ID: 960965941

View in Genome Browser
Species Human (GRCh38)
Location 3:123104765-123104787
Sequence TAATCCTGGCTCACAGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960965941_960965946 16 Left 960965941 3:123104765-123104787 CCAGTAGCTGTGAGCCAGGATTA 0: 1
1: 0
2: 1
3: 9
4: 90
Right 960965946 3:123104804-123104826 ATGTGGTGTCAGACAGTGCCTGG 0: 1
1: 0
2: 2
3: 12
4: 225
960965941_960965947 17 Left 960965941 3:123104765-123104787 CCAGTAGCTGTGAGCCAGGATTA 0: 1
1: 0
2: 1
3: 9
4: 90
Right 960965947 3:123104805-123104827 TGTGGTGTCAGACAGTGCCTGGG 0: 1
1: 2
2: 0
3: 14
4: 175
960965941_960965944 -1 Left 960965941 3:123104765-123104787 CCAGTAGCTGTGAGCCAGGATTA 0: 1
1: 0
2: 1
3: 9
4: 90
Right 960965944 3:123104787-123104809 ACAGCTATGAAGGCCAGATGTGG 0: 1
1: 0
2: 4
3: 24
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960965941 Original CRISPR TAATCCTGGCTCACAGCTAC TGG (reversed) Intronic
904227642 1:29037154-29037176 TGATCCTGGCTCACTGCTCCTGG + Intronic
905442411 1:38003998-38004020 TGATCCTGACTCACAGCTGTGGG - Intronic
908880478 1:68726000-68726022 TATCCTTGGCTCACATCTACAGG + Intergenic
909869773 1:80724601-80724623 TACTCCAGCCTCACAGCTATTGG - Intergenic
910623074 1:89277040-89277062 AAAGCCTGGCTCAAATCTACTGG + Intergenic
913533812 1:119752486-119752508 AATCCCTGGCTCCCAGCTACTGG + Intronic
917102385 1:171459443-171459465 TAATCCCAGCTCCCAGCTTCTGG + Intergenic
917500206 1:175578805-175578827 TACTCCTTCGTCACAGCTACAGG - Intronic
919119956 1:193326801-193326823 AAAGTCTGCCTCACAGCTACAGG - Intergenic
922880488 1:228976778-228976800 TAAACCTGCCACACAGTTACTGG + Intergenic
1066164539 10:32772364-32772386 TAATCAGAACTCACAGCTACTGG + Intronic
1066501680 10:36000985-36001007 TAATTCTGGCTAACAGCTCAAGG - Intergenic
1067268595 10:44769909-44769931 CAAACCTGGCTCACAGGCACTGG + Intergenic
1067373732 10:45708452-45708474 CAATCTTGGCTCACTGCAACCGG - Intergenic
1072584626 10:96770503-96770525 CAATCTTGGCTCACTGCAACTGG - Intergenic
1074875234 10:117608321-117608343 TGATCCCGGCTCACTGCAACTGG - Intergenic
1075482658 10:122796024-122796046 TCATCCTGGCCCTCAGCTCCTGG + Intergenic
1079551935 11:21710565-21710587 CAGGCCTGGCTCACAGCTTCAGG + Intergenic
1085620154 11:78031942-78031964 TAATGGTGGCTCACAGATAATGG + Intronic
1086361561 11:86065554-86065576 TAATCCTGTCTCACAGCTGGAGG - Intronic
1090056244 11:123427531-123427553 TAATGTTGGCTCACAGCTGTAGG + Intergenic
1095214212 12:39528993-39529015 AAAACCTGGCACACAGATACTGG - Intergenic
1099685050 12:85874441-85874463 TACTCCTGGCTTTCAGCTCCTGG + Exonic
1104015022 12:124956176-124956198 GAAGCCTGGCTCACAGCTGAGGG + Intronic
1105734206 13:23251055-23251077 TATTCGTGGCTCTCAGCCACTGG - Intronic
