ID: 960972669

View in Genome Browser
Species Human (GRCh38)
Location 3:123150706-123150728
Sequence CAGTGTCTGGAGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 705
Summary {0: 1, 1: 1, 2: 6, 3: 64, 4: 633}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960972669_960972673 -3 Left 960972669 3:123150706-123150728 CCCTCTTCCTTCTCCAGACACTG 0: 1
1: 1
2: 6
3: 64
4: 633
Right 960972673 3:123150726-123150748 CTGACTTATCTTCAGCACCTTGG 0: 1
1: 0
2: 0
3: 9
4: 180
960972669_960972679 25 Left 960972669 3:123150706-123150728 CCCTCTTCCTTCTCCAGACACTG 0: 1
1: 1
2: 6
3: 64
4: 633
Right 960972679 3:123150754-123150776 CCTCTCCCTGCCCTTCCAGATGG 0: 1
1: 0
2: 6
3: 65
4: 502

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960972669 Original CRISPR CAGTGTCTGGAGAAGGAAGA GGG (reversed) Intronic
900462033 1:2806149-2806171 CAAGGTCTGTTGAAGGAAGAAGG - Intergenic
900510947 1:3060829-3060851 CTGTGTTTGGAAAAGGAAGCTGG - Intergenic
901648037 1:10727139-10727161 AACAGCCTGGAGAAGGAAGAGGG + Intronic
901948215 1:12720801-12720823 CTGTGTCTGTAGGAAGAAGACGG + Intronic
902113108 1:14099427-14099449 GAGTATCTGGTGAAGGAACAGGG - Intergenic
903548906 1:24143981-24144003 CAGGGCCTGGAGAAGGTAGAAGG + Intergenic
903649071 1:24912079-24912101 CAGTGCCTGAGGAAAGAAGATGG + Intronic
903853286 1:26320938-26320960 CTGGGGCTGGAGAAGGATGATGG + Intergenic
904052425 1:27647768-27647790 CAGGGCCGGGAGAAGGAGGAGGG + Intergenic
904157685 1:28498242-28498264 GGGTCTCTGGAGAAGCAAGAAGG + Exonic
904302117 1:29561203-29561225 CAATCTCTGGAGAAGGGGGATGG + Intergenic
904330533 1:29755454-29755476 CAGTGTCTGGGGAGAGAAGATGG + Intergenic
904416144 1:30362140-30362162 CAGTGTCTGGGGAGAGAAGATGG - Intergenic
904435431 1:30491914-30491936 CTGGGTCTGGGGAAGGAAGCTGG - Intergenic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
904949672 1:34226381-34226403 TAGAGGCTGGAGGAGGAAGAAGG - Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905104879 1:35558333-35558355 CAGGGGCTGGAGAAGCAAGAGGG - Intronic
905142823 1:35861934-35861956 CTGTGGCTGGAGAAGGAAGAAGG + Intergenic
905208750 1:36358762-36358784 CAGTGTTTGGCGAGGAAAGATGG - Exonic
905861917 1:41357715-41357737 GAGTGTCTGCAGAAGCCAGAGGG - Intergenic
905909843 1:41646240-41646262 CAGCCTATGGAGAAGGAAGGAGG + Intronic
906572605 1:46857017-46857039 TACTGTCTGGGTAAGGAAGATGG + Intergenic
906599168 1:47108874-47108896 TACTGTCTGGGTAAGGAAGATGG - Intronic
906608917 1:47189003-47189025 CAGTGTCTGGGGCAGGAGAAAGG + Intronic
907017858 1:51034771-51034793 CCATGTATGGAGAAGGAATAGGG - Intergenic
907161697 1:52375570-52375592 CACTGTCTGGAGATGCACGACGG - Exonic
907328276 1:53654903-53654925 CAGTCTCTGAAGAGGGAAGTGGG + Intronic
