ID: 960969655

View in Genome Browser
Species Human (GRCh38)
Location 3:123130437-123130459
Sequence AGAGCTCAGAGCAGGCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 552
Summary {0: 1, 1: 0, 2: 10, 3: 52, 4: 489}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960969655_960969662 20 Left 960969655 3:123130437-123130459 CCCCAGGGCCTGCTCTGAGCTCT 0: 1
1: 0
2: 10
3: 52
4: 489
Right 960969662 3:123130480-123130502 TCCGCAGCCGCCACAGCCCCAGG 0: 1
1: 0
2: 9
3: 55
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960969655 Original CRISPR AGAGCTCAGAGCAGGCCCTG GGG (reversed) Intronic
900130804 1:1086374-1086396 CGGGCTCAGCACAGGCCCTGGGG + Intronic
900192444 1:1357127-1357149 AAGGCTCAGCGCAGCCCCTGAGG + Intronic
900523310 1:3116490-3116512 AGAGCCCAGACCAGGACCTGCGG - Intronic
900584812 1:3427720-3427742 AGAGCCCAGAGCGGGCTCAGAGG + Intronic
900813822 1:4828174-4828196 TGAGCTCAGTCCAGGCCATGAGG + Intergenic
900963105 1:5938173-5938195 AGAGCTCAGGGCACGGGCTGAGG + Intronic
900972892 1:6001230-6001252 AGGGCTCAGGGTAGGGCCTGGGG - Intronic
901001665 1:6151920-6151942 TGGGCCCAGAGCTGGCCCTGAGG + Intronic
901146773 1:7070139-7070161 AGAGGCCAGTGCAGCCCCTGAGG - Intronic
901205971 1:7496105-7496127 ACAGCTCTGAGCCGGCCCTCTGG - Intronic
901965743 1:12864286-12864308 TGAGCAGAGAGGAGGCCCTGGGG - Intronic
902000944 1:13194266-13194288 TGAGCAGAGAGGAGGCCCTGGGG + Intergenic
902020174 1:13339970-13339992 TGAGCAGAGAGGAGGCCCTGGGG + Intergenic
902219789 1:14957706-14957728 ACAGCTCTGCGGAGGCCCTGAGG + Intronic
902843321 1:19089393-19089415 AGAACTCAGGGCAGGTCCTTAGG - Intronic
903257935 1:22115029-22115051 GGAGCTCAGAGCAGCGACTGAGG - Intergenic
903929710 1:26855203-26855225 AGAGCTCAGAGGAGGGGGTGTGG - Exonic
903930969 1:26862370-26862392 GGAGCTCAGAGGGGACCCTGAGG + Intergenic
904042445 1:27592580-27592602 TCAGCTAAGAGCAGGGCCTGGGG - Intronic
904260994 1:29287539-29287561 AGGCCTCACAGCAGTCCCTGTGG + Intronic
904900168 1:33850921-33850943 AGAGCTCAGAGCAGATTTTGTGG + Intronic
904979758 1:34488816-34488838 AGAGCTGAGTTCAGGTCCTGTGG - Intergenic
905032864 1:34899549-34899571 AGAGCTCAGGCCTGGCTCTGGGG - Intronic
905908139 1:41633374-41633396 GGAGCTCTGAGCAAGTCCTGGGG - Intronic
907211363 1:52825786-52825808 ACAGCTAAGACCAGGCACTGTGG - Exonic
907840754 1:58155086-58155108 AGAGGTCTGGGCCGGCCCTGAGG - Intronic
907974161 1:59414708-59414730 GGGGCTACGAGCAGGCCCTGGGG + Intronic
911104258 1:94117695-94117717 TGAGCTCAGAGGAGGCACCGGGG - Intronic
913609005 1:120492637-120492659 TGAGCTCTGAGCAGATCCTGAGG + Intergenic
914204823 1:145517814-145517836 TGAGCTCTGAGCAGATCCTGAGG - Intergenic
914370742 1:147022414-147022436 TGAGCTCTGAGCAGATCCTGAGG + Intergenic
914483946 1:148091000-148091022 TGAGCTCTGAGCAGATCCTGAGG - Intergenic
914582186 1:149029201-149029223 TGAGCTCTGAGCAGATCCTGAGG - Intronic
914980220 1:152408775-152408797 AGAGGTCAGAGCTGACACTGAGG + Intergenic
915146904 1:153800753-153800775 TGACCTCAGAGCAGGGCCAGGGG + Intergenic
915234583 1:154471086-154471108 AGAGCTCAGAGCAACTCCTTAGG + Intronic
915699804 1:157781109-157781131 AGACATCAGAGCAGCACCTGTGG + Intergenic
917478097 1:175386114-175386136 AATACTCAGTGCAGGCCCTGCGG - Exonic
919070386 1:192748147-192748169 AGAGGCCACAGCAGCCCCTGAGG + Intergenic
919882807 1:201911945-201911967 GGGGCACAGAGCAGGGCCTGTGG + Intronic
920523717 1:206649429-206649451 AGAGCTCACAGCAGACTGTGGGG + Intronic
920746274 1:208631903-208631925 AGAGCTCAGATAAACCCCTGAGG - Intergenic
920956168 1:210621974-210621996 AGAGTTAAGAACAGACCCTGGGG + Intronic
922566599 1:226605455-226605477 GCAGCCCAGAGCAGGTCCTGTGG + Exonic
923052378 1:230397869-230397891 AGAGCACAGAGCTGGCTTTGGGG + Intronic
923146094 1:231199232-231199254 GGAGCACAGAGTAGGCACTGGGG + Intronic
923408032 1:233682229-233682251 AGCTCTCACTGCAGGCCCTGGGG - Intergenic
1063124163 10:3125021-3125043 GGACCTCAGCACAGGCCCTGGGG + Intronic
1063211239 10:3883133-3883155 TGAGCTCAGAGCAGGGGCTCTGG + Intergenic
1063351723 10:5362771-5362793 AGAGCTCAGGGCAGACCCCAAGG + Intergenic
1063481882 10:6383532-6383554 ACAACCCAGAGCAGGGCCTGAGG - Intergenic
1064137403 10:12762834-12762856 AGAGAGCAGAGAAGGCCCGGAGG - Intronic
1064398683 10:15002506-15002528 AGAGCTCAGAGCCTGCCTTTAGG + Intergenic
1064523671 10:16230512-16230534 AGAGCTCAGATTAGGACGTGTGG - Intergenic
1065777373 10:29133294-29133316 AGATTTCACAGCAGTCCCTGTGG - Intergenic
1066205637 10:33186652-33186674 AGAGCTGAGAGCAGGGCCTTAGG - Intronic
1066579304 10:36862522-36862544 AGGTCTCAGAGCAGGCACAGTGG - Intergenic
1067038016 10:42933475-42933497 AGAGCCGAGGGCAGGCCCTGGGG + Intergenic
1067542553 10:47166371-47166393 AGGGCTCAGGGCAGGTCCTGGGG - Intergenic
1067834160 10:49627901-49627923 AGGGCCCACAGCATGCCCTGCGG + Intronic
1067878138 10:50021927-50021949 AGGGCTCAGAGCAGGTCCACTGG - Intergenic
1069591016 10:69641840-69641862 CTGGCTCACAGCAGGCCCTGGGG + Intergenic
