic
1075186228 10:120260809-120260831 CTGGTGTTTTTCATGGGAGAGGG + Intergenic
1075654279 10:124151130-124151152 GTGGAGTTCTACATGGCACATGG - Intergenic
1075934596 10:126328728-126328750 CTGGAATTCTTTAGTGCAGTAGG + Intronic
1075946542 10:126438192-126438214 CTGGGGTTCCTCTGGGCAGTAGG - Intronic
1075970047 10:126644294-126644316 CTGGAGTTCTGCAGTGGAGGAGG - Intronic
1076411893 10:130257572-130257594 ATGGAGGCCTTTAGGGCAGATGG - Intergenic
1076859460 10:133133753-133133775 CTGTGGTTGTTCAGGGCAGGCGG + Intergenic
1078011721 11:7577477-7577499 TTGGAGTTCTTGAGGGGGGAGGG + Intronic
1079275971 11:19038062-19038084 CTGGAGTAATCCAGGGAAGAAGG - Intergenic
1080883268 11:36342318-36342340 CTGGAGATCAGTAGGGCAGACGG + Intronic
1082916712 11:58445780-58445802 ATGGAGATCATCATGGCAGAGGG + Intergenic
1083266475 11:61549220-61549242 CTGGAGCTCTTCAGAACACAGGG - Intronic
1083768864 11:64855271-64855293 CTGGTGGCCATCAGGGCAGAAGG - Intronic
1084007159 11:66329382-66329404 CTGTAGTCCTTCAAAGCAGAGGG - Intergenic
1084113021 11:67025584-67025606 CTGGAGGTCTGCCAGGCAGAAGG - Intronic
1084537060 11:69763536-69763558 TTGCAGTTCTGGAGGGCAGAAGG - Intergenic
1085052981 11:73389221-73389243 CTGGAGGGCTGCAGGGCTGAGGG - Intronic
1085511630 11:77091113-77091135 CTCTGGTTCTTCCGGGCAGAGGG + Intronic
1086403529 11:86480736-86480758 CTGAAGTTCCTCAGGGCAAAGGG + Intronic
1086701234 11:89902093-89902115 CTGCAGTTCTGGAGGGCACAGGG + Intergenic
1086704933 11:89942434-89942456 CTGCAGTTCTGGAGGGCACAGGG - Intergenic
1087600138 11:100304065-100304087 CTGGAGTTCTTCATGTAATATGG - Intronic
1089146131 11:116330839-116330861 CTGGAGTTCCTCAGCCCTGAAGG + Intergenic
1092118355 12:6025737-6025759 CTGGGGTTATTCAGCCCAGAAGG + Intronic
1095480842 12:42633866-42633888 CTGGATTTCTGCAGGGCTGGTGG + Intergenic
1096673527 12:53214228-53214250 CTGGAGTTCTGCAGAGGGGAGGG + Exonic
1096851642 12:54442571-54442593 CTGCAGTTCTTCAAAGGAGAGGG + Intergenic
1100708677 12:97229809-97229831 CTGGTGTTCTTAAGCACAGAAGG - Intergenic
1100862644 12:98822725-98822747 CTGGAGGTGTTTAGGGCTGACGG + Intronic
1101062773 12:100988994-100989016 GTGGAGCTCTGCAGGGCAAAGGG + Intronic
1101899941 12:108784291-108784313 CTGGACTTCTCCAGGGGAAAAGG + Exonic
1102962574 12:117102222-117102244 CAGGAGTTCTTCAGGAGCGAAGG - Intergenic
1104448571 12:128852587-128852609 CTGGGGTTCATCAGGGTACATGG - Intergenic
1105623273 13:22089364-22089386 CTGGAGTACTTCTGGGTAGGGGG - Intergenic
1105942279 13:25158551-25158573 CTTAAGTTCTTCAGGACAGTGGG - Intergenic
1107241878 13:38245273-38245295 CTGGAGTTATTCAAGATAGATGG - Intergenic