1108531962 13:51335754-51335776 TGATCCTGGCTTCCAGCTTCTGG - Intronic
1111461410 13:88547331-88547353 TAATCCTAGTTCTCAACTACCGG + Intergenic
1111691737 13:91572491-91572513 TAATCATGGCTGACAGCAAAGGG + Intronic
1117707353 14:58484997-58485019 TGATCTTGGCTCACTGCAACAGG + Intronic
1119803984 14:77470214-77470236 CAATCTTGGCTCACACCTTCTGG - Intergenic
1127764600 15:62172802-62172824 GTTTCCTGGCTCACAGCTGCAGG + Intergenic
1127808507 15:62542859-62542881 TAATCCTGGGTCAAAGTTGCTGG - Intronic
1128432758 15:67614400-67614422 TAATCTTTGCTCACAGTTTCTGG - Intronic
1129383238 15:75180996-75181018 TAAACCTGGGTCACACCAACCGG - Intergenic
1142430643 16:90024739-90024761 CAATCCTGGCTCACTGCAACTGG - Intronic
1147098294 17:38158503-38158525 TGATCTTGGCTCACTGCAACCGG - Intergenic
1149809682 17:59656282-59656304 TAATCCTGTCTCAGAGAAACTGG + Intronic
1161416575 19:4150405-4150427 CAATCCTGCCCCACAGCCACGGG - Intergenic
1163508490 19:17721771-17721793 TGATACTGGTTCACAGCCACAGG + Intronic
1165075553 19:33278249-33278271 TAACCCTGGCTCCCTGCTGCTGG + Intergenic
925215003 2:2086865-2086887 TGCTCCTGCCTCACAGCTCCGGG + Intronic
927778597 2:25921422-25921444 TTAGCCCGGCTCCCAGCTACTGG + Intergenic
934665112 2:96164297-96164319 TATTCCTGGCTCACAGCAGTGGG - Intergenic
938758845 2:134405439-134405461 CACACCTGGCACACAGCTACAGG + Intronic
943122988 2:183760653-183760675 TATCCCTGGATCACAGCTATAGG + Intergenic
1168921464 20:1539984-1540006 GAATCCTGACTCACAGACACTGG + Intronic
1169962699 20:11179465-11179487 TAAGCCTGTCTCACTGCTAGAGG + Intergenic
1174594732 20:51674885-51674907 CAATCTTGGCTCACACCTCCTGG + Intronic
1175418652 20:58817579-58817601 CACTCCTGGCACACAGCTGCGGG + Intergenic
1178405728 21:32321665-32321687 TAACCCTGGCTCTCAGTTAGGGG - Intronic
1180120627 21:45745225-45745247 GAATCCTGGCTCACAGCTGAGGG + Intronic
1184944836 22:47795790-47795812 GCCTCCTGGCTCACAGCTCCTGG + Intergenic
953639043 3:44688425-44688447 TACTCCTGTCTCACAGGTCCAGG + Intergenic
953847860 3:46443192-46443214 TGATCTTGGCTCAAAGCCACAGG + Intronic
960949697 3:122991383-122991405 TACTCCTGGCTGAGAACTACTGG - Intronic
960965941 3:123104765-123104787 TAATCCTGGCTCACAGCTACTGG - Intronic
961817317 3:129557839-129557861 TCATCCCTGCTCACAGCAACCGG + Intronic
962235755 3:133705791-133705813 TAATACTGGCTCAAAGGTAAAGG + Intergenic
962236112 3:133709053-133709075 TATCCCTTGGTCACAGCTACAGG - Intergenic
969265419 4:6061354-6061376 TACTCCTGGCTCCCCGCTACAGG + Intronic
973316676 4:48767823-48767845 TAATCCTGGATTGCAGCTACGGG + Intronic
977177550 4:93835055-93835077 TAGTCCTGGTTCACTGCTTCAGG - Intergenic
980602658 4:135045037-135045059 TACTCCTGGTTTACAGCCACAGG - Intergenic