1070565413 10:77600402-77600424 AGTCCTCACAGCAGCCCCTGTGG + Intronic
1071505649 10:86229966-86229988 CTGGCCCAGAGCAGGCCCTGAGG + Intronic
1072009116 10:91288063-91288085 AGAACACAGAGCTGGACCTGGGG - Intergenic
1072023096 10:91424520-91424542 AGAGCTGAGAATAAGCCCTGAGG + Intronic
1072158624 10:92746282-92746304 TCAGGTCAGAGCAGGCGCTGTGG + Intergenic
1073043065 10:100620577-100620599 AGAGCCCAGAGCTGGCTCTCAGG - Intergenic
1073077361 10:100832617-100832639 AAAGCCCAAAGGAGGCCCTGAGG + Intergenic
1073222649 10:101888826-101888848 AGAGCTGAGTGCAGGCACTCTGG + Intronic
1073354836 10:102845526-102845548 AGAGCTCAGGGCATGCACTGTGG + Intergenic
1073426591 10:103458873-103458895 AGAGCTCAGAGCAGAGGCTGAGG + Exonic
1073792628 10:106955459-106955481 AGTGGGCAGAGCAAGCCCTGTGG + Intronic
1074123500 10:110510384-110510406 AGAGCTCAGCAGAAGCCCTGTGG + Exonic
1074705500 10:116126363-116126385 ACAGCACAGAGCAGGCAGTGTGG - Intronic
1074778210 10:116781746-116781768 AGAGCCCACAGCAGACCCTCAGG - Intergenic
1075330749 10:121572246-121572268 ATAGCTCAGTGCAGCCTCTGGGG - Intronic
1075454959 10:122579153-122579175 TGGGCTCAGAACAAGCCCTGGGG + Intronic
1075574766 10:123570414-123570436 CCAGCGCAGAGCAGGCTCTGGGG - Intergenic
1075960893 10:126567046-126567068 GGAGCTCAGAGGGGACCCTGCGG + Intronic
1076574717 10:131456610-131456632 TGTGCCCAGAGCAGGCCCTCAGG + Intergenic
1076590105 10:131577014-131577036 ACCGCTCAGCGCAGGGCCTGGGG - Intergenic
1076611599 10:131729400-131729422 AGAGCTCAGAAGAGGCCCCCAGG - Intergenic
1077295120 11:1822929-1822951 AGGGCTCAGGGCAGGCCCTAGGG - Intergenic
1077362111 11:2145392-2145414 GGAGCCTAGAGCTGGCCCTGGGG - Intronic
1077712370 11:4550401-4550423 AGAGGTGAGAGCAGCTCCTGAGG - Intergenic
1078012223 11:7581268-7581290 ATAGCTCCGAGCAGGGTCTGTGG + Intronic
1079083330 11:17428745-17428767 AGAGCTCTGAGCAGGATCTCAGG + Intronic
1079243847 11:18739327-18739349 GGAGCTCAGAGAAGGAGCTGAGG + Intronic
1079701698 11:23556247-23556269 AGAGCACAAAGCAGGCTCTTGGG - Intergenic
1080150214 11:29044019-29044041 AGAGCTAAAAGCAGGCCAAGTGG + Intergenic
1080578508 11:33622354-33622376 AGACCACAGGGCTGGCCCTGAGG + Intronic
1083259241 11:61514288-61514310 AGAGATCAGAGGAAGCCCCGGGG - Intergenic
1083661742 11:64254613-64254635 AGTGCTCAGGGCAGGAGCTGAGG + Intronic
1083954819 11:65977478-65977500 AGAAGGCAGAGCAGGCCCTGTGG - Intronic
1084122967 11:67080226-67080248 AGTGCCTAGAGCAGGGCCTGTGG - Intergenic
1084366946 11:68707957-68707979 GGAGGGCAGAGCAGGCCCTGCGG - Exonic
1084527497 11:69705898-69705920 AGCGCTCAGAACAGGGGCTGGGG - Intergenic
1084594880 11:70110945-70110967 TGTGCCCAGTGCAGGCCCTGGGG + Intronic
1084861092 11:72018704-72018726 AGAGCTCAGCCCTGGGCCTGTGG - Intronic
1085778971 11:79391364-79391386 CTAGCACAGATCAGGCCCTGAGG - Intronic
1087265502 11:96056197-96056219 AGTGCTAAGAGCCTGCCCTGTGG - Intronic
1088897830 11:114091484-114091506 AGACGTCCGAGCAGCCCCTGGGG + Intronic
1089915166 11:122147635-122147657 AGACCACAGAGCAGTCCTTGTGG - Intergenic
1090201749 11:124862683-124862705 AGAGAGCAGAGCAGGCAGTGAGG + Intergenic
1090404207 11:126467413-126467435 ACTGCCCAGAGGAGGCCCTGGGG - Intronic
1090659363 11:128870743-128870765 AGGACTCAGGGCAGACCCTGAGG - Intergenic
1090731115 11:129574085-129574107 AGGGCTTAGAGCATGGCCTGGGG + Intergenic
1090807530 11:130211779-130211801 AGTGCCCAGTGCAGGCGCTGAGG + Intergenic
1091191445 11:133698787-133698809 TGGGCTCAGATCAGGCCCTGTGG + Intergenic
1092117723 12:6021318-6021340 AGGGCTCAGAGCTCACCCTGAGG + Intronic
1092981744 12:13801854-13801876 AGAGCTCAGAGCAGTTCCCAGGG - Intronic
1093395314 12:18673841-18673863 AGAGCTCAGGGCAGCTTCTGTGG - Intergenic
1093608092 12:21118623-21118645 AGAGCACCAAGCAGGCCCTTGGG - Intronic
1093663121 12:21780379-21780401 AGGTCTCAGAGCAGGCTGTGGGG + Intergenic
1095614882 12:44176641-44176663 AGAGCTGAAAGCAGGCTCTATGG - Intronic
1096165904 12:49423913-49423935 AGAACTCAGACCAGGCGCAGTGG + Intronic
1096500687 12:52062374-52062396 GGTGCTCAGAGCAGGCCATGTGG - Intergenic
1096592392 12:52669588-52669610 AGAGAACAGAACAGCCCCTGAGG + Intergenic
1096722634 12:53534630-53534652 AGAGATCAGAACAGGCTTTGGGG + Exonic
1096793861 12:54061802-54061824 AGTGGTCAGATCAGCCCCTGAGG - Intergenic
1097174747 12:57136143-57136165 AGACCTCACAGCTGGCCCAGTGG + Intronic
1097970000 12:65623358-65623380 AGGGCTCAGACTAAGCCCTGGGG - Intergenic
1098142922 12:67469192-67469214 AGAGCACCAAGCAGGCCCTCAGG - Intergenic
1100819759 12:98420248-98420270 ACAGCTTAGACCAGGACCTGGGG + Intergenic
1101199651 12:102421245-102421267 AGATCTCGAAGCAGACCCTGTGG + Intronic
1101479560 12:105084201-105084223 AGACCTCAGAGGAGGGCTTGGGG - Intronic
1101657065 12:106731827-106731849 AGAGCTCAGAGATGGCTCGGTGG + Intronic
1102089050 12:110171101-110171123 AGAGTTCATAGCAGGACCTGAGG + Intronic
1102612193 12:114122045-114122067 TGAGCCCAGAGCAGGCTGTGAGG - Intergenic
1102859871 12:116326466-116326488 AGAGCTCAGAGCAGTCACAAAGG + Intergenic
