ID: 960968138

View in Genome Browser
Species Human (GRCh38)
Location 3:123119753-123119775
Sequence CTGTGTTTCAGCAGCGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960968138 Original CRISPR CTGTGTTTCAGCAGCGAGGA GGG (reversed) Intronic
900398057 1:2461362-2461384 CTGTCCTTCAGCAGGGAGGAGGG + Intronic
900994578 1:6113591-6113613 CTGTGTCTCAGCACCCAGGCAGG + Intronic
901050637 1:6424387-6424409 CTGGGTTTGAGCGGCGAGAAGGG - Intronic
901442109 1:9284191-9284213 CTTTGTTACAGCAGCCTGGATGG + Intergenic
902072252 1:13749714-13749736 CCGTGATTCAGCAGCGGGGCCGG - Intronic
903326361 1:22571016-22571038 CTGAGTCCCAGCAGCTAGGAGGG + Intronic
905301478 1:36989069-36989091 CTGTGTTTGTGCAGGGAGGGAGG - Intronic
905814241 1:40936185-40936207 TTGTGTTTCTACAGAGAGGAGGG - Intergenic
907379399 1:54073428-54073450 CTGTGGGCCAGTAGCGAGGAGGG - Intronic
909106455 1:71415646-71415668 CTTTATTTCAGCAACTAGGAAGG - Intronic
912216860 1:107624259-107624281 CTGTGTTTCTGCAGCAAGAAAGG + Intronic
912242598 1:107927046-107927068 CTTTGCTTCAGCAGAGAAGATGG + Intronic
912516680 1:110220670-110220692 CTGTTTTTCAGGAGAGAGGGTGG + Intronic
912760215 1:112359773-112359795 CTGTATTTGGGCAGAGAGGAGGG - Intergenic
913390330 1:118303635-118303657 CAGTGTTTCAGCAGCGGGTTTGG + Intergenic
916030682 1:160875243-160875265 CTGTGTTTCAGGATAGAGAATGG + Intergenic
917240503 1:172942998-172943020 CAGTGTTGCAGCAGAGATGATGG + Intergenic
918135896 1:181673748-181673770 CTGTGTTTCAGGAGAGGGGTGGG - Intronic
920514203 1:206572439-206572461 CTGGGATGCAGCAGAGAGGAAGG + Intronic
920657440 1:207887397-207887419 CTGTATTGCGGCAGAGAGGAGGG + Exonic
1062793468 10:324300-324322 CAGTGTTCCTGCAGCAAGGAAGG - Intronic
1063244637 10:4205571-4205593 CTGTCTTTCAGGAGAAAGGACGG + Intergenic
1064339877 10:14476329-14476351 CAGTGTTTCAGCTGGGAGGCTGG - Intergenic
1067695911 10:48535560-48535582 CTGTCTTACTGCAGGGAGGATGG + Intronic
1067912468 10:50360373-50360395 CTGTTTTGCAGCAGCCTGGATGG - Intronic
1068600623 10:58952769-58952791 CTGGGTTCCAGAAGCTAGGAGGG - Intergenic
1072685363 10:97533426-97533448 CTGGGTTTCAGCACCATGGAAGG + Intronic
1074025227 10:109627114-109627136 CTGTGTTAGAGCAGCATGGAAGG - Intergenic
1076870125 10:133188902-133188924 CTGGGTTGCAGCACCGAGGGAGG + Intronic
1078413817 11:11149083-11149105 CTGGATTTCAGGAGCGAGGGTGG + Intergenic
1079242092 11:18728527-18728549 CTGTGTCTCCTCAGCCAGGAAGG - Exonic
1079742298 11:24078046-24078068 CTGTGATTCAGAAGCGTGGTTGG + Intergenic
1080106580 11:28517564-28517586 ATGTGTTTCAGCATCCAGAAAGG - Intergenic
1084555802 11:69875121-69875143 CCGTGTCCCAGCAGCCAGGAGGG + Intergenic
1085726483 11:78959494-78959516 TTGGGTTTCAGGAGAGAGGAAGG + Intronic
1086016401 11:82172738-82172760 CTGTATTTCAGAAGGAAGGAAGG + Intergenic