1108504365 13:51097863-51097885 CTGGGCTACTTCAGGGCTGATGG - Intergenic
1108530590 13:51323932-51323954 ATGGAGTGCTCCAGGGCTGAAGG - Intergenic
1111750687 13:92328025-92328047 CTGTGCTTCTTCAGGGCAAAAGG + Intronic
1112417445 13:99215562-99215584 CTGGAGTACCTCACCGCAGAGGG - Intronic
1112436063 13:99392194-99392216 CTGGAGCTCTCCCGGGGAGAAGG - Intergenic
1115226006 14:31103005-31103027 TTGGACTTCTTCATGGCTGAAGG + Exonic
1115787024 14:36837570-36837592 CTGGAGTCCTTGAGGGCTGTGGG + Intronic
1115996774 14:39203331-39203353 CTGGAGATCATCATGGCGGATGG + Intergenic
1121532379 14:94664539-94664561 CCTGAGTTCTGCAGGGCAGGAGG - Intergenic
1121975686 14:98402031-98402053 CTGGAGTTCATCAGGATAGAGGG - Intergenic
1122225933 14:100279601-100279623 GTGGAGGTCTTCAGTGCCGAGGG + Exonic
1122780926 14:104143183-104143205 CTGGAGCTCTTGGGGGCATAAGG - Intronic
1122821713 14:104349956-104349978 CTGGAGTTCATTAGCCCAGAGGG - Intergenic
1123459801 15:20459503-20459525 CTGGCGAACTCCAGGGCAGAGGG - Intergenic
1123658261 15:22540917-22540939 CTGGCGAGCTCCAGGGCAGAGGG + Intergenic
1123947314 15:25245023-25245045 CTGGGGTTTTTCAGGGGAGCCGG + Intergenic
1123948514 15:25250414-25250436 CTGGGGTTGTTCAGGGGAGCTGG + Intergenic
1124312126 15:28635409-28635431 CTGGCGAGCTCCAGGGCAGAGGG + Intergenic
1125026235 15:35032257-35032279 CTGGAGTTCCTCAGGTGACATGG - Intergenic
1126612854 15:50547255-50547277 CTGAAGTTTTTCGGGGCACAGGG + Intergenic
1126794121 15:52245806-52245828 CTGGACTTCCACAGGGCAGTGGG + Intronic
1128075453 15:64822788-64822810 ATGGGGGTCTTCAGGGCACAAGG - Intronic
1131638507 15:94263572-94263594 CTGGTGTTCCTAAGGACAGAAGG - Intronic
1132027942 15:98418859-98418881 CTGGAGTGCTGAAGGGCAAAGGG + Intergenic
1132764508 16:1527369-1527391 CTGGAGGTCTGCCGAGCAGAGGG + Intronic
1132882807 16:2169955-2169977 CTGGAGGTTTCCAGGCCAGAGGG + Intronic
1134694608 16:16214330-16214352 CTGGGGGTCTTCAGGGAAGAAGG + Exonic
1134977228 16:18580307-18580329 CTGGGGGTCTTCAGGGAAGAAGG - Intergenic
1137716748 16:50602780-50602802 CTGCAGATCTCCCGGGCAGAGGG - Intronic
1138217719 16:55219245-55219267 CTTGCTATCTTCAGGGCAGAGGG - Intergenic
1138316918 16:56078224-56078246 CTGGAGCTCTCCAGGGCACAAGG - Intergenic
1139743699 16:69057588-69057610 TTGGAGTTCTTCAGGTGACAGGG - Intronic
1139814981 16:69662290-69662312 CTGTAGTAATTCTGGGCAGAGGG + Intronic
1140657438 16:77155304-77155326 CTGGGGCTCTTCAGGGAAGCTGG + Intergenic
1140801585 16:78493131-78493153 CTGGACTTCTTCCTGGGAGAAGG + Intronic
1141297999 16:82787982-82788004 ATGGAATGCTTCAGGACAGAAGG - Intronic