1103246566 12:119463122-119463144 AGAGAACAGAACAGGCACTGAGG - Intronic
1104949238 12:132431577-132431599 AGAGCCCGGAGCAGGCCAAGTGG - Intergenic
1105449747 13:20488823-20488845 GGAGCTGGGAGCAGCCCCTGTGG - Intronic
1106330484 13:28734795-28734817 AGTGCACTGAGGAGGCCCTGGGG - Intergenic
1107132722 13:36913344-36913366 AGGCCCCAGAACAGGCCCTGGGG - Intronic
1107559928 13:41549800-41549822 AGAGTGCAGGGCTGGCCCTGAGG - Intergenic
1107837074 13:44420890-44420912 AGAGCTCGGAACAGGCCCACTGG - Intergenic
1108248650 13:48542781-48542803 TGAACTCTGTGCAGGCCCTGCGG - Intergenic
1109940277 13:69353194-69353216 AGATCTGGGAGGAGGCCCTGGGG - Intergenic
1110333899 13:74303866-74303888 AGTGCTCAGATCATGCCCTAAGG + Intergenic
1112390499 13:98979401-98979423 AGGGCTCAGAGGAGGCAGTGGGG + Intronic
1112609988 13:100946499-100946521 TCAGCTCACAGCAGGCGCTGAGG - Intergenic
1113366460 13:109681153-109681175 AGAGCTGTGAGCAGGACCAGTGG + Intergenic
1113614690 13:111671797-111671819 AGAGCACAGAGCTGGGCCAGTGG + Intronic
1113620159 13:111756711-111756733 AGAGCACAGAGCTGGGCCAGTGG + Intergenic
1113879003 13:113612247-113612269 AGAGACCAGAGCAGGACCTAGGG - Intronic
1114263999 14:21060489-21060511 AGAGCTCAGAACAGGACCCTGGG - Intronic
1114349544 14:21835416-21835438 TCAGCACAGAGGAGGCCCTGGGG + Intergenic
1114661345 14:24347157-24347179 GGAGCTCAGAGCAGATCCTCAGG - Intergenic
1115129608 14:30038874-30038896 GGAGCCCAGAGCAGCCTCTGAGG - Intronic
1115469931 14:33757964-33757986 AGTGCTCTGTGCAGGCACTGAGG - Intronic
1115729498 14:36253103-36253125 AGAGCTCAGTGCATGCACTTAGG + Intergenic
1115810668 14:37103580-37103602 AGAGCTCACAGCAGGCTGAGTGG + Intronic
1117167090 14:53046902-53046924 TGAACTCAGAGAAGGCCTTGTGG - Exonic
1118036896 14:61877680-61877702 AGAGTTGAGAGCTTGCCCTGTGG + Intergenic
1118817719 14:69324654-69324676 AGAGGTCAGAGCCAGCCATGAGG - Intronic
1118928414 14:70215499-70215521 AGAGCTTTGAACAGGCGCTGAGG + Intergenic
1119243190 14:73079898-73079920 AGACCTCAGATTAGGCCTTGTGG - Intronic
1119820086 14:77608150-77608172 AGAGGCCAGAGAAGGTCCTGGGG - Intronic
1121245383 14:92458138-92458160 AGAGCCTGGAGCAGGGCCTGGGG + Intronic
1121326533 14:93023420-93023442 AGAGCCCCCAGCTGGCCCTGTGG + Intronic
1121588678 14:95082492-95082514 AGAGTTCAGGGGAGGCTCTGGGG - Intergenic
1121629842 14:95414027-95414049 AGAGCTGAGGGCAGTCCCTCAGG + Intronic
1122414193 14:101541002-101541024 AGAGCCCGGAGCAGGGCCTCTGG + Intergenic
1122623362 14:103072016-103072038 AGAGCCCACAGCACGACCTGAGG + Intergenic
1122834200 14:104423197-104423219 AGAGGCCAGAGCATTCCCTGGGG - Intergenic
1122838417 14:104442707-104442729 GGAGCACAGAGCTGGCCATGTGG - Intergenic
1122878197 14:104678440-104678462 GGAGCTCAGAGCAGGACCCGGGG - Intergenic
1123000452 14:105291206-105291228 GGAGCTCAGAGGTGCCCCTGCGG - Intronic
1123461694 15:20478564-20478586 AGAGCTCAGGGGAGACCTTGTGG - Intergenic
1123656362 15:22521816-22521838 AGAGCTCAGGGGAGACCTTGTGG + Intergenic
1123943310 15:25227026-25227048 AGAGCTCAGTGCAGGAGCCGAGG - Intergenic
1124272351 15:28294534-28294556 AGAGCTCAGGGGAGACCTTGTGG - Intronic
1124310273 15:28616994-28617016 AGAGCTCAGGGGAGACCTTGTGG + Intergenic
1125894185 15:43288154-43288176 GGAGCTCAGAGCAGACGCTGCGG + Intronic
1126460069 15:48905388-48905410 AAAGCTCAGAGTGTGCCCTGGGG - Intronic
1126823737 15:52529175-52529197 AGAGCCCAGAGCAGCCGCGGTGG - Intergenic
1126953738 15:53911199-53911221 ACAGCTTGGAGCAGGACCTGGGG + Intergenic
1127528320 15:59816230-59816252 AATGGTCAGAGCAGGCCCTGTGG - Intergenic
1127556299 15:60090630-60090652 GGGGCTCAGAGCAGGGCCTAGGG + Intergenic
1127960635 15:63887856-63887878 TGAGCTCAGAGCAGGACTAGAGG - Intergenic
1128090284 15:64914629-64914651 ACAGCTCACAGCAGGCCCAAAGG - Intronic
1128551228 15:68599208-68599230 AGAGATCAGAGAAGGCTCTGTGG - Intronic
1128672978 15:69588070-69588092 AGAGCTCAGCTGAGGCCCAGAGG - Intergenic
1128701158 15:69805363-69805385 GGAGCACAGAGCAGCCCCTGTGG + Intergenic
1129230617 15:74195222-74195244 AGAGCTCAAAGGAGGCACTGTGG + Intronic
1129456373 15:75677959-75677981 AGAGCCCAGAGTGGGGCCTGAGG - Intronic
1129540058 15:76341592-76341614 CCAGCTGAGAGCAAGCCCTGCGG - Intronic
1129718205 15:77863955-77863977 AGAGAGCAGAGGAGACCCTGGGG + Intergenic
1129771349 15:78205273-78205295 AGAGCTCAGAGCTCAGCCTGGGG + Intronic
1130460725 15:84156910-84156932 AGAGAGCAGAGGAGACCCTGGGG - Intergenic
1131152914 15:90058126-90058148 GGTTGTCAGAGCAGGCCCTGTGG + Intronic
1132482953 16:175686-175708 AGACCTCATCACAGGCCCTGAGG - Intergenic
1132547458 16:539942-539964 ACATCTCAGTGCAGGGCCTGCGG - Intronic
1132981414 16:2740244-2740266 AGAGCCCAAGGCAGGACCTGTGG + Intergenic
1133777176 16:8905935-8905957 GGAGCTCGGTGCTGGCCCTGTGG + Intronic
1133803793 16:9107420-9107442 GGTGCTCAGGGCAGGCCCTCTGG + Intronic
1136235440 16:28910939-28910961 AGAACTCAGAGCAGCTGCTGCGG - Exonic
1136707306 16:32201044-32201066 AGAGCTCAGAGCTGGCCATGGGG - Intergenic