1088907703 11:114167261-114167283 TTGGTTTTCAGCAGCCAGGAAGG + Intronic
1093230635 12:16538193-16538215 CTGTGTTTTAGCAGAGAGAATGG - Intronic
1094005746 12:25748850-25748872 ATCTGTGTCAGCAGAGAGGATGG - Intergenic
1095886519 12:47194120-47194142 ATGTGTTTCAGGAGCATGGAGGG - Intronic
1096580070 12:52579472-52579494 CTGGGCTGCAGCAGAGAGGAGGG - Intergenic
1096636091 12:52960562-52960584 TTGGGGATCAGCAGCGAGGATGG + Intergenic
1100237398 12:92674567-92674589 CTGCTTTTCAGGAGCCAGGAAGG + Intergenic
1101358425 12:104003232-104003254 TTGTGCTGCAGCAGGGAGGATGG - Exonic
1102989379 12:117303786-117303808 CTGAGTTTGTGCAGGGAGGATGG + Intronic
1104852083 12:131881497-131881519 CTTTGTTTCAGCAGTGGGCAAGG + Intergenic
1106813374 13:33381565-33381587 TTGTGTTTCAGTAGAGAGGGGGG - Intergenic
1107094325 13:36518449-36518471 TTGTGTTACAGCAGCCAGAATGG - Intergenic
1108637305 13:52348357-52348379 CTGTGTTTCTGCAGGGATGAAGG - Intergenic
1111842351 13:93465931-93465953 CTGTGTTTCAGGAAACAGGAAGG + Intronic
1120655595 14:87186193-87186215 CAGTGCTTCAGCAGGGAGGCAGG + Intergenic
1120982847 14:90306329-90306351 CTGTGTTTGGTCAGTGAGGAGGG - Intronic
1122955811 14:105070456-105070478 CTGTGTTCCAGGAATGAGGAAGG + Intergenic
1123404163 15:20010483-20010505 GTGTGTTCCAGCTGGGAGGAAGG + Intergenic
1123513502 15:21017129-21017151 GTGTGTTCCAGCTGGGAGGAAGG + Intergenic
1125029489 15:35061897-35061919 CTCTGTCTCAGCAGCGGGCAAGG + Intergenic
1127626072 15:60781458-60781480 CAGTGTTTCAGCAGCACGGAGGG + Intronic
1127701026 15:61501218-61501240 CTGTGTTTAAGCTGAGAGCAAGG + Intergenic
1129054684 15:72810639-72810661 CTTTGTTACAGCAGCCTGGATGG - Intergenic
1129442492 15:75591880-75591902 CTGTGCAGCAGCAGAGAGGAGGG + Intergenic
1129682179 15:77664103-77664125 CTGTGTGGCAGAAGAGAGGAAGG - Intronic
1131446462 15:92502041-92502063 CTGAGGTTCTGCAGGGAGGAGGG - Intergenic
1133504657 16:6399437-6399459 CTGTGTTTTAGCAGAGAGTCTGG - Intronic
1136000382 16:27287998-27288020 CTGTCTTTCACAAGCGAGAATGG + Intronic
1137249926 16:46733787-46733809 CTGAGTCTCAGCAGGGAGGCAGG + Intronic
1137977376 16:53042852-53042874 CTGAGTTTGGGCAGCCAGGAAGG - Intergenic
1140987644 16:80173905-80173927 CTGGGTTTAAGCATGGAGGAAGG + Intergenic
1141633003 16:85299001-85299023 CTGTCCTCCAGCAGCGAGGACGG - Intergenic
1141963460 16:87425055-87425077 CTCAGTTTCAGCAGGCAGGAGGG - Intronic
1142171497 16:88624924-88624946 CTGTGTTTCTGGAGCGTGAAGGG + Intronic
1143772480 17:9177510-9177532 CTGTGTTCCATCAGCTCGGAGGG + Intronic
1144778064 17:17794866-17794888 CTGTGGTTCTCCAGCGAGAAGGG - Exonic
1146174370 17:30655631-30655653 CTGACTTTTAGCAGCAAGGAAGG + Intergenic
1146347826 17:32071669-32071691 CTGACTTTTAGCAGCAAGGAAGG + Intergenic
1146485573 17:33239941-33239963 CTGTGCTGCAGCAGCGTGGGGGG - Intronic