907553344 1:55323454-55323476 CAGAGTCTCAAGCAGGAAGAAGG - Intergenic
908801599 1:67886105-67886127 CAGTGACTTGAGAAAGAACAGGG + Intergenic
908979591 1:69939477-69939499 GAGGGGCTGGAGGAGGAAGAGGG - Intronic
909187488 1:72506688-72506710 AAGTGTCTGAGGAAGGAAGGTGG - Intergenic
909461222 1:75916684-75916706 CAGAGGGTGGAGATGGAAGAGGG + Intergenic
909647568 1:77934621-77934643 CAGAGTCCGAAGAGGGAAGAAGG - Intronic
910047342 1:82933483-82933505 CAGTGTCTCGAGAAGAAAAAAGG + Intergenic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
911490255 1:98556181-98556203 CAGGGAATGGAAAAGGAAGAGGG + Intergenic
911509862 1:98798448-98798470 CAGAGTCTGGGAAGGGAAGAGGG - Intergenic
911546004 1:99217752-99217774 CCGTGGCTGGAGTGGGAAGATGG + Intergenic
911697268 1:100904787-100904809 CAGTTTATGGTGAAGGCAGAGGG + Intronic
913419479 1:118649283-118649305 CATTGTCTAGAGAAGAATGAGGG - Intergenic
914804876 1:150984418-150984440 GGGTGTCTGGGGAAGGGAGAAGG + Intronic
914956436 1:152166933-152166955 CAGAGTATGGGGCAGGAAGATGG + Intergenic
916028399 1:160855375-160855397 CAGTGTGGGAAGGAGGAAGATGG + Intronic
917635195 1:176929140-176929162 CAGTGGCTGGAGAGGTGAGAGGG + Intronic
918065763 1:181100605-181100627 AAGTGTTTGAAGAACGAAGATGG - Intergenic
918082960 1:181221576-181221598 CAGTGTCTGGGGGAGGCGGAGGG + Intergenic
918264479 1:182828533-182828555 CTGTGTTTGAAGCAGGAAGAGGG + Intronic
918709983 1:187714997-187715019 CAGGGTCTGGAGAACGAAGTTGG - Intergenic
919321637 1:196048101-196048123 CAGTAGCAGGAGAAAGAAGAGGG + Intergenic
919763597 1:201112831-201112853 CATTGTCTGGAGAAGGCACTGGG + Intergenic
919977686 1:202623402-202623424 GAGTCTCTGGAGAAGGAGGTGGG - Intronic
920201629 1:204263178-204263200 CTGTGACAGGAGAAGGCAGAGGG + Intronic
920492889 1:206431755-206431777 GAGGGGATGGAGAAGGAAGAGGG + Intronic
920740719 1:208578922-208578944 CAGTGTATGGAGATGGGAAATGG - Intergenic
920741139 1:208582319-208582341 CAGCATCTGGAGAGAGAAGATGG + Intergenic
920866610 1:209758709-209758731 CAGGGACTGATGAAGGAAGAGGG - Exonic
922386339 1:225087616-225087638 CAGACCTTGGAGAAGGAAGATGG + Intronic
922741312 1:228015773-228015795 AAGTGTCTGGTCAAGGACGAAGG - Intronic
922955855 1:229599064-229599086 CAGTGTCTGAAACAGGAGGAGGG + Intronic
922972163 1:229751745-229751767 CAAAGCCTGGAGAAGGCAGAGGG - Intergenic
923080197 1:230646043-230646065 CAGGGTCCTGAGAAGGGAGAGGG - Intronic
923694540 1:236234596-236234618 AACTGCCTGGAGAAGGAAGTTGG - Intronic
923999520 1:239535151-239535173 CAGTGTTTGCTGAAGGAAGGGGG + Intronic
1062823371 10:551103-551125 CAGTGTCTAGTGAGGGCAGAGGG - Intronic
1063942747 10:11147346-11147368 CAGTGTCTGGACAAGTCAAATGG + Intronic