1136760605 16:32728373-32728395 AGAGCTCAGAGCTGGCCATGGGG + Intergenic
1136807498 16:33142013-33142035 AGAGCTCAGAGCTGGCCATGGGG - Intergenic
1136922977 16:34346635-34346657 AGAGCTGGGCCCAGGCCCTGAGG + Intergenic
1136981596 16:35065171-35065193 AGAGCTGGGCCCAGGCCCTGAGG - Intergenic
1137446487 16:48535502-48535524 AAAGGTCAGATGAGGCCCTGAGG + Intergenic
1137563931 16:49521770-49521792 TGAGCTCAGGGCTGGCCCCGAGG - Intronic
1137825475 16:51490757-51490779 AGAGGTTAAAGTAGGCCCTGAGG - Intergenic
1138522340 16:57578021-57578043 AGAGCCCAGATGGGGCCCTGGGG + Intronic
1138657695 16:58500480-58500502 AGAGCCCATAGCAGGGGCTGGGG + Intronic
1139357969 16:66378689-66378711 GGAGCCCAGAGGAGGGCCTGTGG - Intronic
1139475454 16:67200475-67200497 TGAGCTCTGAGAAGGCCCTCAGG - Exonic
1139648063 16:68346464-68346486 AGAGCAGAGAGCAAGCCCTCAGG - Intronic
1140032973 16:71353231-71353253 AGAGCACAGAGTAGACACTGAGG - Intergenic
1140087284 16:71808581-71808603 AGAAGTCGGAGCAGCCCCTGGGG + Intronic
1141196467 16:81865113-81865135 GGAGCTCTGAGCATGGCCTGTGG + Intronic
1141485153 16:84334007-84334029 AGAGCACCAAGCAGGCCCTTAGG + Intergenic
1141623135 16:85247729-85247751 AGTGCTCACAGCAGCCCCAGGGG - Intergenic
1141671968 16:85496837-85496859 GGGGCTCAGGGCAGCCCCTGTGG + Intergenic
1141696817 16:85624164-85624186 AGACCTCAGTGCCCGCCCTGGGG + Intronic
1142178247 16:88654901-88654923 AGAGCTCAGTCTAGGCCCTCAGG + Intronic
1142343868 16:89541685-89541707 ACAGCACAGAGCAGTCCCTTTGG - Intronic
1203062759 16_KI270728v1_random:988688-988710 AGAGCTCAGAGCTGGCCATGGGG + Intergenic
1142481120 17:218825-218847 AGAGGTCACAGCAGGTCCTGGGG + Intronic
1142499993 17:326925-326947 AGAGCACAGAGAAGGCCCTGGGG + Intronic
1142766627 17:2068047-2068069 AGAGCCCAGAGCCCACCCTGAGG + Intronic
1142898206 17:2995804-2995826 AGAGCCCAGGGCAGAGCCTGGGG + Intronic
1143768131 17:9150899-9150921 AAAGCACAGCCCAGGCCCTGTGG - Intronic
1144708820 17:17387277-17387299 AGTGGTCAGAGAAGGCGCTGGGG - Intergenic
1144819861 17:18064838-18064860 AGAGGTCAGAGCAGCCGGTGAGG + Intronic
1145398896 17:22515701-22515723 AGACCTGAGAGCAGCCTCTGTGG + Intergenic
1146713594 17:35064217-35064239 AGAGGTCAGAGGAGGCCTAGTGG - Intronic
1146729790 17:35183579-35183601 AGTGGTAAGAGCTGGCCCTGGGG + Exonic
1146930244 17:36771841-36771863 AGGGCTCAAAGCTGGCCCTGGGG + Intergenic
1147419451 17:40314896-40314918 AGAGATCAGAGAAGACACTGGGG - Intronic
1147674174 17:42193369-42193391 AGAGCCAGCAGCAGGCCCTGAGG - Exonic
1147995493 17:44358098-44358120 TCAGCTCAGGGGAGGCCCTGTGG + Intronic
1148999296 17:51740651-51740673 AGAGGTCAGAGCAGGGCCAGAGG - Intronic
1150475590 17:65472144-65472166 AGAGCCCAAACCAGGACCTGGGG + Intergenic
1151571049 17:74925472-74925494 CGAGCTGAGGACAGGCCCTGAGG - Intronic
1152406770 17:80102241-80102263 AGATTTCAGAGCTGGCCCAGGGG - Intergenic
1152425231 17:80214914-80214936 AGAGCTAAGGGCAGGCCACGGGG + Intronic
1152786574 17:82251076-82251098 AGGGCCCAGAGCATGCCCTGGGG - Intronic
1153754047 18:8262191-8262213 AGTGATCAGGGCAGGCCCTAGGG - Intronic
1157318894 18:46619317-46619339 AGGGCTCAGAGAAGGCACTAGGG - Intronic
1157603597 18:48911379-48911401 AGGGCTCAGAGCAAGGGCTGTGG + Intergenic
1157956206 18:52100289-52100311 AGATGTTAGTGCAGGCCCTGTGG + Intergenic
1159130763 18:64278021-64278043 AGAGCACCAAGCAGGCACTGAGG - Intergenic
1160717537 19:583204-583226 AGAGGTCAGAGTCGTCCCTGAGG - Exonic
1161001621 19:1913802-1913824 AGAACTTGGAGCAGGACCTGTGG + Intronic
1161007116 19:1942207-1942229 AGATGTCTGAGCAGGGCCTGCGG + Intronic
1161064367 19:2230352-2230374 AGAGCTCAGGGCAGGCGCCAGGG - Exonic
1161257190 19:3315905-3315927 AGAGGTCACAGCAGGTCATGAGG - Intergenic
1161457381 19:4376337-4376359 AGAGCTGTGAGCGGGCGCTGAGG - Intronic
1161457609 19:4377367-4377389 AGAGCTGTGAGCGGGCACTGAGG + Intronic
1161555050 19:4936484-4936506 ACTGCCCAGAGCAGGACCTGGGG - Intronic
1162830537 19:13281852-13281874 AGTGCTCAGACCAGGCCCCAGGG - Intronic
1163642580 19:18469944-18469966 TGAGCCCAGTGCAGGCTCTGTGG + Intronic
1163849262 19:19654243-19654265 AGAGCCCCGATCAGGCCCTGGGG - Intronic
1165432836 19:35782238-35782260 AGAGCCCAGTGTAGGACCTGGGG + Intronic
1165476938 19:36036098-36036120 AGAGCTCAGACTCGGGCCTGGGG - Intronic
1165494300 19:36142616-36142638 AGAGCTCAGAGCAGGGGGAGGGG - Intronic
1165973906 19:39657773-39657795 AGATCACAGGGCAGGCTCTGTGG - Intronic
1166420527 19:42632875-42632897 AGAGCTCTGAGCGGGGACTGAGG - Intronic
1167172002 19:47839609-47839631 GGAGGTCAGAGACGGCCCTGAGG - Exonic
1167538246 19:50069061-50069083 TGAGCTCAGTGCAGGCCAAGAGG - Intergenic
1167618807 19:50550203-50550225 AGGGCACAGAGCAGGCCGGGAGG + Intronic
1168189852 19:54730016-54730038 AGAGGTCAGAACAGACCCAGAGG + Intronic
1168322208 19:55517326-55517348 AGAGGTCAGCGCTGGGCCTGGGG - Exonic
1168587805 19:57608099-57608121 AGAACTCAGATCAGGTCCTGGGG - Exonic
925294882 2:2769740-2769762 AGAACTCAGATCCGGCCCGGAGG + Intergenic