1142552185 17:747617-747639 CTCTAGTTCTGCATGGCAGATGG + Exonic
1143179007 17:4972833-4972855 CTGTAGTTCCTCAAGGCAGCGGG + Exonic
1144429719 17:15180329-15180351 GTCGAGGTCTTCAGGGCAGTGGG + Intergenic
1144811112 17:17999465-17999487 CTGGAGGTCTGCAGGGCCTATGG - Intronic
1145045757 17:19614261-19614283 CTGGAGCTCTACTGGGAAGACGG + Intergenic
1146271818 17:31489763-31489785 CTAGGGTTCTTCACTGCAGAAGG + Intronic
1146661833 17:34669968-34669990 CAGGACTTCTTCAGAACAGAGGG - Intergenic
1147760451 17:42794760-42794782 CTGGAGCTCTTCTGGGAAGGAGG - Exonic
1149412590 17:56424111-56424133 CTGGAGTCCCACAGGGTAGAAGG + Intronic
1149661945 17:58338556-58338578 CTTCAGTTCTCCATGGCAGATGG - Intergenic
1150353145 17:64461205-64461227 GTGGAGTTCTTCTTGGCACAGGG - Intronic
1151458755 17:74242239-74242261 CTGGAGGTCTGCAGGGCTGTAGG + Intronic
1152749612 17:82056614-82056636 CTGAAATACTGCAGGGCAGAGGG - Exonic
1153650085 18:7231769-7231791 CTGCAGATCTTCATCGCAGAGGG + Exonic
1153973002 18:10243404-10243426 CTGAGGTTTTTCAGGGCATATGG + Intergenic
1154161877 18:11986514-11986536 CTCTGGCTCTTCAGGGCAGAAGG + Intronic
1156397287 18:36709573-36709595 CTGTCTTTCTACAGGGCAGAAGG - Intronic
1158015685 18:52780752-52780774 GTGAAGGTCTTCAGGGGAGAAGG + Intronic
1160589766 18:79936979-79937001 GTGGGGTCCTTGAGGGCAGAAGG + Intronic
1161845062 19:6707530-6707552 CTGAAGTTCTGCAGGGCAGGCGG + Exonic
1162030984 19:7917139-7917161 CTGGAATCCTTCAGGGCTGGGGG + Intronic
1162593182 19:11606552-11606574 CTGGGGTTCTTGAGGACGGATGG + Intronic
1162625612 19:11882199-11882221 TTGGAGTTCTTTAGGGGAGAGGG - Intronic
1163760250 19:19132602-19132624 GTGGAGACCTTCAGGGCTGAGGG + Intronic
1164686070 19:30167617-30167639 CTGAAGTTCTCCAGGCCAGTGGG - Intergenic
1165279379 19:34783453-34783475 CTGGAGTGATTTAGGGCAGGGGG + Intergenic
1202686321 1_KI270712v1_random:53610-53632 CTGAAGTACTTCATGGCAGCAGG + Intergenic
925179577 2:1808346-1808368 CTGGTGTTCCTAAGGGCAGGGGG - Intronic
925493266 2:4419183-4419205 CCTGAGTTCTGGAGGGCAGAGGG + Intergenic
925590404 2:5503482-5503504 ATGAAGTTCTTCAAGGAAGAAGG - Intergenic
925862349 2:8191944-8191966 AAGGAGTTCTCCAGGGCAGGTGG - Intergenic
926552422 2:14316375-14316397 CTGACGTTCTTCAGAGGAGATGG - Intergenic
926732901 2:16050616-16050638 CAGCAGATCTTCAGGGCAGGGGG - Intergenic
927617876 2:24618460-24618482 CTGAAGGTCTTCAGACCAGATGG - Intronic
928364201 2:30689192-30689214 TGGGAGTTCATCAGAGCAGAGGG + Intergenic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929827627 2:45321691-45321713 CTGCAGTTATTCAGGAGAGAAGG + Intergenic
930492189 2:52089188-52089210 CTGGACTTTTCCTGGGCAGAAGG + Intergenic