983536152 4:168859261-168859283 TTATCCATGCTCACAGCTGCTGG + Intronic
984601083 4:181727448-181727470 GATTCCTGGCTCTCAGCTCCTGG - Intergenic
985882870 5:2653753-2653775 TCATCCTGGCTGACAGCCACTGG - Intergenic
986057668 5:4154538-4154560 TAAGCCTGGCTCACTGGTCCAGG - Intergenic
986596379 5:9426579-9426601 TAATCCTGGGTCACCTCCACGGG - Intronic
987030877 5:13975442-13975464 TAATCCTGGCACAGAGCTATGGG - Intergenic
990863303 5:60352266-60352288 TTAGCATGGCTCACAGTTACTGG + Intronic
993102251 5:83554949-83554971 TAATCATGGCCCACACCTAAGGG - Exonic
993319312 5:86453626-86453648 TTATCTTGGCTCACCGCAACGGG + Intergenic
994364441 5:98896088-98896110 TGATCTTGGCTCACTGCAACTGG - Intronic
996384253 5:122893971-122893993 TAATCTTGGCTCACAGCAACCGG - Intronic
996470698 5:123856930-123856952 TTCTCCTGGCTGACAGCCACAGG - Intergenic
997813922 5:136998071-136998093 AAAACATAGCTCACAGCTACTGG + Intronic
1000121428 5:158201619-158201641 TCATCCTGACTCACAGATAGTGG + Intergenic
1007359278 6:41343413-41343435 TGATCATGGCTCACTGCAACTGG - Intronic
1008435113 6:51466723-51466745 TAATCCTGACCCCCAGCTATTGG - Intergenic
1013597617 6:111674283-111674305 TAATCCTGGCACACAGTTCATGG + Intronic
1015468673 6:133577272-133577294 TAATACTGGATCACAGGAACCGG + Intergenic
1017750910 6:157489831-157489853 TGATCATGGCTCACTGCTATGGG + Intronic
1019384839 7:748738-748760 TAAGCCTGGCTCACCGCCTCTGG - Intronic
1023036256 7:36134127-36134149 TTATCCTGGCTCTCAGCTTTGGG - Intergenic
1026246888 7:68628415-68628437 CAATCTCGGCTCACTGCTACTGG - Intergenic
1034849839 7:154483274-154483296 TCTTCCTGGCTCACAGCCCCAGG + Intronic
1036453073 8:8885646-8885668 GAATCCTGGCTACCAGCTATGGG + Intronic
1041568774 8:59312020-59312042 TAAACCTGGCTCACATTCACTGG - Intergenic
1043760649 8:84063525-84063547 TAATCCCAGCTCACAGCTCATGG - Intergenic
1053386927 9:37699382-37699404 TGATCTTGGCTCACTGCAACTGG + Intronic
1057246912 9:93464167-93464189 TAATTCTGAAACACAGCTACAGG - Intronic
1057262889 9:93595899-93595921 TACTCCTGTCTCACAGGCACTGG + Intronic
1057845071 9:98516689-98516711 TGATCCTGGCTCCTAGCTCCTGG + Intronic
1058609302 9:106757507-106757529 TAATCCTGCTTCAGAGCTACAGG - Intergenic
1059724653 9:116994678-116994700 CAATAATGGCTAACAGCTACTGG + Intronic
1060136219 9:121157411-121157433 CAATACTCACTCACAGCTACTGG - Intronic
1196647794 X:118136770-118136792 CAATCTTGGCTCACTGCAACCGG + Intergenic
1196652770 X:118185488-118185510 CAATCTTGGCTCACTGCAACTGG + Intergenic
1197144080 X:123151580-123151602 TACTCCTTCCTCACAGCTCCTGG - Intergenic
1198573190 X:137980386-137980408 TAATGCTGGCTATCAGCTAAGGG - Intergenic
1199506013 X:148562471-148562493 TAAACCTCACTCATAGCTACGGG + Intronic