ID: 960970878

View in Genome Browser
Species Human (GRCh38)
Location 3:123139323-123139345
Sequence CACCCACGGCTCCCCAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 130}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960970869_960970878 23 Left 960970869 3:123139277-123139299 CCAGGCCCAGGAGGCTGGTCCTC 0: 1
1: 0
2: 9
3: 44
4: 321
Right 960970878 3:123139323-123139345 CACCCACGGCTCCCCAAGACAGG 0: 1
1: 0
2: 1
3: 16
4: 130
960970874_960970878 -6 Left 960970874 3:123139306-123139328 CCGCCAGCTCTATCCATCACCCA 0: 1
1: 0
2: 5
3: 93
4: 1083
Right 960970878 3:123139323-123139345 CACCCACGGCTCCCCAAGACAGG 0: 1
1: 0
2: 1
3: 16
4: 130
960970875_960970878 -9 Left 960970875 3:123139309-123139331 CCAGCTCTATCCATCACCCACGG 0: 1
1: 0
2: 2
3: 6
4: 117
Right 960970878 3:123139323-123139345 CACCCACGGCTCCCCAAGACAGG 0: 1
1: 0
2: 1
3: 16
4: 130
960970873_960970878 4 Left 960970873 3:123139296-123139318 CCTCAGGTCACCGCCAGCTCTAT 0: 1
1: 0
2: 1
3: 9
4: 132
Right 960970878 3:123139323-123139345 CACCCACGGCTCCCCAAGACAGG 0: 1
1: 0
2: 1
3: 16
4: 130
960970871_960970878 18 Left 960970871 3:123139282-123139304 CCCAGGAGGCTGGTCCTCAGGTC 0: 1
1: 0
2: 1
3: 30
4: 275
Right 960970878 3:123139323-123139345 CACCCACGGCTCCCCAAGACAGG 0: 1
1: 0
2: 1
3: 16
4: 130
960970872_960970878 17 Left 960970872 3:123139283-123139305 CCAGGAGGCTGGTCCTCAGGTCA 0: 1
1: 0
2: 1
3: 19
4: 223
Right 960970878 3:123139323-123139345 CACCCACGGCTCCCCAAGACAGG 0: 1
1: 0
2: 1
3: 16
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960970878 Original CRISPR CACCCACGGCTCCCCAAGAC AGG Intronic
900393793 1:2444869-2444891 CACCATGGGCTCCCCAAGTCAGG - Intronic
900431709 1:2605876-2605898 CACCCGCGGCTCCCCCAGAGTGG + Intronic
900436061 1:2631898-2631920 CACCCACTGATCCCCACCACAGG + Intronic
900507537 1:3037203-3037225 CACCCACCCCTCCCCAGCACAGG + Intergenic
902575065 1:17372474-17372496 GACCCAAGGCTTCCCAAGATGGG - Intronic
907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG + Intronic
908272914 1:62437517-62437539 CACACACGGCTCCCCCTGGCAGG - Intronic
920387753 1:205580492-205580514 CACCCATGGCTCCCCATTCCAGG + Intronic
920926303 1:210344665-210344687 CCCCAAAGGCTCCCCAAAACGGG - Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
923526506 1:234776951-234776973 CACCCACGTTTCCCCAGCACAGG + Intergenic
1062786390 10:268834-268856 ATCCCACAGCTCCCCAAGTCTGG - Intergenic
1062824196 10:556442-556464 CACCCACACCTTCCCAAGAGGGG + Intronic
1065123568 10:22551183-22551205 CAGCAACGGCTCCCCAAAAGTGG - Intronic
1065875388 10:29993357-29993379 CCCCCAGCGCTCCCCAGGACAGG + Intergenic
1066267140 10:33787497-33787519 CACCCACCTCTTCCCAAGGCAGG - Intergenic
1071932979 10:90495180-90495202 CACCTACATCTCTCCAAGACTGG + Intergenic
1075198732 10:120383438-120383460 CACCAAAGGCTCCCCAGGCCTGG - Intergenic
1076491548 10:130865109-130865131 TTCCCAGGGCTGCCCAAGACAGG + Intergenic
1077343947 11:2037873-2037895 CTCCCATGGCTCCCCAGTACTGG - Intergenic