931861993 2:66364915-66364937 CTGGAGCTCTTGAGGACAGCTGG - Intergenic
934245401 2:90301197-90301219 CTGAAGTACTTCACGGCAGCAGG - Intergenic
934263344 2:91495832-91495854 CTGAAGTACTTCACGGCAGCAGG + Intergenic
935471439 2:103465180-103465202 CTGCTGTTATTCATGGCAGAAGG - Intergenic
937231619 2:120401286-120401308 TGGGGGTTCTTCAGGGCAGAGGG + Intergenic
937732367 2:125248964-125248986 CTGGAATTCCTCAGGGCACACGG - Intergenic
937891819 2:126944940-126944962 TTGAGGGTCTTCAGGGCAGAAGG + Intergenic
939482825 2:142770940-142770962 CTGAAGCTATTCAGGGCAGTGGG - Intergenic
940584297 2:155625269-155625291 CTGTTCTTCCTCAGGGCAGAGGG - Intergenic
941249064 2:163139081-163139103 ATGGAGTTCTTCAGGCCAGCTGG + Intergenic
941923492 2:170874025-170874047 CTTGAGTCCTTAAAGGCAGAAGG + Intergenic
942223072 2:173790224-173790246 CTGGAGCTCCTCAGGGCATCTGG + Intergenic
944994980 2:205283838-205283860 CTGGCTTACTTCAGGGAAGAGGG - Intronic
947946638 2:234109344-234109366 CGGGAGATTTTGAGGGCAGAGGG + Intergenic
949028116 2:241775709-241775731 CTGGAGGTCTACAGAGCAGCTGG + Intergenic
1168798108 20:625517-625539 CTGGAGTTCTTCATGGCAGCTGG - Intergenic
1169048596 20:2558203-2558225 CAGGAGGTCTTCAAGGGAGACGG + Intronic
1169774531 20:9238098-9238120 CTGGAGTTTTCCAGAGCAGCTGG + Intronic
1169810160 20:9601764-9601786 CAGGTTTTTTTCAGGGCAGATGG - Intronic
1170538316 20:17363586-17363608 CAAGAGTAATTCAGGGCAGATGG + Intronic
1170599008 20:17826745-17826767 CAGGAATGCTTCATGGCAGAGGG + Intergenic
1171193756 20:23180745-23180767 CTGGAGTTCTTCAGGTTCCAAGG - Intergenic
1172241065 20:33412756-33412778 CTGGAGATCTGCTCGGCAGATGG - Exonic
1173842315 20:46165959-46165981 GAGGAGTGCTTCAGAGCAGACGG - Intergenic
1174575481 20:51533995-51534017 CTGGAATTCTCCAAGGCAGGAGG - Intronic
1175323193 20:58103775-58103797 CTGGAGTCATTCACGGCAGATGG + Intergenic
1175581377 20:60102406-60102428 CTGGAGACCTTCAGGGTAGCAGG + Intergenic
1175651534 20:60728867-60728889 CTGGCATTCTTCAGGACAGAAGG - Intergenic
1176896506 21:14384474-14384496 CTGGAGGTGTTCCAGGCAGACGG + Intergenic
1177361822 21:20083055-20083077 CTTAAGTTCTTCAGAGCAGGGGG - Intergenic
1177417446 21:20812669-20812691 CTGGAGCTCTTCTGGGCATCTGG + Intergenic
1178900128 21:36591905-36591927 CTTGAATCCTTCAGGGCAGATGG - Intergenic
1179481001 21:41678657-41678679 CTGGACTTCTCCAGGGCAGGCGG + Intergenic
1179800159 21:43807984-43808006 TGGGAGTTCTGCAGGGCAGGCGG + Intergenic
1180085099 21:45504851-45504873 CTGGAGTCTTTCAGGACTGATGG - Intronic
1180569787 22:16704150-16704172 CTGGGGTTATTCAGCCCAGAAGG + Intergenic