1146644567 17:34568480-34568502 CTGTGTCTCTGCAGCCAGGGAGG - Intergenic
1146885022 17:36464765-36464787 CCTTTTTTCCGCAGCGAGGATGG + Intergenic
1151191540 17:72401790-72401812 CTGTCTTTCAGCAGAGAAGATGG + Intergenic
1151962357 17:77413009-77413031 TTTGGTTTCAGCAGCGAGGTAGG + Intronic
1152485224 17:80586635-80586657 CTGTGGTTCAGCTGCCAGGCGGG + Intronic
1157011129 18:43650232-43650254 CTGTGTTTTGGGAGAGAGGAAGG + Intergenic
1158396239 18:57080308-57080330 CTGTGTTACAGCAGCCTGAATGG + Intergenic
1159120188 18:64159851-64159873 TTGTTTTTCAGGAGCGAAGAGGG + Intergenic
1162909402 19:13841296-13841318 CTGTCTTTCTCCAGCGAGCAAGG + Intergenic
1163759847 19:19130260-19130282 CTGTACTTCAGCGCCGAGGAGGG - Exonic
1164615866 19:29666422-29666444 CTGTGTTTTGGCAGCCCGGAGGG - Intronic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165346869 19:35254030-35254052 CTCTGTTTCAGCTTTGAGGATGG + Intronic
1167659110 19:50785642-50785664 CTGTGTTTCAGAAGGGAGTGGGG - Intergenic
1167691911 19:50990568-50990590 CTGTCTTTGAGAAGCCAGGAAGG - Intergenic
925009492 2:471436-471458 CTGTACTGCAGAAGCGAGGACGG + Intergenic
925018397 2:548991-549013 CTTTGTTTCAGCAGGGATGGTGG + Intergenic
926197600 2:10773139-10773161 CTGTGTGTCAGGAGGGATGAAGG + Intronic
927904998 2:26849259-26849281 CTGGGTTTGAGGAGGGAGGACGG + Intronic
928003720 2:27544363-27544385 TTGTGTCTGAGCAGAGAGGAGGG - Intronic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929260773 2:39864281-39864303 CTGTGTGAAAGCAGCCAGGAGGG + Intergenic
929461574 2:42105828-42105850 TTGGGTTTGAGCAGCCAGGATGG + Intergenic
929991460 2:46792829-46792851 CTTTGTTCCAGCAGCTAGAAAGG + Intergenic
931733120 2:65170617-65170639 CTTTGTTTCCTCAGGGAGGAAGG + Intergenic
935106092 2:100045068-100045090 CTGAGTTTCATCAGGGAGGCTGG - Intronic
935668727 2:105537175-105537197 CTGGGTTGCAGCAGAGAGAAAGG - Intergenic
937379085 2:121360071-121360093 CTATGTGACTGCAGCGAGGAAGG - Intronic
938291705 2:130154185-130154207 CTGTGATCCAGCAGGAAGGAGGG - Intronic
938950393 2:136249653-136249675 CTGGTTTTCAGCAGACAGGAGGG - Intergenic
940067921 2:149650502-149650524 ATGTATTTCAGCAGTGGGGATGG + Intergenic
941156304 2:161982218-161982240 CTTTGTGTCAGCAGTGGGGAGGG + Intronic
942151725 2:173082476-173082498 CTGTCTGTCAGCAGCCAGGATGG + Intronic
947153723 2:227139269-227139291 TTCTGTTACAGCAGCGAGAATGG + Intronic
947301300 2:228690668-228690690 CTGTGTCTCCCCAGCTAGGACGG - Intergenic
947751450 2:232534885-232534907 CTGTGCTACAGCAGAGAGGGAGG + Intronic
948264105 2:236625020-236625042 CTGTATTTAGGCAGTGAGGAGGG + Intergenic
948511309 2:238467031-238467053 CTGTGTTACAGCAGCAGGAATGG - Intergenic
948571900 2:238922927-238922949 CTGAGTGCCAGCAGGGAGGATGG - Intergenic
948741434 2:240049027-240049049 CTCTGGGTCAGCAGGGAGGAGGG + Intergenic