1077389587 11:2293923-2293945 CACCAACGGCTCCACCAGACTGG - Intergenic
1077507157 11:2935122-2935144 CTGCCAGGGCTCCCCCAGACCGG - Intergenic
1078621081 11:12908474-12908496 CACTCAAAGGTCCCCAAGACAGG - Intronic
1079674162 11:23203409-23203431 AACTCAGGGCTCCCCAAGCCAGG + Intergenic
1080628230 11:34050934-34050956 CACCCACTCCACCCCAAGGCTGG + Intergenic
1082811096 11:57479490-57479512 CACCCACGGGTCCCACAAACAGG + Intergenic
1083272732 11:61580430-61580452 CACCCGAGGCTCCCCAGCACCGG - Intronic
1083307168 11:61767167-61767189 CACCCCTGGCACCCCAAGCCTGG - Intronic
1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG + Intronic
1087623730 11:100571687-100571709 CACCCACCGCTCCTCAAGAATGG + Intergenic
1090796559 11:130140612-130140634 CTCCAACGGCTCCCACAGACTGG + Intronic
1202826933 11_KI270721v1_random:93062-93084 CTCCCATGGCTCCCCAGTACTGG - Intergenic
1096692889 12:53332053-53332075 CACTCACGGTTCCCCCAGTCAGG + Intronic
1101910431 12:108857225-108857247 CCCGCACAGCTCCCCAAGACAGG + Intronic
1104656052 12:130574800-130574822 CACCCACTGCTTGCCAAGCCTGG + Intronic
1106197631 13:27507975-27507997 CACACAAAGCTCCCCAAGGCAGG - Intergenic
1113235726 13:108270476-108270498 CACCTCCAGCTCCCCCAGACTGG - Intronic
1117653939 14:57935111-57935133 CACTCACTCCTCCCCAAGAGAGG - Intronic
1118615939 14:67574458-67574480 CACCCTCGGCACCCCAATCCTGG - Intronic
1121718010 14:96089902-96089924 GACCCCAGGCTCCCCAGGACAGG + Exonic
1122782410 14:104149303-104149325 CACGCACCCCTCCCCAGGACGGG - Intronic
1125581336 15:40788140-40788162 CAGCCACGTCTCCCCAAGCCCGG + Intronic
1127673718 15:61220489-61220511 CAGCCACTCCTCCCCATGACTGG + Intronic
1128802430 15:70505197-70505219 CCCCCACGGCACCCCAACACGGG + Intergenic
1129776612 15:78241141-78241163 CACCCAGGTCTCCACAGGACTGG + Intronic
1131397312 15:92097005-92097027 CACCCAAGGCAGCACAAGACAGG + Intronic
1132975972 16:2711425-2711447 CACCCAGGGCTCTCCGAGGCTGG + Intergenic
1133536591 16:6708131-6708153 CATCCCCCGCTCCCCAAGCCAGG - Intronic
1134207921 16:12252782-12252804 CACCAAAGGCTCCCCATGGCTGG - Intronic
1136003687 16:27314241-27314263 CACCCAGCGCTCCCCAAAGCCGG + Intronic
1137036539 16:35574145-35574167 CACCCCCGGATCTCCCAGACTGG + Intergenic
1138270678 16:55693782-55693804 CACTCACGACTACCCAAGGCTGG + Intronic
1141165926 16:81661115-81661137 CACCCACGTCTCTGCCAGACAGG + Intronic
1141396470 16:83709453-83709475 CACACACGGCACCCCTAGAGTGG - Intronic
1145813195 17:27777160-27777182 CACACACTGTTCCCCATGACTGG - Intronic
1145905610 17:28514597-28514619 CACCCAGGGCTCCACCCGACAGG - Intronic
1148505214 17:48121827-48121849 CACATACGGGTCCCCAAAACTGG - Exonic
1149304710 17:55336276-55336298 CACCCCCTGCTCCCCAGGCCAGG + Intergenic
1152230217 17:79110601-79110623 CACCAGCGGCTCACCAAGGCAGG - Intronic
1152305008 17:79515246-79515268 CTCCCACTGCTCCCCAGGCCAGG + Intronic
1152331214 17:79674395-79674417 AGCCCAGGGCACCCCAAGACAGG + Intergenic
1153030362 18:708192-708214 CAGCCACGACACCCCAATACAGG - Intronic
1155450614 18:25959216-25959238 AGCTCACGGCTCCCAAAGACAGG + Intergenic
