ID: 960969800

View in Genome Browser
Species Human (GRCh38)
Location 3:123131256-123131278
Sequence CAAGACCCTGTCTCATTAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960969796_960969800 5 Left 960969796 3:123131228-123131250 CCACTGCACTCCAGCCTGAGTAA 0: 291
1: 12865
2: 174040
3: 289915
4: 210438
Right 960969800 3:123131256-123131278 CAAGACCCTGTCTCATTAGCCGG 0: 1
1: 0
2: 0
3: 17
4: 212
960969797_960969800 -5 Left 960969797 3:123131238-123131260 CCAGCCTGAGTAACCAAACAAGA 0: 1
1: 2
2: 76
3: 1465
4: 16485
Right 960969800 3:123131256-123131278 CAAGACCCTGTCTCATTAGCCGG 0: 1
1: 0
2: 0
3: 17
4: 212
960969798_960969800 -9 Left 960969798 3:123131242-123131264 CCTGAGTAACCAAACAAGACCCT 0: 1
1: 2
2: 31
3: 546
4: 5419
Right 960969800 3:123131256-123131278 CAAGACCCTGTCTCATTAGCCGG 0: 1
1: 0
2: 0
3: 17
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960969800 Original CRISPR CAAGACCCTGTCTCATTAGC CGG Intronic
901067433 1:6500891-6500913 CCCGACCCTGTCTCAGTCGCAGG + Intronic
901242107 1:7701425-7701447 CAAGACCCTGTCTCAAAAAGGGG - Intronic
901370344 1:8792074-8792096 CAAGACCCTGTCTCAAAAGAAGG + Intronic
902200000 1:14826305-14826327 CAAGAATCTGTCTCATTGTCAGG + Intronic
902878293 1:19353942-19353964 CAGGACTCTGTCTCAGCAGCCGG - Intronic
904563229 1:31412655-31412677 CAAGACCCTGTCTCTTAAAAAGG + Intronic
905476948 1:38235686-38235708 CAAGACCCTGTCTCAAAAAAGGG + Intergenic
906985772 1:50681844-50681866 CAAGACCCTGTCTCAAAAAGAGG - Intronic
915613400 1:157014417-157014439 CAAGACCCTGTCTCAAAAAGAGG - Intronic
917341217 1:173979901-173979923 TGAGACCCTGTCTCTTTAGGGGG - Intronic
917864339 1:179178891-179178913 CAAGACCCTGTCTCAAGAAAAGG + Intronic
919850656 1:201669840-201669862 CAAGTCCCTGTCTCTTTTCCCGG - Intronic
920408002 1:205733886-205733908 CAAGACCCTGTCTCAATTGTTGG - Intronic
923123064 1:231012214-231012236 CAAGACCCTGTCTCAAGAGAAGG - Intergenic
924239078 1:242024073-242024095 CAAGACCCTGTCTCAAAAAAAGG - Intergenic
924906975 1:248465400-248465422 CAAGACCCTGACTCAAAAACAGG + Intergenic
1065886947 10:30087056-30087078 CAAGACTCTATCTCACTAGCAGG - Intronic
1066668533 10:37812223-37812245 CAAGACCCTGTCTCAAAAAAAGG + Intronic
1067015785 10:42755486-42755508 TAAGCCCCTGTCTCATAGGCTGG + Intergenic
1067439000 10:46297750-46297772 CAAGACACTGTCTCCTGGGCCGG + Intronic
1069480554 10:68777918-68777940 CAAGACCCTGTCTGAAAAGAAGG + Intronic
1069655594 10:70085475-70085497 CAAGACTCTGTCTCCTTGCCAGG - Intronic
1071590039 10:86864192-86864214 CATGTGCCTGTCTAATTAGCAGG - Intronic
1073003619 10:100304503-100304525 CAAGACCCTGTCTCAAAAAAAGG - Intronic
1074516678 10:114176666-114176688 CATCACCCTGCCTCAGTAGCTGG - Intergenic
1078126920 11:8575030-8575052 CAAGACCCTGTCTCAAAAAAAGG + Intronic
1079734662 11:23981216-23981238 CAATACCCTGTCTCTTTGGGTGG - Intergenic