1180754977 22:18155146-18155168 CTGAAGTTATTCAGGGCCCAGGG + Intronic
1182058820 22:27382205-27382227 CTGGATTCCTTTAGGGTAGAAGG + Intergenic
1182435054 22:30325274-30325296 CTGGATTTCTCCAAGGAAGAAGG + Intronic
1183498637 22:38164918-38164940 CTGGGGTTCTCCAGGGCCGGGGG - Intronic
1184411615 22:44329389-44329411 CTGGAGCTTATCAGGGCAGGTGG - Intergenic
1184784819 22:46666599-46666621 CTGGGGCCCTTCTGGGCAGAGGG - Intronic
1185236422 22:49716217-49716239 CTGGGGGCCCTCAGGGCAGATGG - Intergenic
950228529 3:11255977-11255999 TTGGACTTGATCAGGGCAGAAGG + Intronic
952701804 3:36336384-36336406 CAGTATTTCTTCAGGTCAGAAGG - Intergenic
953071112 3:39520840-39520862 CTTGAGTTTTTCAAGTCAGAAGG - Intronic
953403184 3:42644784-42644806 GTGGAGATCTGCAGGGTAGATGG - Intronic
953862614 3:46557994-46558016 CAGGAGTTCTTCAGAGCACGTGG + Intronic
954441688 3:50525613-50525635 CTGGGCTGCTTCAGGGCAGCTGG + Intergenic
954895321 3:53970261-53970283 CTGGACTGCTCCAGGGAAGATGG - Intergenic
955417345 3:58704836-58704858 CTGGAGGTGTTCAGGCAAGAAGG + Intergenic
955491155 3:59484373-59484395 CTGGAGTTCTCCTGGGCACAAGG - Intergenic
956234888 3:67058699-67058721 CTGCTTTTCTTCATGGCAGAAGG + Intergenic
956704549 3:71988166-71988188 CTGGCTTTCTTCAGTGGAGAAGG - Intergenic
956728977 3:72179158-72179180 ATGGTGTGCTTCAGGGGAGAAGG - Intergenic
957840804 3:85666735-85666757 GTGAAGATCTTCAGGGGAGAAGG + Intronic
958712677 3:97737139-97737161 CTGGACTTCTTTAGGGAAGATGG - Intronic
960323832 3:116270347-116270369 CTTGAGTTGTACTGGGCAGAAGG - Intronic
960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG + Intronic
962184658 3:133245306-133245328 CTGGAGTACTGCTGTGCAGAGGG - Intronic
962886456 3:139632423-139632445 CTCCAGTTCTGTAGGGCAGAGGG - Intronic
962991089 3:140578050-140578072 CTTGAATTCCTCAGGGCAGCAGG + Intergenic
963206512 3:142641764-142641786 CTGGGTTTCTTTAGGGGAGATGG + Intronic
963668950 3:148227770-148227792 CTGGAGTTTTTCTCTGCAGATGG - Intergenic
964185420 3:153937036-153937058 CTGGAGTTAATCAAGGAAGATGG - Intergenic
964403118 3:156319921-156319943 CTGGACTTCATCAAAGCAGATGG - Intronic
965096740 3:164238706-164238728 CTGGAGTTGTGCAGTGCAGCAGG + Intergenic
965122668 3:164582776-164582798 CAGGATTTCTTGAGGCCAGAAGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
970366927 4:15368867-15368889 GCAGAGTTCTTTAGGGCAGATGG + Intronic
971872196 4:32256923-32256945 CTGGAGTTCTTCAGAGAAAGAGG - Intergenic
974733313 4:65897610-65897632 CTGAAGCTGTTCAGGGCAGTGGG + Intergenic
977615426 4:99083097-99083119 CTGCAGTTTTGCAGGGAAGATGG + Intronic