1160690400 19:458644-458666 CACTTCCGCCTCCCCAAGACCGG - Intronic
1162450420 19:10750990-10751012 CACACACAGCTCCCCAAGGTGGG - Intronic
1168483716 19:56742855-56742877 CACCCACGACACCCCATGTCGGG - Intergenic
929942061 2:46341789-46341811 GACCCACGGCTCTGCAAAACTGG + Intronic
934851061 2:97701512-97701534 CACCCAGGGATCCCCAAACCCGG - Intergenic
935189891 2:100768624-100768646 CAGCCACAGCCACCCAAGACTGG + Intergenic
937261728 2:120590959-120590981 CACCCATGTCTCCCCAAGCTTGG - Intergenic
938307497 2:130265521-130265543 CAGCCCAGGCTCCCCAAGGCTGG + Intergenic
938413395 2:131084193-131084215 CCCCCACCCCACCCCAAGACAGG + Intronic
938447835 2:131391321-131391343 CAGCCCAGGCTCCCCAAGGCTGG - Intergenic
944035011 2:195284322-195284344 CACCCACTGATCACCAAGAAAGG + Intergenic
945234943 2:207625214-207625236 CACCCAGGGCTCGCCCAGGCCGG + Exonic
947804813 2:232958876-232958898 CACCCACTCCTCCCCAGGCCTGG + Intronic
948606785 2:239140970-239140992 CACCCACAGCTCCCCCAACCTGG + Intronic
949018823 2:241728949-241728971 CAGCCAGGGCTCCCAACGACAGG - Exonic
1168854070 20:996762-996784 CACCCAAGGCCCTCCATGACGGG + Intronic
1169446114 20:5672364-5672386 GACCCACGGTTCCACATGACTGG + Intergenic
1174568196 20:51482117-51482139 CACCCCCAGCCCCCCAAGTCTGG + Intronic
1176131648 20:63498971-63498993 CACCCTCTGCCCCCCAGGACCGG + Intronic
1179631691 21:42682764-42682786 CACCCTCGGCCCCTCAAGAGCGG + Intronic
1179821681 21:43940662-43940684 CTCCCACTGCCCCCCAAGGCAGG + Intronic
1181102537 22:20551050-20551072 CACCCACGGCTGCCTCTGACAGG + Intronic
1181377870 22:22474860-22474882 CACCTAGGCCTCCCCATGACAGG + Intergenic
1182361564 22:29749473-29749495 CACCCAAGGCTCCCCAGGGAGGG + Intronic
1183323909 22:37181069-37181091 TACCCACTGCTCCCCAAGGCTGG - Exonic
1184778478 22:46635074-46635096 AGGACACGGCTCCCCAAGACAGG - Intronic
949947642 3:9202945-9202967 CAGCCACTTCTCCCCAAGCCAGG + Intronic
950098284 3:10342715-10342737 CACCCACGCCTCTCCCAGGCGGG - Intronic
952784962 3:37144060-37144082 TACCCTGGGCACCCCAAGACAGG + Intronic
953367069 3:42354078-42354100 CAGCCCTGGCTCCTCAAGACAGG + Intergenic
953903942 3:46858826-46858848 CACCCGCTGCTCCCCAAGTCTGG + Intronic
954214925 3:49119338-49119360 CACCCAGGGCTCAGCAACACAGG + Intronic
960970878 3:123139323-123139345 CACCCACGGCTCCCCAAGACAGG + Intronic
962718865 3:138153675-138153697 GACTCACAGTTCCCCAAGACTGG + Intergenic
968704821 4:2072923-2072945 CACCCTGGGCTCCGGAAGACCGG + Intronic
971467142 4:26975957-26975979 CACACACCCCTCCCCAAGCCAGG + Intronic
979785737 4:124712941-124712963 CCCCCACGCCGCCCCGAGACAGG - Intergenic
985669924 5:1201939-1201961 GACCCTCGGCTCCCCAAGCACGG + Intronic
986871202 5:12048832-12048854 GACCCACAGTTCCCCAAGGCTGG - Intergenic
991274625 5:64830168-64830190 CTCCCCCGGCCCCCCATGACAGG + Intronic
992167689 5:74071197-74071219 CCCCCCCGCCCCCCCAAGACAGG + Intergenic
992473549 5:77080782-77080804 CTCCCACGCCACCCCACGACAGG - Intronic
997208804 5:132065980-132066002 CCTCCACGGCTCCCCCAGGCTGG + Intergenic