1083767084 11:64846769-64846791 CAAGACCCTGTCTCAAAAAAAGG - Intergenic
1084218717 11:67665227-67665249 CAAGACCCTTTCTCAATGGAGGG - Intronic
1084354889 11:68631521-68631543 CATGTGCCTGTCTAATTAGCAGG - Intergenic
1085743985 11:79099283-79099305 CCAGACCCTCTCTCCTTTGCAGG + Intronic
1087059770 11:93966082-93966104 CAAGACCCTGTCTCAAAAAAAGG + Intergenic
1089954034 11:122554286-122554308 CATGTGCCTGTCTGATTAGCAGG - Intergenic
1091877846 12:3951420-3951442 CAAGCTCCTCTCTCATTAACGGG - Intergenic
1092234267 12:6796401-6796423 CAAGATCTTGTCTCACCAGCAGG + Intronic
1094479268 12:30868921-30868943 CAAGACCCTGTCTCAGAAGAAGG - Intergenic
1096643184 12:53011253-53011275 CAAGACCCTGTATGATTTGGTGG + Intronic
1098114629 12:67161869-67161891 CAAGACCCTGTCTCAAAAAATGG + Intergenic
1098546213 12:71714383-71714405 CAAGACCCTGTCTCAAAAAAAGG + Intergenic
1098552574 12:71779440-71779462 CAAGACCCTGTCTCAAAAAAAGG + Intronic
1099331844 12:81298971-81298993 CAGGGCCCTTCCTCATTAGCAGG - Intronic
1100272924 12:93043547-93043569 CAAGACCCTGTCTCAAAAAAAGG - Intergenic
1100477780 12:94949790-94949812 CAAGACCCTGTCTCAGAAAAAGG + Intronic
1100622407 12:96291301-96291323 CAAGACCCTGTCTCAAAAAGAGG - Intronic
1100828168 12:98493966-98493988 CAAGACCCTGTCTCAAAAAAAGG + Intronic
1102022645 12:109694877-109694899 CAAGACCCTGTCTCAAAAAAAGG + Intergenic
1102635867 12:114323351-114323373 CAAGTCCCTGTCTAATTATGTGG + Intergenic
1102778458 12:115542046-115542068 GAAGACACTGTGTCAATAGCAGG + Intergenic
1102994545 12:117338387-117338409 CAAGACCCTGTTTCATAGGCGGG + Intronic
1103266797 12:119637370-119637392 CATGACTGTGTCTCATTAGCAGG + Intronic
1107776390 13:43847784-43847806 CAAGACCCTGTCTCAACAAAGGG - Intronic
1110567439 13:76970491-76970513 CAAGACCCTGTCTCAAAAAAAGG + Intergenic
1110583529 13:77160226-77160248 AGAAACCCCGTCTCATTAGCTGG - Intronic
1112763079 13:102712340-102712362 CAAGACTCTGTCTCAAAAACAGG + Intergenic
1114069661 14:19097292-19097314 AAAGCCCCTGTCTCATATGCTGG - Intergenic
1115901670 14:38158048-38158070 CAAGACTCTGTCTCAGTGGGGGG - Intergenic
1117949243 14:61064439-61064461 CATGATCCTATCTCATGAGCAGG - Intronic
1118936618 14:70294729-70294751 CATGTGCCTGTCTAATTAGCAGG + Intergenic
1119216768 14:72875393-72875415 CAAGACCCTGTCTCAAAAAAAGG + Intronic
1119452022 14:74719751-74719773 CAAGAACCTGTCTCAAAAGGGGG + Intronic
1120889853 14:89482256-89482278 CATGACCCTGTCTCTCTGGCAGG - Intronic
1127365400 15:58284656-58284678 CCAGTCCCTGCCTCACTAGCTGG + Intronic
1130141704 15:81231382-81231404 CAAGACCCTGTCTTAAGAGAGGG - Intronic
1130145915 15:81273546-81273568 CAAGATCCTGTCTCAGTTGCTGG + Intronic
1130534644 15:84775390-84775412 CAACACCCAGTATGATTAGCTGG - Intronic
1131208100 15:90468817-90468839 CAAGACCCTGTCTCAAAAAAAGG + Intronic
1131344343 15:91632232-91632254 CAACACCGTGTCTCCTTGGCAGG - Intergenic