926962860 2:18377975-18377997 AGATTTCAGATGAGGCCCTGAGG + Intergenic
927848541 2:26484689-26484711 AGTGCTCAGGGCAGGCCAAGGGG + Intronic
927893465 2:26766715-26766737 AAAGGGCAGAGCAGGGCCTGGGG - Intronic
932137773 2:69245489-69245511 AGAGCCCAGAGCAGGAACTTTGG - Exonic
932338381 2:70943815-70943837 AGAGAACAGAGCAGGCCCTGGGG - Intronic
932593383 2:73080144-73080166 AGAGGTTGGAGAAGGCCCTGAGG - Intronic
933768626 2:85728975-85728997 GGAGCTAAGAGCAGGGCCTTAGG - Intergenic
933776425 2:85773889-85773911 AGGGCTCAGCGCAGGCCCACGGG + Intronic
934659533 2:96135910-96135932 ACTCCTCAGAACAGGCCCTGGGG + Intronic
935103595 2:100019675-100019697 AGAACACAGAGCAGCCCCTGTGG + Intronic
935977735 2:108595676-108595698 AGAGCCAAGAACAGGACCTGGGG - Intronic
936159001 2:110070088-110070110 AGAACCCAGAGTAGGCCCAGGGG - Intergenic
936185660 2:110301244-110301266 AGAACCCAGAGTAGGCCCAGGGG + Intergenic
936428396 2:112437485-112437507 AGCCCTGAGACCAGGCCCTGTGG - Intergenic
937315351 2:120928470-120928492 AGAGCTCAGAGCTGGCTGGGAGG - Intronic
938941738 2:136175692-136175714 AGAGCTCAGCCCAGCTCCTGGGG + Intergenic
939189707 2:138902033-138902055 AGAGCTGTGCCCAGGCCCTGCGG - Intergenic
939542015 2:143505621-143505643 AGTGCTCAGAACAGCCCATGGGG + Intronic
940268214 2:151862531-151862553 AGTCCTCAGAACAGTCCCTGAGG - Intronic
940847899 2:158661202-158661224 AGAGGTCGGAGGAGGCACTGGGG - Intronic
942445382 2:176074138-176074160 TGAACTCAGAGCAGGCACTTTGG - Intergenic
942523888 2:176832495-176832517 AGAGCACAGAGCAGGCCAGTGGG - Intergenic
944855071 2:203759672-203759694 AGAGCACTGAGCAGGCTCTTGGG - Intergenic
946039945 2:216774814-216774836 TGTACTCAGAGCTGGCCCTGGGG - Intergenic
946334807 2:219029589-219029611 AGCGCTCCGAGCAGCCCCTGTGG - Exonic
946688245 2:222292590-222292612 AGAGCCCAGAGCAGTCACAGAGG - Intronic
946982850 2:225236788-225236810 AGGGCTCAGAGAACGCACTGGGG + Intergenic
947256992 2:228177391-228177413 ACAGCTCAGTGCTGGCCTTGAGG + Intronic
948800711 2:240432256-240432278 ATGGGCCAGAGCAGGCCCTGGGG + Intergenic
1169022464 20:2340187-2340209 AGAGCTAAGAGCTGGCCTTCAGG + Intronic
1169194540 20:3676069-3676091 AGTGCTCAGAACAGCGCCTGCGG + Intronic
1170568212 20:17618399-17618421 AGAACTCTGAGCTGGGCCTGTGG - Intronic
1170796464 20:19551743-19551765 AGAGCTGAGAGCATGTCCTATGG - Intronic
1171291272 20:23984366-23984388 AGAGGAGGGAGCAGGCCCTGAGG + Intergenic
1171522296 20:25785207-25785229 AGAGTTCAGAGCAGAAGCTGAGG + Intronic
1171530045 20:25847152-25847174 AGAGTTCAGAGCAGAAGCTGAGG + Intronic
1171554531 20:26070676-26070698 AGAGTTCAGAGCAGAAGCTGAGG - Intergenic
1172038777 20:32029232-32029254 AGAGGTCAGAGCAGGAAATGAGG + Intronic
1172106989 20:32522828-32522850 AGAGCTCAGTGGAGGGCCCGGGG + Intronic
1172605759 20:36212522-36212544 AGAGCTCAGAGAGGACACTGAGG - Intronic
1172880060 20:38193985-38194007 AGAGCTCAGGGCAGGGCTGGGGG - Intergenic
1173616907 20:44409147-44409169 AGCGTTCAGAGCAGGCCTTGGGG - Intronic
1174401339 20:50277656-50277678 AAGGTTCAGAGAAGGCCCTGGGG + Intergenic
1175282624 20:57814241-57814263 GGAGCACAAAGCATGCCCTGGGG - Intergenic
1175371674 20:58496678-58496700 AGGGGCCAGAGCAGGCCCTGAGG + Intronic
1175540540 20:59745038-59745060 GGATCACGGAGCAGGCCCTGGGG + Intronic
1175540861 20:59746774-59746796 GGATCACGGAGCAGGCCCTGGGG + Intronic
1175544197 20:59767586-59767608 GGGGCTCAGGGCAGGCCCAGAGG + Intronic
1175793298 20:61756185-61756207 AGAGCTCAGAGCAGGATGTCTGG + Intronic
1175837448 20:62005148-62005170 AATGCTCAGGCCAGGCCCTGCGG + Intronic
1175846790 20:62064044-62064066 AGAGCTGAGGGCAGTACCTGGGG - Intronic
1175918842 20:62440581-62440603 AGCGCTCAGTGCCTGCCCTGTGG + Intergenic
1176146718 20:63568750-63568772 CCAGCTCAGAGCAGGCGCTGTGG - Exonic
1176373855 21:6077726-6077748 AGCCCTGAGACCAGGCCCTGTGG + Intergenic
1176899343 21:14420498-14420520 AGAGCACAAAGCAGGCTCTAAGG + Intergenic
1177141291 21:17360842-17360864 AGACCTAAGAGGTGGCCCTGAGG - Intergenic
1178949564 21:36975036-36975058 AGAGGCCAGAGCTGGCCATGAGG - Intronic
1179256386 21:39719802-39719824 GGAGCACAGAGCAGGCCCTATGG - Intergenic
1179749622 21:43460517-43460539 AGCCCTGAGACCAGGCCCTGTGG - Intergenic
1179840771 21:44071802-44071824 GGAGACCAGAGCAGGCCCGGGGG + Intronic
1179873234 21:44254322-44254344 AGAGCTCAGAGCAGGGCAGTTGG - Intronic
1180005917 21:45020478-45020500 ACAGCTCAGGTCAGGCTCTGTGG - Intergenic
1180167267 21:46036624-46036646 AGAATTCAGAGCTGGGCCTGGGG + Intergenic
1180193702 21:46181498-46181520 GGAGCTCCGAGCAGGGCCTGGGG + Intronic
1180569164 22:16699731-16699753 AGGGCTCAGAGCTCACCCTGAGG + Intergenic
1181032981 22:20157201-20157223 AGTGCCCAGAGCAGGCCAGGTGG + Intergenic
1181044934 22:20210001-20210023 AGAGCTCAGAGCCGTGGCTGGGG - Intergenic
1181098093 22:20519996-20520018 AGAGCTCAGAGAAGCTGCTGGGG - Intronic
1181510317 22:23386033-23386055 AGTGCCCAGAGCAGGCCAAGTGG - Intergenic
1181630703 22:24149825-24149847 AAAGCTCAGAGCTGGACCTATGG - Intronic