948780826 2:240320621-240320643 CTGTGTGACAGCAGCGAGGGAGG - Intergenic
1168813195 20:719711-719733 TTGTCCTTCAGCAGCAAGGAGGG - Intergenic
1168813417 20:720876-720898 TTGTCCTTCAGCAGCAAGGAGGG - Intergenic
1170037699 20:12006021-12006043 TTTTGTTTCTGCAGAGAGGAAGG - Intergenic
1170741733 20:19064592-19064614 CTGTGTTTCAGCAAAGAGACTGG + Intergenic
1172783814 20:37452637-37452659 CTGAGTGTCAGCACAGAGGAAGG + Intergenic
1173741885 20:45407161-45407183 CTGTGCTCCAGCAGCGAGGAGGG - Intronic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174779829 20:53378962-53378984 CAGTGTTTGAACAGCCAGGATGG - Intronic
1175228227 20:57457589-57457611 CTGCGTTTTTGCAGCGAGAAAGG - Intergenic
1175840143 20:62021435-62021457 CTGTGTCTCAGCAGCTAGAAGGG - Intronic
1175952844 20:62592580-62592602 CTGGGTTTCATCAGAGAGGATGG + Intergenic
1177820742 21:26028519-26028541 CTGAGTTTTAACAGTGAGGAAGG + Intronic
1177918916 21:27125714-27125736 ATGTCTTTCAACAGAGAGGAGGG - Intergenic
1179998812 21:44985987-44986009 CTGTGTTTCTGCAGCAAACAGGG - Intergenic
1181347834 22:22233256-22233278 CTGTGTTTCAGGAGAGAGCTTGG - Intergenic
1182126354 22:27818724-27818746 CTGGGTTTGAACAGCGAGAAGGG + Intergenic
1183026361 22:35068407-35068429 CTGTGTGTCTGCAGGCAGGAAGG + Intronic
1184169758 22:42752023-42752045 CTGTGTTTCAGCATCTGGGGTGG - Intergenic
1185013032 22:48326644-48326666 CTGTCTTTGAGCAGCGAGATTGG + Intergenic
1185386985 22:50537929-50537951 CTGGGCTTCAGGAGCAAGGAAGG - Intergenic
949854111 3:8444272-8444294 GTGTGTTACATCAGCCAGGAAGG - Intergenic
950423297 3:12911098-12911120 CTGTGTTCCGGCAGCTATGATGG + Intronic
951721774 3:25707145-25707167 TTGTGTTTCAGCAGAGTGAATGG + Intergenic
952210597 3:31225796-31225818 CTGTGTGGCAGCAGGGAAGAGGG - Intergenic
952976480 3:38700697-38700719 CTGTGTTTCAGCACCAAGGTGGG + Intronic
953856018 3:46499620-46499642 CCTTGTCTCAGCAGGGAGGAGGG - Intronic
953996099 3:47521217-47521239 CTGGGTTCCAGCAGCCACGAGGG + Intergenic
954774423 3:53003788-53003810 CTGTATTTCAGCAGCGTGAGAGG + Intronic
955353205 3:58209342-58209364 CCGGGTTTCATCAGTGAGGAAGG + Intronic
957900679 3:86484897-86484919 CTGTGTTTCAGTAGAGTGGTGGG - Intergenic
959663263 3:108892876-108892898 CTGTGTTTCAGAAGGAAGAAGGG - Intergenic
960968138 3:123119753-123119775 CTGTGTTTCAGCAGCGAGGAGGG - Intronic
961681833 3:128604559-128604581 CTGTGTTTCTGCAGCCAGGCAGG + Intergenic
961746305 3:129065476-129065498 CTGTGTTACAGCAGAGAAGGAGG - Intergenic
962029332 3:131582815-131582837 TTGTGCCTCAGCAGCCAGGATGG - Intronic
962280487 3:134048492-134048514 CTGGGTTCCAGCAGAGACGAAGG - Intronic
962389959 3:134962915-134962937 CTGGGCTTCAGCAGAGTGGAAGG - Intronic
964255310 3:154768548-154768570 CGGGGTTTCACCAGCCAGGATGG - Intergenic