1132324909 15:100960900-100960922 GATGACCCTGTCTCATTAGATGG - Intronic
1132731799 16:1366505-1366527 CCTGACCCTGTCTCTGTAGCTGG - Intronic
1133641315 16:7719910-7719932 CAAGACCCTGTCTCAAAAAAAGG + Intergenic
1134023173 16:10935396-10935418 CAAGGCCCTGTGACTTTAGCTGG + Intronic
1134895775 16:17885702-17885724 CAAGAACCTGTCTGGTTAACAGG - Intergenic
1137048095 16:35686833-35686855 CAGGAGTCTGTCTCATTAGAAGG + Intergenic
1141122212 16:81368596-81368618 CAAGACCCTGTCTCAGAAAAGGG + Intronic
1141651013 16:85393255-85393277 CAAGACCCTGTCTCAAGAAAAGG + Intergenic
1143600465 17:7942253-7942275 CAAGACTCTGTCTCAGAAGTAGG + Intronic
1143908474 17:10228252-10228274 CAAGCGCCTGGCTCAGTAGCAGG - Intergenic
1145622021 17:25735699-25735721 CAAGACCCTGTCTCAAGAAAAGG + Intergenic
1146051538 17:29557968-29557990 CAAGACCCTGTCTCAAAAAAAGG - Intergenic
1148263355 17:46203995-46204017 CAAGACCCTGTCTCACGGGTAGG + Intronic
1148368966 17:47080333-47080355 TAAGACCTTGTCTCATTAAAAGG - Intergenic
1149409294 17:56388307-56388329 TGAAACCCCGTCTCATTAGCTGG - Intronic
1150819427 17:68423372-68423394 TAAGGCACTGTCTCAGTAGCAGG - Intronic
1151145875 17:72040516-72040538 CAAGGACCTGTCTCCATAGCAGG - Intergenic
1152397805 17:80045321-80045343 CAAAACCCTGACTCATTGTCTGG + Intronic
1152983205 18:298081-298103 CAAGACACTGTGTCACAAGCAGG + Intergenic
1153067212 18:1059816-1059838 CAAGACCCTGTCTCGAAAGAAGG - Intergenic
1154113234 18:11588687-11588709 CAAGTCCCTGTCTAATTTGTAGG - Intergenic
1154996743 18:21647523-21647545 CAAGACCCTGTCTCGGTCGGGGG + Intergenic
1156313862 18:35949891-35949913 CCACACACCGTCTCATTAGCAGG + Intergenic
1156498227 18:37540185-37540207 CAAGTGCCTGTCTCACTTGCTGG + Intronic
1159929715 18:74297994-74298016 CATGTTCCTGTCTCATTAACAGG - Intergenic
1161360410 19:3845830-3845852 CAAGACCCTGTCTCCAAATCCGG + Intronic
1161998082 19:7726696-7726718 CAAGACCCTGTCTCAAAAAAAGG + Intergenic
1162053957 19:8051813-8051835 CAAGACCCTGTCTCAAAAAATGG - Intronic
1162353349 19:10165257-10165279 CAAGACCCTGTCTCTTGGGATGG + Intronic
1162899904 19:13788622-13788644 CAAGACCCTGTCTCAAAACAGGG + Intergenic
1165068811 19:33243478-33243500 CACGACCCTGTCTCAACAGGTGG + Intergenic
1165360490 19:35333564-35333586 CGAGACCCTGTCTCATAAAAAGG - Intronic
1165825639 19:38704287-38704309 CCAGACCCTGTCTCAAAAGAAGG + Intronic
1167901560 19:52626009-52626031 CATGTCCCTGTCCGATTAGCAGG - Intronic
925548342 2:5041881-5041903 CCAGACCCTGTCTCAATGGAAGG - Intergenic
927181767 2:20451810-20451832 CAAGACCCTGTCTCTTAAAAAGG - Intergenic
930165954 2:48204098-48204120 CAAGACCCTGTCTCAAAAAAAGG - Intergenic
930198988 2:48534768-48534790 CGAGACCCTGTCTCCTAAGAGGG + Intronic
931724834 2:65099636-65099658 CAAGACCCTGTCCCTTTAAGGGG - Intronic
932615730 2:73230275-73230297 CCAGACCCTGTGTCTTCAGCTGG + Intronic
932707905 2:74040884-74040906 CAAGACCCTGTCTCAAAAAAAGG + Intronic