1181669562 22:24419829-24419851 AGATGTGAAAGCAGGCCCTGAGG - Intronic
1181702668 22:24629667-24629689 AGAGGAGGGAGCAGGCCCTGAGG - Intergenic
1182144778 22:27990702-27990724 CGAGCTCAGAGCCTGCCCAGGGG + Intronic
1182297534 22:29318536-29318558 AGAGCTCATTTCAGCCCCTGTGG - Intronic
1182473866 22:30565179-30565201 AGAGCCCAGAACAGGCTCTAAGG + Intronic
1183248167 22:36709940-36709962 AGAGAGAAGAGCAGGCCCTGGGG - Intergenic
1183366581 22:37410241-37410263 TGAGCTCAGCTCAGGCCCTAGGG + Intronic
1183689947 22:39382807-39382829 AGAGCACAGAGCAGCACCCGGGG - Exonic
1184001218 22:41675050-41675072 TGCGCTCCAAGCAGGCCCTGGGG - Exonic
1184982781 22:48106051-48106073 AGAACCCAGAGCAGGCGCTCTGG + Intergenic
1185030967 22:48442725-48442747 AGAGCCCAGAGCAGGTCCTGGGG - Intergenic
1185233222 22:49695038-49695060 AGAGCTCAAAGCCGGCCTGGGGG + Intergenic
1185255537 22:49828711-49828733 AGAGGACAGAGGGGGCCCTGCGG + Intergenic
950096044 3:10331177-10331199 AGAGCTCAGAGCAGCCACAGTGG - Intronic
950142135 3:10622712-10622734 TGAGCTCAGAGCATGGCCTGGGG + Intronic
950207518 3:11092161-11092183 AGAGGGCAGAGCTGGGCCTGGGG + Intergenic
950332405 3:12166986-12167008 AGAGATCAGGGCAGGCTCTGTGG + Intronic
950682383 3:14594136-14594158 AGGGCTCAGAGCAGTACTTGAGG - Intergenic
951614022 3:24522040-24522062 CGAGCTCAGACCCGGCACTGAGG + Intergenic
952852497 3:37740671-37740693 AGACCTCAGAGCAACCCCAGAGG - Intronic
952878715 3:37969689-37969711 AGGGCTGAGGGCAGGGCCTGTGG - Intronic
952960951 3:38588840-38588862 TCAGCTCAGAAGAGGCCCTGTGG + Intronic
953189989 3:40676777-40676799 AGAGATCAGAGGAGGTCCTAGGG - Intergenic
953848269 3:46445874-46445896 TCAGCTCAGGGCAGTCCCTGGGG - Intronic
954412677 3:50377859-50377881 AGTGTTCAGAGCAGGGACTGAGG + Intronic
954459770 3:50619667-50619689 TGAGCTCTGACCAGCCCCTGTGG + Intronic
954577911 3:51686864-51686886 AGACCTCAGAACAGGACATGTGG + Intronic
955103741 3:55876401-55876423 AGAACACAGCGCAGGGCCTGTGG - Intronic
955696244 3:61640321-61640343 AGAGATCAGAGTAGGTCCTGGGG + Intronic
956779163 3:72590870-72590892 AGAGCACAGCGGAGGCCCCGGGG + Intergenic
960969655 3:123130437-123130459 AGAGCTCAGAGCAGGCCCTGGGG - Intronic
960985823 3:123280046-123280068 GGTACTCAGAGCAGTCCCTGTGG - Intergenic
961037007 3:123649319-123649341 AGAGCTCTGGGCATCCCCTGGGG + Intronic
961384125 3:126515207-126515229 GGAGCTCAGGGAGGGCCCTGCGG - Intronic
962453925 3:135547730-135547752 AGAGCAGGGAGAAGGCCCTGTGG - Intergenic
962699006 3:137978906-137978928 AGAGCACAAAGCAGGCTCTTGGG - Intergenic
963876069 3:150476171-150476193 AGAGCTAAAAGCAGCCCCTGAGG + Intergenic
966300578 3:178475267-178475289 TCAGCTCATAGCAGGCCCTCTGG - Intronic
966570073 3:181431238-181431260 AGGGCTCAGAAGAGGCCCTGTGG + Intergenic
967086007 3:186095928-186095950 AGTGCGCAGAGCAGGCGCTGTGG + Intronic
968434055 4:576026-576048 AGAGCGCGGCGCAGGCCCCGCGG + Intergenic
968461286 4:726360-726382 TGTGCTGGGAGCAGGCCCTGCGG + Intronic
968462780 4:733566-733588 GGAGGACAGTGCAGGCCCTGAGG - Intronic
968508885 4:986853-986875 GGTCCTCAGAGCAGCCCCTGAGG + Intronic
968528574 4:1077771-1077793 AGAGCTTCCAGCAGGGCCTGAGG + Intronic
968690708 4:1988452-1988474 AGTGCCCAAAGCAGACCCTGTGG + Intronic
968791940 4:2671175-2671197 AGAGCACAGTGCATGCACTGAGG - Intronic
969010350 4:4056585-4056607 ACAGCACAGTGAAGGCCCTGAGG - Intergenic
969250368 4:5964217-5964239 AGAGCTCTGAGCAGCCTCTTGGG + Intronic
969509915 4:7611964-7611986 AGAGCCCAGAGCTGGGCATGGGG - Intronic
969569683 4:8001229-8001251 GGAGGACAGAGGAGGCCCTGGGG + Intronic
969657663 4:8507459-8507481 AACGCCCAGAGCAGGCGCTGGGG - Intergenic
969673387 4:8601843-8601865 AGAGTGCAGGGCTGGCCCTGGGG + Intronic
969704522 4:8784580-8784602 AGAGCCCAGACCAGAGCCTGGGG + Intergenic
970112390 4:12652887-12652909 AGAACTCAGAGCTTGCCCTGAGG + Intergenic
970394669 4:15654745-15654767 AGAGCCCCGAACAGGCCCGGGGG + Intronic
970581420 4:17477443-17477465 AGAGCCGTGGGCAGGCCCTGGGG + Intronic
971888366 4:32483180-32483202 AGAGCTCTCACCAGGCCATGAGG + Intergenic
972331460 4:38068017-38068039 AGAGAGCAGAGCTGGCCCTGGGG + Intronic
977127793 4:93192452-93192474 AGATTTCAGACCAGGCACTGTGG + Intronic
977276508 4:94983743-94983765 TGAGCTCAGAGAAGGCTTTGTGG - Intronic
978520507 4:109610241-109610263 AGAGCACTGAGCAGGCTCTTGGG - Intronic
979539646 4:121866692-121866714 AGAGCCAAGAACAGCCCCTGGGG - Intronic
980654742 4:135767087-135767109 AGAGTGAAGAGCAGGCCTTGGGG + Intergenic
982165443 4:152609610-152609632 ATAGGTCAAAGCAGGTCCTGCGG + Intergenic
983493128 4:168412267-168412289 AGAGCACTGAGCAGGCTCTTGGG + Intronic
984954465 4:185031742-185031764 AGAGTGCAGAGCAGCCACTGGGG + Intergenic
985619603 5:947266-947288 AAAGCTCAGAGCAGGCTCTGGGG - Intergenic
985817810 5:2139589-2139611 TGAGCTCACAGCAGGTCATGTGG + Intergenic
985897255 5:2756052-2756074 GGCGCTCAGAGCAGCCCGTGCGG - Intergenic
987079189 5:14411073-14411095 AGAGCGCTGAGCCGGGCCTGGGG + Intronic
988427018 5:31075572-31075594 AGAGCTCAGGGCATGGGCTGGGG - Intergenic