1064269039 10:13848785-13848807 CCTTGGCTGAAGAAGGAAGATGG + Intronic
1065484814 10:26227527-26227549 AAGAGGCTGGAGAAGGAAGGAGG - Intronic
1065617995 10:27548537-27548559 CAGAGGCTGGAAAGGGAAGATGG + Intergenic
1065629705 10:27665951-27665973 CAGAGACTGGAGAGGGAAGGGGG + Intergenic
1065673171 10:28144495-28144517 CAGTGGCTTGCGAAGGAAGAAGG - Intronic
1065865634 10:29912837-29912859 AAGTGGCTGGAGCAGGAGGAAGG - Intergenic
1065927737 10:30450643-30450665 ATGTCTCTGGAGAAGGAAGACGG - Intronic
1067888724 10:50114192-50114214 CAGTGTCAGGTGTAGGAACAAGG + Intronic
1068502846 10:57861988-57862010 CAGTGTCTGGAGAAGGGAGACGG - Intergenic
1068971079 10:62959135-62959157 AAGTGCCAGGAGAAGGATGATGG - Intergenic
1070675788 10:78410394-78410416 CATGGTCTGGAGAAGGCAAAGGG - Intergenic
1070676635 10:78416220-78416242 TAGTTTCTGAAGAAGGAAGATGG - Intergenic
1070711665 10:78687432-78687454 CAGAGACTGGAGATGGAGGAAGG + Intergenic
1071450754 10:85789993-85790015 CAGAGTCAGGAAAAGGGAGAGGG - Intronic
1071805928 10:89120878-89120900 CTGAGTCTGGAGAAGCAGGAAGG + Intergenic
1072299169 10:94042263-94042285 AAATGTCTGTAGAAGTAAGATGG + Intronic
1074190014 10:111127514-111127536 CAGCCTCTGGAGAAGGAAGCAGG - Intergenic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1074928097 10:118094145-118094167 CAGTGGCTGGAGTAAGAAGTGGG - Intergenic
1075062489 10:119266631-119266653 CTGTGGCTGGAGGAGGAAGCGGG + Intronic
1075216947 10:120544581-120544603 CACTGGCTGGAGGTGGAAGAGGG - Intronic
1075345878 10:121681677-121681699 AAGTGTTTGGAGCAGGAAGAAGG + Intergenic
1075400183 10:122155490-122155512 TAGTTTCCGGAGAAGAAAGATGG + Intronic
1075574763 10:123570403-123570425 CAGGCTCTGGGGAAGGAGGAAGG - Intergenic
1075990953 10:126838204-126838226 GGGTGTCTGGAGAAGGGAGGTGG - Intergenic
1076076384 10:127537178-127537200 CTGTCTCTGGAGCAGGAAGGAGG + Intergenic
1076157893 10:128217311-128217333 GGGTGTTTGGAGTAGGAAGACGG + Intergenic
1076499609 10:130927090-130927112 CAGTCTCTGAAGAATGGAGATGG + Intergenic
1076729400 10:132430977-132430999 CAGGGTCCCGAGAAGGAAGATGG + Intergenic
1076822658 10:132947143-132947165 CGGTGTCTGCAGAAGGCAGAGGG - Intergenic
1077345212 11:2045084-2045106 TAATGTATGGAGAATGAAGATGG - Intergenic
1077892834 11:6431721-6431743 AAGCGGCTGGAGAAGGAAGTCGG - Exonic
1077938232 11:6813154-6813176 CAGTGGCTGGAAATGGATGAGGG - Intergenic
1077988397 11:7378557-7378579 CAGTTGATGGAGATGGAAGAGGG + Intronic
1078099518 11:8321513-8321535 CAGGGGCTGGAGAAGGGACAGGG - Intergenic
1078754001 11:14191443-14191465 AAGTGTGTGGGGAAGGAAGAAGG - Intronic
1079191559 11:18281899-18281921 TAGTGCTTGGAGAAGGTAGAAGG - Intronic
1079509348 11:21192894-21192916 CAGTGTCGAGAGAAAGAGGAAGG + Intronic