938791876 2:134683680-134683702 ACAGACCCTGGCTCAATAGCAGG + Intronic
942028308 2:171933067-171933089 CAAGACCTTGTCTCAAAAGAAGG - Intronic
942599365 2:177625056-177625078 CAAGACCCTGTCTCAAAAAAAGG + Exonic
944712908 2:202351614-202351636 CAAGACCCTGTCTCAAAAAAAGG - Intergenic
945226596 2:207537214-207537236 TGAAACCCTGTCTCTTTAGCTGG - Intronic
947540266 2:230972510-230972532 CAAGACCCTGTCTCAAAAAAAGG - Intergenic
948572000 2:238923507-238923529 CAAGACCCTGTCTCAAAAATAGG + Intergenic
1169106041 20:2995293-2995315 CAAGACCCCGTCTCTACAGCGGG - Intronic
1169204944 20:3734154-3734176 CAAGACCCTGTCTCAAAAAAAGG + Intronic
1169961330 20:11163417-11163439 CAAGATCCTGTTTTATTATCTGG + Intergenic
1170069423 20:12348834-12348856 CATGCCCCTCTCTCATCAGCTGG + Intergenic
1174807337 20:53616100-53616122 CAAGACCCTGTCTCAAAAAAAGG - Intergenic
1177236646 21:18398874-18398896 CATGACCTTGTGCCATTAGCTGG + Intronic
1177813066 21:25945708-25945730 CAAGACCCTGTCTCAAAAAAAGG - Intronic
1180661957 22:17475469-17475491 CAAGACCCTGTCTCTTTTAAGGG - Intronic
1180668246 22:17532153-17532175 CAAGACCCTGTCTCAAAAAAAGG + Intronic
1182250159 22:28993692-28993714 CAAGACCCTGTCTCAGAAAAGGG - Intronic
1182570233 22:31231826-31231848 CAAGACCCTGTCTCAAAAAAAGG - Intronic
949512863 3:4781969-4781991 CAAGACCCTGTCTCAAAAAAAGG + Intronic
949848109 3:8392754-8392776 CAAGACCCTGGCACAATTGCTGG + Intergenic
950353566 3:12382124-12382146 CTAGACCCTGACTCCTTAGGTGG + Intronic
950779487 3:15379120-15379142 CAGGACCCTGTCCTCTTAGCAGG - Intergenic
951714761 3:25628462-25628484 CAAGACCCTGTCTCAACAATAGG + Intronic
954357707 3:50096474-50096496 CAAGACCCTGTCTCAAAAAGAGG + Intronic
955012468 3:55031728-55031750 TAAGAACCTTTGTCATTAGCCGG - Intronic
959568595 3:107858151-107858173 CAAGACCCTGTCTCAAAAAAAGG - Intergenic
959668202 3:108944637-108944659 CAACCCCGTGTCTCATTTGCTGG + Intronic
960022788 3:112974422-112974444 CAAGACCCTGTCTCAAAAAAGGG + Intronic
960277227 3:115742144-115742166 CCAGACCCTGTCTGATGAGGAGG + Intergenic
960969800 3:123131256-123131278 CAAGACCCTGTCTCATTAGCCGG + Intronic
961256578 3:125559636-125559658 CAAAACCCTGTCTCAGGAGATGG - Intronic
966755226 3:183363706-183363728 TGAGACCCTGTCTCAAAAGCAGG + Intronic
966846061 3:184130799-184130821 CAAGACCCTGTCTCAAAAAATGG + Intergenic
970392006 4:15621838-15621860 CCAGACCCTGTCTCAAAAGAAGG - Intronic
974735527 4:65926857-65926879 CAAGATCTTTTCTCTTTAGCGGG + Intergenic
975761751 4:77627032-77627054 CAAGACCCTGTCTCAAAAAAAGG - Intergenic
975915364 4:79318927-79318949 CAAGACCCTGTCTCAAAAAAAGG - Intronic
977277238 4:94992892-94992914 CAAGACCCCATCTCTTTAGGGGG - Intronic
977565517 4:98576688-98576710 CAAGACCCTGTCTCAAAAAAAGG + Intronic
979772052 4:124538610-124538632 CAGGAGCCTTTCACATTAGCTGG - Intergenic
979959600 4:127001660-127001682 CCAGACCCTGTCTCAAAAGAAGG + Intergenic