979237775 4:118421254-118421276 CTGGATTTATTCAGGGCCAAAGG + Intergenic
980515159 4:133847676-133847698 ATGAAGGTCTTCAGGGGAGAAGG + Intergenic
981328125 4:143475986-143476008 CTGGAGTTATCTAGGGCTGAAGG + Intergenic
981764250 4:148229854-148229876 CTAGAGTTCTTTAGGGAAGGGGG - Intronic
984606935 4:181796498-181796520 CTGAAGATCTTCAAGGCAGAGGG + Intergenic
988676811 5:33441104-33441126 CAGCAGTCCTTCAGGGAAGATGG + Exonic
990526984 5:56637757-56637779 CTGGCATTGTTCAGGGCAGATGG - Intergenic
990597235 5:57323924-57323946 CTGGAGTTCTGGAGGTTAGAAGG - Intergenic
991977594 5:72198426-72198448 CTGGAGTCCTGCATGTCAGAAGG - Exonic
992488523 5:77218537-77218559 CTGCAGTTATTTAGAGCAGAAGG + Intronic
993507012 5:88721729-88721751 ATGGAGTTCTTCATGGCTTAGGG + Exonic
993914770 5:93730881-93730903 CTGTAATTCTTCAGCCCAGAAGG + Intronic
996223060 5:120956330-120956352 CTTGAGTTCTAAAGGGCGGAGGG + Intergenic
997529121 5:134571359-134571381 CTGGAGGTTTTAAGGGGAGAAGG + Intronic
997949526 5:138231147-138231169 CTGGAATTCTTCCAGGAAGAAGG - Intergenic
998003864 5:138644379-138644401 CTGGAGCTCTCTAGGGCAGTAGG + Intronic
998031274 5:138870672-138870694 CTGCTGTCCTTCAGGGCTGATGG + Exonic
998214624 5:140227775-140227797 CTGGGGGTCCTCATGGCAGAAGG - Intronic
998227007 5:140334899-140334921 CAGGAGTTCCTCGGGGCAGTTGG - Intronic
998378185 5:141705222-141705244 CTGGAGTTATTCCAGGCAGATGG - Intergenic
998524446 5:142829516-142829538 CTAGAGATCTGCAGAGCAGAGGG + Intronic
998545036 5:143020251-143020273 TGGGAGTTCTTAAGGGCAGGTGG + Intronic
999258253 5:150222007-150222029 CTGGAATTCTCCAGGGATGACGG + Intronic
1000177630 5:158773293-158773315 GTGGAGTTATTCTGGGCACAAGG + Intronic
1000335021 5:160235687-160235709 CTGGAGAGCTTCAGGGAGGAGGG - Intronic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1001174854 5:169458740-169458762 CTGTAGTTTTTCAGGGGACAGGG + Intergenic
1001320755 5:170679091-170679113 CAGGTTTTCTTCTGGGCAGATGG + Intronic
1001920830 5:175597989-175598011 CTGGAGTGCTGCAGGGGAGCAGG + Intergenic
1002461161 5:179374539-179374561 TTGGAGGACGTCAGGGCAGAAGG + Intergenic
1002837450 6:876895-876917 CTGAAGTTCTGCAGAGCAGACGG + Intergenic
1003223253 6:4180590-4180612 CTGAATTCATTCAGGGCAGATGG + Intergenic
1003346224 6:5270125-5270147 CTGGAATTCTGCAGTGCAAAGGG + Intronic
1005597581 6:27394288-27394310 CTGGAGTGGTGCAGGGCAGTGGG - Intronic
1006919641 6:37619040-37619062 GTGGAGTGCTGCAGGGCAGAGGG + Intergenic
1007872285 6:45053955-45053977 CTGATGGTCTTCAGGGGAGAAGG - Intronic
1008159372 6:48058837-48058859 CTCCAGTTCTTCAGTGCAAAAGG + Intronic