1079742951 11:24086521-24086543 CAGTATCTGGAGGGGGAGGAGGG - Intergenic
1080230032 11:30010829-30010851 GAGTATCTAGAGATGGAAGAAGG - Exonic
1080306728 11:30844615-30844637 CAGTGTCTGGAGGATGTACAGGG + Intronic
1080874699 11:36265131-36265153 CAGTGACAGGATGAGGAAGAAGG - Intergenic
1080881068 11:36321334-36321356 CAGGATCTGGAGGAGGAAGCAGG - Intronic
1081222235 11:40476037-40476059 CAATGTCTGGAGATGCAGGAGGG - Intronic
1081367435 11:42253128-42253150 CACTGTTTAAAGAAGGAAGAAGG + Intergenic
1081622651 11:44628135-44628157 CAGTGCCTGGTGGTGGAAGATGG - Intergenic
1081741368 11:45443307-45443329 CAGGGTCTGGAGAATGCAGAGGG + Intergenic
1081841551 11:46205323-46205345 TAATGTCTGGAGAATGAGGAGGG + Intergenic
1082241272 11:49873742-49873764 AAGTTCCTGGAGAAGGTAGAAGG + Intergenic
1083072914 11:60005175-60005197 CAATATGTGGAGAGGGAAGACGG + Intergenic
1083520483 11:63306247-63306269 CAGAGGCTAGGGAAGGAAGAAGG - Intronic
1084105541 11:66977791-66977813 CAATGTCTGGAGGAGGAAAATGG + Intergenic
1084937368 11:72594317-72594339 CAGAGGGTGCAGAAGGAAGATGG - Intronic
1086695950 11:89845580-89845602 AAGTTCCTGGAGAAGGTAGAAGG - Intergenic
1086710205 11:89998903-89998925 AAGTTCCTGGAGAAGGTAGAAGG + Intergenic
1086730552 11:90243520-90243542 CAATATCTGTAGAAGGAAGGAGG + Intergenic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1087733005 11:101799642-101799664 CAGAGGCTGGGAAAGGAAGAGGG + Intronic
1087798973 11:102483603-102483625 TAGTCTGTGGTGAAGGAAGAGGG - Intronic
1088129709 11:106472637-106472659 GAGCGTCTGGAGGAGGCAGATGG + Intergenic
1088777049 11:113095590-113095612 CAGTTTCTGGAGAAGGGATTTGG - Intronic
1089709177 11:120302605-120302627 CAGTGCCTGGAGCATGAAGGAGG - Intronic
1089802319 11:121043685-121043707 CTGGGAGTGGAGAAGGAAGATGG - Intronic
1090639307 11:128716891-128716913 CAGTGCAGGGAGGAGGAAGAAGG + Intronic
1090803554 11:130189003-130189025 CAGTGTGTGGGGCAGGAAGCGGG + Intronic
1090922030 11:131215183-131215205 CAGGGTCTGGAGTAGGATGATGG - Intergenic
1091218801 11:133918920-133918942 GACTGACTGGAGAAGGAAGGAGG + Intronic
1092078555 12:5693678-5693700 CAGTGGCTGGAGAAGAAGGAAGG - Intronic
1092837941 12:12509623-12509645 CAATAGCTGGAGAAGTAAGACGG - Intronic
1093639503 12:21509978-21510000 CAGTGTTTGGAGAAGGTCGGGGG + Intronic
1094113111 12:26882349-26882371 CAGGGTGTGGAGAAGAAGGAAGG + Intergenic
1095523272 12:43094074-43094096 CAGGGACTTGGGAAGGAAGATGG + Intergenic
1095750503 12:45705383-45705405 ATGTGTCTTGAAAAGGAAGAGGG - Intergenic
1096099597 12:48961632-48961654 GTGTGTCTGATGAAGGAAGAGGG + Intergenic
1096099613 12:48961832-48961854 TAGTGTATGTGGAAGGAAGAGGG - Intergenic