980428927 4:132664905-132664927 TAAAAACCTGGCTCATTAGCAGG + Intergenic
982294604 4:153814384-153814406 CAAGACCTTGTCTCAAAAGAGGG - Intergenic
987101946 5:14598704-14598726 CAAGACCCTGTCTCAAAAAAAGG + Intronic
988547176 5:32169268-32169290 AAAGACCCTGTCTCAAAAACAGG + Intronic
988801770 5:34702465-34702487 CAAGACCCTGTCTCAGGCGGGGG + Intronic
989040665 5:37225080-37225102 CAAGACCCTGTCTCCCAGGCTGG - Intronic
990151487 5:52822940-52822962 GAGGACACTGTCTCATTAGATGG + Intronic
992417466 5:76565647-76565669 TAAGACCCTGCCCCATTTGCTGG - Intronic
994523584 5:100874582-100874604 CAAGACCCTGTCTCAAAAAAAGG - Intronic
996086881 5:119314246-119314268 CCAGACCCTGTCCCATGTGCTGG - Intronic
999222296 5:149990432-149990454 CAAGACCCTGTCTCAAAAAAAGG - Intronic
999349141 5:150850570-150850592 CAAGACCCTGTCTCAAAAAAGGG - Intronic
999821241 5:155231326-155231348 CAAGACCATGTCTCAATAAAAGG - Intergenic
1000790630 5:165602560-165602582 CCAGATCCTGTCTCAGCAGCAGG - Intergenic
1000962185 5:167612958-167612980 CACAACCCTGTTTCCTTAGCTGG - Intronic
1001026881 5:168232052-168232074 CAAGACCCTGTCTCAAGAAAAGG + Intronic
1001493975 5:172175025-172175047 CAAGACCCTGACTGAAAAGCAGG - Intronic
1002450713 5:179316925-179316947 CAAGACCCTGTCTCAAAAAAAGG + Intronic
1003976088 6:11346019-11346041 CAACACCATGTCTCATTTTCAGG + Intronic
1004163694 6:13236719-13236741 AAAGACCCTGTCTCAATAAGGGG + Intronic
1004715288 6:18210986-18211008 CAAGACCCTGTCTCTTTAAAGGG + Intronic
1005327048 6:24712368-24712390 CAAGACCCTGTCTCAAAAAAAGG + Intronic
1005890431 6:30133072-30133094 TGAAACCCTGTCTCATTAGCCGG - Intergenic
1006659068 6:35624010-35624032 CAAGACCCTGTCTCTTAAAAAGG - Intronic
1011317050 6:86046281-86046303 CAAGACCCTGTCTCAAAGGAGGG - Intergenic
1014784166 6:125598925-125598947 CAATTCCCTGTCTCACTGGCTGG - Intergenic
1015816089 6:137212267-137212289 CAAGACTCTGTCTCAAAAGGAGG - Intronic
1015978142 6:138812036-138812058 CAAGACACTGTCTCAAAAGAAGG + Intronic
1016959937 6:149663461-149663483 CAAGACCCTGTCTCAAAAGAGGG + Intronic
1017704650 6:157110992-157111014 CAAGACCCTGTCTTAATAAATGG + Intronic
1018023451 6:159785208-159785230 CAAGACCCTGTCTCGGGAGTGGG - Intronic
1018976998 6:168573704-168573726 CAGGACCCTGTCTCCCCAGCAGG + Intronic
1019434564 7:1015377-1015399 CAAGTCCCTGTCTCATGAACAGG + Intronic
1020209420 7:6147430-6147452 CAAGACCCTGTCTCAAAAAAAGG + Intronic
1021832142 7:24624894-24624916 GAAGACTCTGTATCATTGGCCGG - Intronic
1023661842 7:42478304-42478326 AAAGCCCATGTCTCATTGGCTGG + Intergenic
1027001132 7:74655204-74655226 TAAGACCCTGTCTCAAAAACAGG + Intergenic
1029963239 7:104710261-104710283 CAAGACCATTTCTCAGTAACAGG + Intronic
1031093778 7:117394114-117394136 CAAGACCCTGTCTCCTAAAAAGG - Intronic
1031393652 7:121246782-121246804 CAATACCCTCTCTCATTAACAGG - Intronic