968204569 3:196787827-196787849 CTGTGTTTCAGCTTCCAGGTAGG - Intronic
968546833 4:1203209-1203231 TTTTGTTACAGCAGCGGGGATGG + Intronic
969491108 4:7499725-7499747 CAGCGTTTGAGGAGCGAGGAAGG - Intronic
970191773 4:13524573-13524595 CTGTGTTTCAGGACCCAGAATGG - Intergenic
971155296 4:24075262-24075284 CTGTGTTTTCACAGGGAGGAAGG - Intergenic
972802921 4:42496197-42496219 CTGTGTTTCAGCACGGGGGTGGG + Intronic
978848973 4:113310234-113310256 CTGTCTCTCAGCAGCCAAGATGG - Intronic
982067170 4:151664541-151664563 CTGTGGTGCAGCAGCCAGAAGGG + Intergenic
984183890 4:176518963-176518985 CTGTGTCTCAGAAGGCAGGATGG - Intergenic
984687035 4:182680596-182680618 CTGTGTTTCAGCGGCTGGAAGGG + Exonic
987426211 5:17776451-17776473 CTGTGTGTCATCAGAGATGATGG + Intergenic
995609474 5:113893683-113893705 CTGTGTTTTAGAACCTAGGATGG - Intergenic
995630593 5:114127878-114127900 CTGTGTTTCAGCAAAGAGATTGG - Intergenic
997976940 5:138446275-138446297 CTGTGCTTCAGCGACCAGGATGG + Exonic
998434443 5:142095610-142095632 CTGTGTTTTGGAAGGGAGGAGGG + Intergenic
999018633 5:148138098-148138120 CAGAGTTTCAGCATAGAGGAAGG - Intergenic
999376050 5:151087157-151087179 CTGTGCTTCTGCAGGAAGGAGGG + Exonic
1001442218 5:171751602-171751624 CTGTGTTCCAGCTGCGAGGGAGG - Intergenic
1003692096 6:8364961-8364983 TTTTGTTACAGCAGCCAGGATGG + Intergenic
1003712299 6:8605464-8605486 CTGGGTTCCAGCAGAGAGAAAGG - Intergenic
1004386643 6:15178799-15178821 CTGTGTTTTAGTAGAGAGGAGGG - Intergenic
1004962664 6:20808679-20808701 CTGGGTTTCAGGAGAGAAGATGG + Intronic
1005958165 6:30679104-30679126 CTGTGGTCCAGGAGAGAGGAGGG - Intronic
1006795285 6:36728525-36728547 ATGTTTATCAGCAGAGAGGAAGG + Intronic
1007755505 6:44096690-44096712 TTCTGTTGCAGCAGGGAGGAGGG - Intergenic
1008086207 6:47247331-47247353 CTGTGTTACTGCAGCATGGAGGG - Intronic
1008434240 6:51456459-51456481 CTTTGTCTCAGCAGAGAGCAAGG - Intergenic
1010049840 6:71489936-71489958 CTGTGACTCAGCAGTCAGGAAGG - Intergenic
1014659860 6:124156371-124156393 CAGGATTTCAGCAGTGAGGAAGG + Intronic
1014896547 6:126907204-126907226 CTGTATTACTGCAGCTAGGAAGG + Intergenic
1015516920 6:134091882-134091904 TTGTGTTTCAGCAAGGGGGAAGG - Intergenic
1016277832 6:142375407-142375429 CTGTGTTTCAGGAGAAATGATGG + Intronic
1019256820 7:57580-57602 CTGGGTTTCAGAAGGGAGGATGG + Intergenic
1019678754 7:2332495-2332517 CTGTGATCCAGCACCTAGGAAGG + Intronic
1019711740 7:2521111-2521133 CGGGGTTTGAGCAGGGAGGAAGG - Intronic
1029223297 7:99007217-99007239 TTGTCTTTCAGCACCTAGGACGG - Intronic
1030108876 7:106009616-106009638 CTGTGCTCCCGCAGGGAGGAGGG + Intronic
1031924602 7:127627567-127627589 CAGAGTTACAGCAGGGAGGATGG - Intergenic
1034026526 7:147710349-147710371 CTGTGTTTCAGGAGTGGTGATGG - Intronic
1034333368 7:150303255-150303277 CTGTGTTCCAGGAAGGAGGAGGG - Intronic