1096526483 12:52213078-52213100 CTGGGTCTGGAGAAGGGAGGAGG + Intergenic
1096967426 12:55639346-55639368 CAGAGCCTGGAGAAGGAAGTGGG + Intergenic
1097068773 12:56339636-56339658 CAGTGAATGGAGTAGGAAGAGGG + Intronic
1097743085 12:63268183-63268205 TCGTTTCTGGAGAAGGAAAAAGG - Intergenic
1098392649 12:69985846-69985868 CAGAGTCTGGGCAAGGGAGAGGG - Intergenic
1098918082 12:76277785-76277807 CTGTGTCTGGAAAAGTAAGTTGG - Intergenic
1098998862 12:77153064-77153086 CAGTGTATGGGGGAGGGAGAAGG + Intergenic
1100057083 12:90524866-90524888 CAGTATCATGAGAATGAAGAAGG - Intergenic
1100438383 12:94592777-94592799 CAGTGTCTGGAGAAAGGATTGGG - Intronic
1100438475 12:94593571-94593593 CAGTGTCTGGAGAAAGGACTGGG - Intronic
1100661779 12:96707539-96707561 TAGTGGCTGGAGAAGGAAGTTGG + Intronic
1100841344 12:98614967-98614989 CAGTTGCTGGAGAAGGGAAAAGG + Intronic
1102518430 12:113465103-113465125 CAGGGTTTGGAGAGGGAAGAGGG - Intronic
1102840348 12:116113694-116113716 CAGTGAGTGGAGGAGGAAGAGGG + Intronic
1103176025 12:118864078-118864100 CAGTGTCTGGGCATGGAAGTGGG - Intergenic
1103402577 12:120653373-120653395 CACAGTATGGAGAAGGAAGCTGG + Intronic
1103791720 12:123476884-123476906 CTGTGTGTGGGGAACGAAGAAGG + Intronic
1104147583 12:126050193-126050215 CATTGTCTTGAGTAGGAAAAAGG - Intergenic
1104644278 12:130486062-130486084 CAGTGGCTGGAGGGGGATGAGGG - Intronic
1104738145 12:131152653-131152675 CTGTGTCTGGACAAGGAATGTGG - Intergenic
1104809363 12:131611252-131611274 TAGTGTCTGGGCCAGGAAGACGG + Intergenic
1104995122 12:132649412-132649434 CAGCGTCTGGAGTCGGCAGAGGG - Exonic
1105024993 12:132842250-132842272 CAGTCTGTGGAGAGGGAAGGTGG - Intronic
1105225745 13:18429929-18429951 TAGTGTCGGGAGACGGAAGCTGG - Intergenic
1105236502 13:18560262-18560284 CACTGTTTGGCGAAGGGAGAAGG - Intergenic
1105705737 13:22966467-22966489 CAGCATCTGGAGAAGGCGGAGGG + Intergenic
1105858640 13:24391452-24391474 CAGCATCTGGAGAAGGCGGAGGG + Intergenic
1106899183 13:34336880-34336902 CAGTGTCTGGAGAGAAAAGAAGG + Intergenic
1107265279 13:38546117-38546139 CAGAGTCTGGAGAAGGAGCATGG + Intergenic
1107606583 13:42063574-42063596 CAGTGGCTGGAGAGGGATGCTGG + Intronic
1108638139 13:52356620-52356642 CAGTCTCTGGAGTAGGGAGAGGG + Intergenic
1110664785 13:78104103-78104125 AAGTGTCTGTAGGAGGAAAATGG - Intergenic
1110864536 13:80379566-80379588 TATTCTCTGGAGAAGGGAGAAGG - Intergenic
1111249403 13:85583841-85583863 CAATGACTGGAGCAGGAAGTCGG + Intergenic
1111705763 13:91747533-91747555 AAATGTCTGGAGCAGGAAGCAGG - Intronic
1112425022 13:99290398-99290420 CAGTGTCTGGACTAGGATGATGG + Intronic
1112667542 13:101593748-101593770 CAGAGACGGGAGGAGGAAGATGG + Intronic
1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG + Intergenic