1010041823 6:71393535-71393557 CTGATGTTCATCAGGGCAGTGGG - Intergenic
1011341637 6:86321799-86321821 GTGGAGTTCTTCAAGGAATAGGG - Intergenic
1012434775 6:99203954-99203976 CTGGAGCACTTCATTGCAGATGG - Intergenic
1012627444 6:101421210-101421232 ATGGAGCTCCTCAGAGCAGAAGG - Intronic
1012665394 6:101962035-101962057 CTTGGGTTCATGAGGGCAGAGGG + Intronic
1014282704 6:119459434-119459456 CTGCATCTCTCCAGGGCAGAGGG + Intergenic
1014574584 6:123054359-123054381 CTGGTGTACTTTGGGGCAGATGG + Intronic
1016696494 6:147002154-147002176 CGGGAAATCTTCAGGGCAGTGGG + Intergenic
1017543714 6:155428827-155428849 CTGGAGGCCTTTGGGGCAGAGGG - Exonic
1017766398 6:157610482-157610504 CTGCAGAACTTCATGGCAGAAGG - Intronic
1020061832 7:5158497-5158519 AGGAAGTTCTCCAGGGCAGAGGG + Intergenic
1020166326 7:5810191-5810213 AGGAAGTTCTCCAGGGCAGAGGG - Intergenic
1023520556 7:41046286-41046308 CTGGACTTCTGCACGGGAGAAGG + Intergenic
1023625343 7:42109765-42109787 CTGGACATCTTCCTGGCAGAGGG + Intronic
1027267824 7:76503856-76503878 CTGGACTTGTTCTGGGCAGAAGG + Intronic
1027319635 7:77003718-77003740 CTGGACTTGTTCTGGGCAGAAGG + Intergenic
1027724840 7:81791036-81791058 CTGGGAATCTTCAGGGAAGAGGG - Intergenic
1028074058 7:86489068-86489090 CTGGAGTTCTGTTTGGCAGAAGG + Intergenic
1028649794 7:93138758-93138780 ATAGAGTACTCCAGGGCAGATGG + Intronic
1028825607 7:95269746-95269768 AGGGAGTTCTTCAGGGGAGTGGG + Intronic
1028979791 7:96954670-96954692 CTGCAGTTCTTGAGTGCATAGGG - Intergenic
1029028847 7:97447733-97447755 ATGAAGTTCTTTAGGGCAGATGG - Intergenic
1030108864 7:106009553-106009575 GTGGAGTTCTTGAGAGCAGGTGG + Intronic
1030689987 7:112522444-112522466 GTGGAGCTCATCAGAGCAGAGGG - Intergenic
1031069926 7:117150727-117150749 CTGGAGTTCAACAGAGAAGAGGG - Intronic
1032005531 7:128299337-128299359 CTGGAGTGATTTAGGGCAGGGGG + Exonic
1033711600 7:143951675-143951697 GTGGAGTTTTTGAGGGGAGAGGG + Intergenic
1034925721 7:155119943-155119965 GTGGAGTCCTTCACGGCAGCTGG - Intergenic
1036775410 8:11608600-11608622 CTGGAGTGCTTCTGGGGAGCAGG - Intergenic
1037379023 8:18264275-18264297 GTGGAGTTCATCAGGGAATAGGG - Intergenic
1038174596 8:25168893-25168915 CTGGAGTCCAGTAGGGCAGAGGG - Intergenic
1041800472 8:61792460-61792482 CTGGAGTGTTTCAGGGAAAAAGG + Intergenic
1042114613 8:65416854-65416876 CTGGTGTTCTTCAAGCCAGATGG + Intergenic
1042787069 8:72559546-72559568 CTGGAGAGATCCAGGGCAGAAGG + Intronic
1043856053 8:85266139-85266161 CTGGAGTTTGTTAGGGCTGAAGG + Intronic
1043908746 8:85836291-85836313 GCGGAGTTCTTCAGGGCAGAGGG + Intergenic
1045431411 8:102118269-102118291 CTGGAGTTGTTCAGGGGACAGGG - Intronic