1034420765 7:150989349-150989371 CTGTGTTTCCGCCTCGGGGAGGG - Intergenic
1034664675 7:152806632-152806654 CTGTGTTCCAGGAAGGAGGAGGG + Intronic
1035221647 7:157409896-157409918 GCGTGTCTCAGCAGCGAGGCAGG - Exonic
1038780903 8:30567898-30567920 CTGGGTTACAGCAGCGAGTTTGG + Intronic
1038905463 8:31897254-31897276 CTGAGTTCCAGAAGGGAGGAGGG - Intronic
1039724330 8:40199118-40199140 CAGTGTTTTAGCAACCAGGAGGG - Intergenic
1040397359 8:47012512-47012534 CTGTTTTTCAGCAGCAGTGAGGG + Intergenic
1043877570 8:85503329-85503351 CTGTGGTTCAGTGGGGAGGAAGG - Intergenic
1044389611 8:91633986-91634008 CAATGTTTCAGCACAGAGGAGGG + Intergenic
1044649692 8:94481325-94481347 CTTTGGTGCAGCAGAGAGGAAGG - Intergenic
1047024529 8:120811686-120811708 CTGGTTCTGAGCAGCGAGGAGGG - Exonic
1047788963 8:128182798-128182820 CTGTGTTTCAGCAGAGAGGGAGG + Intergenic
1048303210 8:133266390-133266412 CCGTGTGGCAGCAGAGAGGAAGG + Intronic
1048420835 8:134276847-134276869 CTGCATTTCAGCAGCAAGCAGGG - Intergenic
1048996477 8:139796933-139796955 CTGCTTTTCACCAGCTAGGATGG - Intronic
1049001263 8:139826813-139826835 CTGGGTTTCTGCAGAGAGGTTGG + Intronic
1049086366 8:140481397-140481419 CGGGGTTTCACCAGCCAGGATGG - Intergenic
1050033974 9:1415595-1415617 CTGGGTTTCACCAGCTAGGTGGG - Intergenic
1051799472 9:20915776-20915798 TTGTGATGCAGCAGAGAGGAGGG + Intronic
1052922568 9:33983579-33983601 CTGTGTCTCACCAGGGAGGGCGG - Intronic
1052923553 9:33993210-33993232 TTTTGTTTCAGCACAGAGGAAGG + Intronic
1055954434 9:81760995-81761017 GTGTGTTCCAGGAGCAAGGAGGG - Intergenic
1057608318 9:96518000-96518022 CTGGGTTCTAGCAGTGAGGAAGG + Intronic
1057621584 9:96640628-96640650 CTGTGTTATAACAGCCAGGATGG - Exonic
1057837159 9:98454712-98454734 CTGAGTTTCAGCAGCACAGAGGG + Intronic
1058618839 9:106862707-106862729 CTGGGGTTCAGCAGGGGGGAGGG + Intergenic
1058976170 9:110127368-110127390 CTGTCTTCCATCAGCCAGGAGGG + Intronic
1060731949 9:126044290-126044312 CTGCCTTTCAGCAGCCAGGTGGG - Intergenic
1061170053 9:128947421-128947443 CCGTTCTCCAGCAGCGAGGAGGG + Exonic
1185539084 X:887837-887859 CTATGTTTCTGCAGCCACGAGGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187227107 X:17383856-17383878 CAGTGCTTCAGCAGTGAGAAGGG + Intronic
1187391359 X:18888436-18888458 CTGTGTGTCAGGAGTGAAGAGGG - Intergenic
1188006112 X:25016693-25016715 GCGAGTATCAGCAGCGAGGAGGG + Intergenic
1189286415 X:39855064-39855086 CCGTGTTACAGCAGCCTGGATGG + Intergenic
1189384087 X:40522339-40522361 CTGTGGTACAGCAGAGAGGAGGG + Intergenic
1192034709 X:67549416-67549438 CAGTGTTTCTGCTGAGAGGAGGG + Intronic
1192567136 X:72174328-72174350 CTGTGCTTCTGCAGCCTGGAAGG + Intergenic
1193486221 X:82087839-82087861 CTGTGTTTGTGCAGCAACGAAGG + Intergenic
1193560752 X:83013427-83013449 CTGTTTTTCAGCAGCGGTTAGGG + Intergenic