1113802890 13:113095686-113095708 CAGGGCCTGGAGCAGGAGGACGG - Intronic
1114010199 14:18358280-18358302 TAGTGTCGGGAGACGGAAGCTGG - Intergenic
1114258171 14:21019816-21019838 CAGGATTTGGGGAAGGAAGAAGG - Intronic
1114661248 14:24346623-24346645 AATTTTCAGGAGAAGGAAGAGGG - Intergenic
1115653033 14:35416948-35416970 CAGAGTCAGGAGTGGGAAGAAGG + Intergenic
1115766160 14:36625540-36625562 CTCTGTTTGGAGAAGGAAGCCGG - Intergenic
1116521095 14:45848082-45848104 CAGTGTCTGAAGACAGGAGAAGG + Intergenic
1116899527 14:50348518-50348540 CAGAGTCTAGTGAGGGAAGAGGG - Intronic
1117256440 14:53982891-53982913 CAGTGAATGGAGAAAGATGAAGG + Intergenic
1117487999 14:56217817-56217839 CACTGTATGGAGCAGGCAGAAGG - Intronic
1117558718 14:56912876-56912898 CAGAGTCAGGGGAAGGATGAGGG + Intergenic
1117881695 14:60318988-60319010 CATTGTCAGGAGAAGCAAGAGGG - Intergenic
1118171579 14:63394537-63394559 CATTATTTGGAGAAGGAAAAGGG - Intronic
1118221355 14:63857149-63857171 CATTGGCTGGATGAGGAAGAGGG - Intronic
1118671914 14:68137809-68137831 CAGTGTCAGGGCAACGAAGAAGG - Intronic
1118888086 14:69883287-69883309 CAGAGGCTGAGGAAGGAAGAGGG - Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119614652 14:76091184-76091206 CGGAGGCCGGAGAAGGAAGAAGG - Intergenic
1119829259 14:77686479-77686501 TAGTGCCTGGAGAAGGCAGCAGG - Intronic
1120718614 14:87866855-87866877 CATTGTCAGGAGGAGAAAGAAGG + Intronic
1120722753 14:87905928-87905950 CAGGGACTGGAGAGAGAAGATGG - Intronic
1121633978 14:95441178-95441200 CAGTGTCTGTGGAATGTAGAAGG - Intronic
1121777940 14:96603059-96603081 GAGTGTCTGGGGAGGGGAGAGGG + Intergenic
1121827825 14:97025296-97025318 CAGGGTTTGAAGAGGGAAGATGG - Intergenic
1121999902 14:98638520-98638542 TAGTGCCTGGAGTAAGAAGATGG - Intergenic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122881864 14:104693861-104693883 CTGTGCCTGGAGCAGGAACAGGG - Intronic
1123186062 14:106518055-106518077 TAGTGTCAGGAGAAGGAGAAGGG + Intergenic
1123830982 15:24136879-24136901 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123836064 15:24194254-24194276 CAGGGTATGCAGAAGGAACATGG + Intergenic
1124208405 15:27742601-27742623 CACTGTCTGCAGAAGCAAGCTGG + Intergenic
1124493334 15:30171766-30171788 GAGTCTCTGGAGAAGGAGGTGGG - Intergenic
1124750200 15:32366559-32366581 GAGTCTCTGGAGAAGGAGGTGGG + Intergenic
1124896238 15:33780051-33780073 TAGTGTCTAGAGAAAGAGGAGGG + Intronic
1124934346 15:34156234-34156256 CAGTGTCGGGAGACAGAAGCTGG + Intronic
1125015794 15:34933315-34933337 CCTTGTCTGGAGAAGTAAGGTGG - Intronic
1125432982 15:39615784-39615806 CAGTGGCTGGGGGATGAAGAGGG + Intronic
1125675507 15:41500392-41500414 CAGGGCCTGGAGAAAGAACAGGG - Intronic