1032242747 7:130177520-130177542 CAAGACCCTTTCTCAAAAGCAGG + Intronic
1033738132 7:144244954-144244976 AAAGACCCTGTCTCAATGGGGGG - Intergenic
1033744921 7:144305999-144306021 AAAGACCCTGTCTCAATGGGGGG + Intergenic
1035922407 8:3691983-3692005 CAGCATCCTGTCTCATGAGCTGG - Intronic
1040620049 8:49081984-49082006 CAAGACCCTATCTCAAAAGAAGG + Intergenic
1040701474 8:50071208-50071230 CAAGACTCTGTCTCAAAAACAGG - Intronic
1041232820 8:55770663-55770685 CAAGACCCTGTCTCGGGGGCAGG + Intronic
1041391657 8:57352444-57352466 CAAGATCCTGTCTCAAAAGAAGG - Intergenic
1041765395 8:61413400-61413422 AAACCCCATGTCTCATTAGCTGG - Intronic
1042202892 8:66299095-66299117 CATGAGCCTGCCTCAGTAGCTGG + Intergenic
1043127684 8:76420407-76420429 CAAGACCCTGTCTCAAAAAAAGG + Intergenic
1044392014 8:91662660-91662682 AAACCCCCTGTCTCATTTGCAGG - Intergenic
1046018140 8:108630937-108630959 CAAGACCCTGTTTCATTGTGGGG + Intronic
1048483612 8:134827060-134827082 CAAGACCCTGTCTCCCTCTCCGG - Intergenic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1050249423 9:3728919-3728941 CAAGACCCTGTCTCAAAATAAGG + Intergenic
1050874676 9:10619149-10619171 CAAGACCCTGTTTCAAAAGAAGG - Intergenic
1052903512 9:33815730-33815752 TAAGACCCTGTCTCAATAAAAGG + Intergenic
1052956954 9:34260179-34260201 CAAGAACCTGTCTCAAAAACAGG + Intronic
1055923124 9:81482663-81482685 TAAGACCCTTTCTCCTTGGCAGG + Intergenic
1056218492 9:84428323-84428345 CAAGACCTTGTCTCTTTGGAGGG - Intergenic
1059561241 9:115336566-115336588 CAAATCCTTTTCTCATTAGCTGG + Intronic
1059949328 9:119445358-119445380 CAAGACCCTGTCTCAAGAAAAGG - Intergenic
1060265126 9:122107555-122107577 CAAGACCCTGTGTCACTCGCTGG - Intergenic
1060928722 9:127474277-127474299 CAAGACCCTGTCTCAAAAAAAGG - Intronic
1061647871 9:132020622-132020644 CATGATTCTTTCTCATTAGCTGG - Intronic
1061653618 9:132070543-132070565 CAAGACCCTGTCTCAAAAAAAGG + Intronic
1062444552 9:136588159-136588181 CCAGACCCTGGCTCCTGAGCAGG + Intergenic
1185907374 X:3948081-3948103 CAAGACCCTGTCTCAAAAAAAGG + Intergenic
1187346150 X:18466525-18466547 CAAGACCCTGTCTCAAAAAAAGG - Intronic
1189385825 X:40536163-40536185 CAAGACCCTGTCTCAAAAAAAGG + Intergenic
1190055864 X:47180609-47180631 CAAAACCCTCTCCCAGTAGCTGG + Intronic
1190125448 X:47700911-47700933 CATGACCCTGTCCAATTTGCTGG - Intergenic
1190847268 X:54205561-54205583 CAAGACCGTGTCTCTTAAGCAGG + Intronic
1192163312 X:68804882-68804904 CAAGACCCTGTCTCAAAAAAAGG + Intergenic
1195449245 X:104991694-104991716 CTAGAGCCTGTCTCAGTACCTGG - Intronic
1196829493 X:119765111-119765133 CAAGACTCTGTCTCAAAAGGTGG + Intergenic
1198068995 X:133129221-133129243 CAAGAGCCTGTCTCAAAAACTGG + Intergenic
1198461929 X:136871661-136871683 CAAGACCCTGTCTCAAGAAGAGG - Intronic
1200173396 X:154095866-154095888 CCAGACCCTGTCTTATTATAGGG + Intronic
1200975481 Y:9208015-9208037 TAAGTACCAGTCTCATTAGCTGG - Intergenic