991500175 5:67268924-67268946 AGAGCCAAGAACAGGCTCTGGGG - Intergenic
997446369 5:133943249-133943271 AGAGTCCCAAGCAGGCCCTGGGG + Intergenic
998177550 5:139911218-139911240 AGGGCACACAGCAGGCCCCGGGG - Intronic
998256221 5:140590975-140590997 TGAGCAGACAGCAGGCCCTGTGG + Intronic
998951320 5:147395617-147395639 AGAGCCCCGAGCAGAGCCTGCGG + Exonic
999063989 5:148665383-148665405 AGAGCTCAGAGCAGTAGGTGTGG + Intronic
999377319 5:151095821-151095843 AGAACTCAGAGAAGGACATGAGG - Intergenic
999828077 5:155293067-155293089 AGAGCTCAGAGCTGGGCCTGGGG + Intergenic
1001565983 5:172699795-172699817 AGAGCACAGCGAAGGCCCAGGGG + Intergenic
1001568696 5:172716483-172716505 AGGGCTCAGAGCAAGGCCTTGGG + Intergenic
1001818529 5:174691494-174691516 AGAGCTCAAGGCAGGACCTCTGG - Intergenic
1001934124 5:175692642-175692664 AAAGTTCAGGGCAGGCTCTGTGG + Intergenic
1002107270 5:176886261-176886283 AGAGGTCAGAGCAGGAGCAGGGG + Intronic
1002564011 5:180100002-180100024 AGGGCTCTGCCCAGGCCCTGCGG + Intergenic
1002660399 5:180787714-180787736 AGCCCTCAGAGCAGGCCAAGAGG - Intergenic
1002795058 6:465460-465482 AGAGGTGAGAGAAGGTCCTGTGG + Intergenic
1002876557 6:1215800-1215822 AGAGCTGAGACCGGGCTCTGAGG + Intergenic
1003510003 6:6771667-6771689 AGACATCAGCACAGGCCCTGGGG - Intergenic
1003972138 6:11310063-11310085 AACGCTCAGAGCATGCTCTGGGG - Intronic
1004384562 6:15161509-15161531 AGAGTTCAAAGCAGGGCCAGGGG - Intergenic
1006402309 6:33824994-33825016 AGAGCTCAGCCCAGGGACTGGGG - Intergenic
1007089440 6:39172987-39173009 AGACCTCAGAACAACCCCTGGGG - Intergenic
1007477328 6:42127582-42127604 AGAGCTCAGACCAGGGCAAGGGG + Intronic
1007653302 6:43436528-43436550 AGCATTCAGAACAGGCCCTGGGG + Intronic
1007654260 6:43442777-43442799 AAAGCTGAGTGCTGGCCCTGGGG + Intronic
1007765028 6:44155077-44155099 AGAGCCCCGAGCCGGCCCCGGGG + Exonic
1008449384 6:51632602-51632624 ACAGCTCAGAGCCAGCCATGAGG + Exonic
1009298875 6:61989830-61989852 AGAGGCCAGAGCAAGCCCTCAGG - Intronic
1010034504 6:71308540-71308562 AGAGCACAGAGAAGGCCCAGTGG - Exonic
1010434498 6:75813854-75813876 AGAGAACAGGGCAGGTCCTGAGG - Intronic
1011051897 6:83160298-83160320 GAAGGTCAGAGCAGGCCCTGAGG + Intronic
1011241581 6:85277212-85277234 GTAGGTCAGAGAAGGCCCTGTGG - Intergenic
1011459637 6:87589886-87589908 AGCGCGCAGAGGAGTCCCTGAGG - Intronic
1011706210 6:90003823-90003845 AGAGCACAGAGCCTGCCCTTTGG - Intronic
1012091471 6:94902964-94902986 AGAGCACTGAGCAGGCTCTTGGG + Intergenic
1013013856 6:106143751-106143773 GCAGTTCAGAGCAGCCCCTGGGG - Intergenic
1013925616 6:115468258-115468280 AGAGCACCAAGCAGGCCCTTGGG - Intergenic
1016272227 6:142302115-142302137 AGCGTTCAGCGCAGGGCCTGCGG - Exonic
1016466916 6:144334792-144334814 ATAGCTGGGAGCTGGCCCTGAGG + Intronic
1017435310 6:154410271-154410293 AGAGGTGAAACCAGGCCCTGGGG + Intronic
1019057670 6:169234930-169234952 GGAGCTCAGAGCAAGACCCGGGG + Intronic
1019261520 7:84493-84515 ACACCTCCAAGCAGGCCCTGAGG + Intergenic
1019262109 7:87511-87533 AGAGTTTTGAGCAGGACCTGAGG + Intergenic
1019311278 7:362025-362047 AGAGATCAGGGCAGGAACTGGGG - Intergenic
1019350122 7:550618-550640 AGAGGTCAGGGCTGGGCCTGGGG + Intronic
1019617989 7:1975205-1975227 GGAGCCCAGGGCAGGACCTGGGG - Intronic
1019734492 7:2644106-2644128 GGAGCCCAGGGGAGGCCCTGTGG + Intronic
1019934580 7:4245974-4245996 GGGGCCCAGAGCAGGCCGTGGGG - Intronic
1019985193 7:4650502-4650524 TGAGCTTTGAGCAGGCTCTGTGG - Intergenic
1020104070 7:5413063-5413085 AGGGCTCCCAGCAGGCCCTGGGG + Intronic
1020268245 7:6576264-6576286 ATAGCCCTGAGAAGGCCCTGTGG - Intergenic
1020515012 7:9107039-9107061 AGAGCACCAAGCAGGCTCTGGGG + Intergenic
1022010401 7:26303626-26303648 AGGGCTCAGAACAGGCCCCAAGG - Intronic
1022421669 7:30229434-30229456 AGTGCTCATAGCAGCCCATGAGG + Intergenic
1022906463 7:34862360-34862382 AGAGTTCAGAGGAGGCCCCAGGG - Intronic
1023050187 7:36244575-36244597 AGAGCCCAGAGCCAGCTCTGAGG + Intronic
1023301215 7:38773888-38773910 AGAGTTCAGACCAGGACCCGGGG - Intronic
1025022908 7:55494029-55494051 AGAACACAGAGCAGGTACTGGGG + Intronic
1025177949 7:56811370-56811392 AGAGGCCAGAGCTGGGCCTGGGG + Intergenic
1025181943 7:56827793-56827815 AGAGGCCAGAGCTGGGCCTGGGG + Intergenic
1025689977 7:63749202-63749224 AGAGGCCAGAGCTGGGCCTGGGG - Intergenic
1026957535 7:74387144-74387166 AGAACACAGAGCTGGCTCTGGGG - Intronic
1026969594 7:74459898-74459920 AGGGCTCAGTGGAGGCCCCGGGG + Intronic
1028012236 7:85661275-85661297 AGAGCTGATAGAAGGCACTGAGG - Intergenic
1028382283 7:90212274-90212296 AGAGCTAAGGGCAAGTCCTGAGG + Intronic
1028719869 7:94016698-94016720 AGAGTTCAGGCCAGGCGCTGTGG - Intergenic
1030694128 7:112566459-112566481 AAATTTCAGAGCAGTCCCTGAGG + Intergenic
1031945670 7:127837601-127837623 TAAGCTCAGAGCATGCCCAGAGG + Intronic
1031995107 7:128225498-128225520 AGAGCTCAGAGGAGACCCTTGGG + Intergenic
1034878549 7:154746280-154746302 AAGGATCAGAGGAGGCCCTGGGG - Intronic