1001652893 5:173328083-173328105 CACCCGAGGGTCCCCAAGACAGG - Exonic
1002259486 5:177983863-177983885 GGCCCACGGCTCTCCAAGACTGG - Intergenic
1002575726 5:180172690-180172712 CACGCCCAGCTCCCCAAGAGGGG + Intronic
1006166857 6:32070359-32070381 CACCCACAGCTCCCCAAGGCGGG + Intronic
1007507495 6:42347240-42347262 CACCCACCTCTCCCAAAGGCAGG + Intronic
1017642480 6:156507771-156507793 CACCCACTGCTCGTCGAGACTGG - Intergenic
1018907827 6:168085520-168085542 CCACCATGGCTCCCCAGGACGGG + Intergenic
1019395936 7:817478-817500 TCCCCAGGGCTCCCCAGGACAGG + Intronic
1019707061 7:2501954-2501976 CACCCACTGCACCCCAAGGCTGG - Intergenic
1019711760 7:2521164-2521186 CACCCACAGTGCCCCAAAACAGG - Intronic
1022092324 7:27115699-27115721 CTCCCACGGCTCCTCAGGTCTGG - Intronic
1022486340 7:30781145-30781167 CAGCCACGGCTCGGCAAGACTGG + Intronic
1022723809 7:32963290-32963312 CACCCAGGCCTCCCAAGGACTGG - Intronic
1024637061 7:51299828-51299850 GACCCATGACTCCACAAGACAGG + Intronic
1025049816 7:55724626-55724648 CACCCAGGCCTCCCAAGGACTGG + Intergenic
1026127194 7:67589249-67589271 CAGCCAGGGCTCCGCAAGACAGG - Intergenic
1043364269 8:79513453-79513475 GACTCACGGCTCCCCACGGCTGG - Intergenic
1045282076 8:100757949-100757971 TTCCCACCACTCCCCAAGACAGG - Intergenic
1049112524 8:140656608-140656630 CCCGCACTGCTCCCCAAGAAGGG - Intergenic
1049223166 8:141437016-141437038 GACCCACAGCTCCCCATGGCGGG - Intergenic
1049223181 8:141437053-141437075 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223196 8:141437090-141437112 GACCCACAGCTCCCCATGGCGGG - Intergenic
1049223211 8:141437127-141437149 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223226 8:141437164-141437186 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223241 8:141437201-141437223 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223256 8:141437238-141437260 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223271 8:141437275-141437297 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049830687 8:144699389-144699411 CACCCACAGCACCCCCACACCGG - Intergenic
1051565828 9:18496989-18497011 CACCCTCCACTCCCCAAAACAGG - Intronic
1055760384 9:79600733-79600755 TGCCCATGGCTCCCCAAGCCTGG + Intronic
1056963863 9:91149882-91149904 CACCCACTGCACTCCAAGCCTGG - Intergenic
1057174683 9:92987530-92987552 CACCCATGGCCCTCCTAGACAGG - Intronic
1057237176 9:93370991-93371013 CACCCACTACTTCCCAACACTGG + Intergenic
1058815605 9:108680291-108680313 CACCCAAGGCAGCCCAAGGCAGG + Intergenic
1059194149 9:112354980-112355002 CACCCACATCTCCCAAAGACAGG - Intergenic
1188769101 X:34131059-34131081 CACCCAGTGCCTCCCAAGACTGG - Exonic
1190485056 X:50915874-50915896 CACCCAGGGCTCCACATGGCAGG - Exonic
1191841901 X:65519239-65519261 CTCCCACGGCTCCTCAGCACAGG - Intronic
1191859784 X:65656852-65656874 CTCCCACGGCTCCTCAGCACAGG - Intronic
1197758284 X:130011195-130011217 CACCCACAGCTCCCAAGGGCAGG + Intronic
1199848925 X:151711484-151711506 CACCCACCACACTCCAAGACAGG + Intergenic
1201524774 Y:14919894-14919916 CACTCACAGCTCCCCATGGCTGG - Intergenic