1046481268 8:114821617-114821639 CTGGGGCTCTACAGGGCAGTGGG + Intergenic
1047390778 8:124449263-124449285 CTGCTTTTCTGCAGGGCAGAAGG - Intergenic
1047495402 8:125405266-125405288 CTGGCTCTCTTCGGGGCAGAGGG + Intergenic
1049474359 8:142789853-142789875 ATGGAGTGCCTCAAGGCAGACGG - Intergenic
1049813370 8:144586367-144586389 CGGGAGTGATTCTGGGCAGAGGG - Intronic
1051544373 9:18257937-18257959 ATTGAGATCTTCAGAGCAGAAGG + Intergenic
1052787344 9:32841625-32841647 CTGGAGCTCTAAAGGGCAGAAGG - Intergenic
1053278292 9:36799656-36799678 CTGGAGTCCTTGAGGACAGTGGG + Intergenic
1053421962 9:37985315-37985337 TTCGAGTACTTCAGGCCAGAGGG - Intronic
1055423764 9:76171594-76171616 CAGAACTTCTTGAGGGCAGAGGG - Intronic
1055927563 9:81526341-81526363 TTTGAGTTCTTCAGGGTACAGGG - Intergenic
1057891108 9:98870532-98870554 CCAGAGTCCTTCAGGGCTGATGG - Intergenic
1057930950 9:99192482-99192504 CTGAAGATCTTCAGGGCTAAGGG - Intergenic
1057969164 9:99536862-99536884 CTGGAGATCATCTGGCCAGATGG - Intergenic
1061057858 9:128233746-128233768 CTGGGCAACTTCAGGGCAGAGGG - Intronic
1061428678 9:130517490-130517512 CTGGTGAACTTCGGGGCAGAGGG - Intergenic
1061465813 9:130778575-130778597 TTGGGGCTCTTCTGGGCAGATGG + Intronic
1185956531 X:4497125-4497147 ATGAAGTTCTTCAGGGAAGAAGG - Intergenic
1187583107 X:20630596-20630618 CTGGAGCTCTTCAGGGCATCTGG + Intergenic
1187776139 X:22760175-22760197 CTGGAGTTCTTAAAAGAAGAGGG + Intergenic
1189635879 X:43008641-43008663 CTGGCCTGCTTCAGGGAAGAAGG + Intergenic
1190904230 X:54710351-54710373 ATGGAGTCCTTCAGGTCAGCTGG - Intergenic
1192227187 X:69237385-69237407 CTGGAGCTCCTCAGGGCATCTGG - Intergenic
1192676236 X:73199603-73199625 CTGGTGCCCTTCAGGGCAGCAGG - Intergenic
1192682304 X:73264292-73264314 ATGGAGCTCTTCAAGGAAGAAGG + Intergenic
1192845032 X:74897746-74897768 CTTAAGTTTTTCATGGCAGAAGG + Intronic
1193593958 X:83423054-83423076 CTGAAGTTGTGCAGGGCAGTGGG - Intergenic
1194023883 X:88726880-88726902 CTGAAGTTGTTCAGGGCAGCAGG + Intergenic
1194051727 X:89077839-89077861 GTGGAGTTCTTCAGGGAACAGGG + Intergenic
1194187871 X:90795460-90795482 ATGGAGTTCTTCAAGGAAGAGGG - Intergenic
1195773767 X:108380358-108380380 CTGGATTTCTTCAGGGCTGGAGG + Intronic
1198638338 X:138725614-138725636 CTGTACTTCTTCAGGGAAGCTGG + Intronic
1200176756 X:154122410-154122432 CTCTAGTTATTCAGAGCAGAAGG - Intergenic
1200534459 Y:4377409-4377431 ATGGAGTTCTTCAAGGAAGAGGG - Intergenic
1202385556 Y:24323056-24323078 CTGGATTTATTCAGGGCCAAAGG + Intergenic
1202485230 Y:25347072-25347094 CTGGATTTATTCAGGGCCAAAGG - Intergenic