1035344479 7:158189034-158189056 ATGGCTCATAGCAGCCCCTGGGG - Intronic
1035860330 8:3021558-3021580 AGAGTTCAGAGGAAGCACTGCGG - Intronic
1035913957 8:3598615-3598637 AGAGCTCAGTACAGTTCCTGAGG + Intronic
1036428771 8:8670361-8670383 AGAGATCCGAGCAGCCCCTCTGG + Intergenic
1036560178 8:9895036-9895058 AGAGGACAGAGCAAGCCATGAGG + Intergenic
1037992341 8:23329938-23329960 GGGGGTCAGAGCAGTCCCTGAGG - Intronic
1037994288 8:23341322-23341344 AGAGCTCACTGCAGGGCCTGAGG - Intronic
1039466867 8:37790772-37790794 AGAGCTCAGAGGAAGCCCCGGGG + Intronic
1039562998 8:38528112-38528134 GGAGCTCAGAGCACTCCCAGGGG - Intronic
1039912216 8:41834514-41834536 AGACCACAGGGCAGGCTCTGTGG - Intronic
1040531461 8:48269782-48269804 AGAGGCCAGGGCAGGCGCTGGGG + Intergenic
1041004222 8:53483699-53483721 ACAGCTTTGAGCAGGACCTGGGG + Intergenic
1041945221 8:63433398-63433420 AGAGAGCAGAGCAGGCACTAGGG + Intergenic
1042080063 8:65041851-65041873 GGAGCTCAGAGAAGGCCCTCAGG - Intergenic
1042445859 8:68884550-68884572 AGAACTCCATGCAGGCCCTGTGG + Intergenic
1042687803 8:71461743-71461765 ATAGCTCAGAGGAGATCCTGAGG + Intronic
1043341252 8:79242747-79242769 AGATGTCAGAGCAGCCCCTTGGG + Intergenic
1043734981 8:83730796-83730818 ACAGCTTAGAGGAGACCCTGGGG + Intergenic
1044757905 8:95485328-95485350 AGAGGTGAGAGCAGGCAGTGGGG + Intergenic
1045799306 8:106083325-106083347 TGAGCCCAGAGCAGGCTCTGTGG + Intergenic
1046292700 8:112183599-112183621 AGAGGTAAGAGCATGCCCAGTGG + Intergenic
1047498555 8:125425912-125425934 AGATCTGAGTGCAGGCGCTGGGG + Intergenic
1048080219 8:131118695-131118717 GTATCTCAGAGGAGGCCCTGAGG + Intergenic
1048867535 8:138771840-138771862 AGAGCTCTCCGCAGGCCCCGGGG - Intronic
1049310949 8:141933603-141933625 AGAGCTCACCCCAGGCTCTGGGG - Intergenic
1049422093 8:142521536-142521558 ACAGCACATGGCAGGCCCTGGGG - Intronic
1049574828 8:143385177-143385199 AGAGGGCAGTGCAGCCCCTGGGG + Intergenic
1050191865 9:3034700-3034722 AGTGCTCAGTGCAGGTCTTGAGG - Intergenic
1051205857 9:14688443-14688465 ACAGGCAAGAGCAGGCCCTGGGG - Intronic
1051478260 9:17532455-17532477 AGAGGACAGACTAGGCCCTGGGG + Intergenic
1051609936 9:18951275-18951297 AGACCTCAGGGGAGGACCTGGGG - Intronic
1052152474 9:25134399-25134421 ATAGCTCAGAGAAGGCTCAGAGG - Intergenic
1052319728 9:27155018-27155040 GGAGCTCAGAGCAGATCCTGTGG + Intronic
1052654202 9:31334787-31334809 ATAGCTCAGAGGAGGCCCTGGGG + Intergenic
1055630583 9:78219674-78219696 AGAGCTCAGGGAATGCCCTTTGG - Intergenic
1056719632 9:89060633-89060655 TGAGCTCACAGAAGGTCCTGTGG + Intronic
1057962017 9:99465889-99465911 AGGTCTCAGACCAGGCCTTGTGG - Intergenic
1058088818 9:100781126-100781148 TGACCCCACAGCAGGCCCTGGGG - Intergenic
1059499125 9:114735953-114735975 AGAGGTGAGAGCAGACACTGGGG - Intergenic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060795628 9:126510801-126510823 AGAGGTCTGGGAAGGCCCTGAGG + Intergenic
1061323676 9:129849067-129849089 AGAGCTCAAAGGATGGCCTGAGG + Intronic
1061378680 9:130241331-130241353 GGAGCCCAGGGCAGCCCCTGAGG + Intergenic
1061398101 9:130354400-130354422 AGAGCTCTGTCCCGGCCCTGGGG + Intronic
1061486323 9:130922273-130922295 AGACCCCAGACCAGGCCCGGGGG - Intronic
1062325427 9:136010402-136010424 TGAGCTCAGGGCCGGACCTGGGG - Exonic
1186221728 X:7356281-7356303 AGAGCTCAGAGGAGGGCCTAAGG + Intergenic
1187169308 X:16835910-16835932 AGAGTTCAGTGCTGGCCCAGTGG - Intronic
1187528752 X:20077493-20077515 GAAGCTTAGAGCAGGTCCTGCGG - Intronic
1187618690 X:21026978-21027000 AGAGCACAAAGCAGGCTCTTGGG - Intergenic
1189170616 X:38905882-38905904 AGAGCTCACCACAGGCCCTGTGG + Intergenic
1189890034 X:45591576-45591598 AGAGCACAAAGCAGGCTTTGGGG - Intergenic
1192151690 X:68716714-68716736 AGAGCTGAGACCAGGCCCCATGG - Intronic
1192179878 X:68909796-68909818 AGAGGACAGAGCAGGAGCTGGGG - Intergenic
1192233977 X:69284681-69284703 CGAGCTGAGACCAGGCCCCGAGG - Intergenic
1193147392 X:78092050-78092072 AGTGGTCACAGCAGGCCTTGGGG - Intronic
1194457568 X:94123733-94123755 AGAGCTAAAAGCAGGCTCTTGGG - Intergenic
1197250220 X:124208315-124208337 AAAGCTCAGACCAGGCACAGTGG - Intronic
1197565770 X:128084078-128084100 AGAGCACAGAGTTGGACCTGAGG + Intergenic
1199374235 X:147088321-147088343 AGAGCAAAAAGCAGGCCCTTGGG - Intergenic
1199616121 X:149657592-149657614 GGAGCACAGACCAGGCGCTGGGG - Intergenic
1199626519 X:149745656-149745678 GGAGCACAGACCAGGCGCTGGGG + Intergenic
1199793917 X:151177760-151177782 AGAGCTCAGAGGCGGCGATGGGG + Intronic
1200062844 X:153491300-153491322 AGAGCTCACAGCCTGCCCTCTGG + Intronic
1200094206 X:153649723-153649745 GGAGGCCAGAGCAGGCCTTGGGG - Intronic
1200777996 Y:7186958-7186980 AGAGCTCAGAGCAGCACCAAAGG - Intergenic
1202365359 Y:24158445-24158467 GGAGCTGAGAGCAAGCCATGGGG + Intergenic
1202378525 Y:24258270-24258292 AGAGAGCAGAGGAGACCCTGGGG + Intergenic
1202492257 Y:25411851-25411873 AGAGAGCAGAGGAGACCCTGGGG - Intergenic
1202505422 Y:25511677-25511699 GGAGCTGAGAGCAAGCCATGGGG - Intergenic