1125770158 15:42159841-42159863 GAGTGTCTGGTGAGCGAAGACGG + Exonic
1126323215 15:47447346-47447368 CAACCTCTGGGGAAGGAAGAGGG + Intronic
1126932685 15:53672386-53672408 CAGTTTCTGCACAAGAAAGAAGG + Intronic
1127133587 15:55895742-55895764 CAGTGTCTGGAGAAACCAGGAGG + Intronic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1127395572 15:58541710-58541732 CAGGAGCTGGAGAAGGAAGAAGG + Intronic
1127533063 15:59864072-59864094 CAGTGTCCTGAGAAACAAGATGG - Intergenic
1127967395 15:63932608-63932630 CAGTAGCTTGAGAAGGAGGAAGG + Intronic
1127973902 15:63983335-63983357 CAGTTTCAGGAGGAGGAAGCGGG + Intronic
1128108793 15:65063305-65063327 CAGTGTCTGGGAAAGGACAAGGG - Intronic
1128401919 15:67292102-67292124 CTGTGTCTGCACATGGAAGAGGG - Intronic
1128498207 15:68210244-68210266 CGGTGTGTGGAGAGGGGAGAGGG - Intronic
1128556834 15:68637572-68637594 CTGAGCCTGGAGAAGGAAGGCGG + Intronic
1128609869 15:69064967-69064989 CAGTGTTTGGAGAAGGATGCAGG - Intergenic
1128823640 15:70687352-70687374 CAGAGTCTGCTGAAGAAAGAAGG - Intronic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1129632591 15:77277840-77277862 CAGGGGCTGGAGAAGGAAAAGGG + Intronic
1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG + Intronic
1129952975 15:79608210-79608232 CAGGGTCTGGATGTGGAAGAGGG - Intergenic
1130254721 15:82320612-82320634 CAGGGTCAGGAGAAGAAAGCTGG - Intergenic
1130288407 15:82574156-82574178 GAATGTCTGGATAAGGAGGAAGG - Intronic
1130600252 15:85269394-85269416 CAGGGTCAGGAGAAGAAAGCTGG + Intergenic
1131433551 15:92405313-92405335 CAGGGTCTGGGGAAGGAGAAGGG + Intronic
1131998373 15:98155243-98155265 GAGTGTCTGGAGAGGAAAGAGGG + Intergenic
1132012722 15:98290231-98290253 CAGTGGCTGGAGGAGGGGGAGGG + Intergenic
1132499624 16:279755-279777 CTGCGTCTGGATAAGGGAGAAGG - Intronic
1132840448 16:1976222-1976244 CCGTATCTGGAGAATGAACAAGG + Exonic
1133162406 16:3920714-3920736 AACTGCCTGCAGAAGGAAGAGGG - Intergenic
1133711645 16:8407320-8407342 CAATGTCTGGAGAAGGAATGAGG + Intergenic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1135013334 16:18903469-18903491 TAGTGGTGGGAGAAGGAAGAAGG - Intronic
1135325646 16:21523816-21523838 CAGTGGCTGGAGCGTGAAGATGG + Intergenic
1135438690 16:22448147-22448169 TAGTGGTGGGAGAAGGAAGAAGG + Intergenic
1135688708 16:24519217-24519239 CAGTGTCTGGAGATCGAGGCAGG - Intergenic
1135747543 16:25029991-25030013 CATTCTCTGGAGGAGGAGGATGG - Intergenic
1135748479 16:25037366-25037388 CATTATCTTGAGAATGAAGAAGG - Intergenic
1135859671 16:26044350-26044372 CATTCTCTGGAGAGGGGAGAAGG + Intronic
1136102196 16:28004331-28004353 CAGTGGCTGGAGGGGGATGAGGG + Intronic
1136330489 16:29572763-29572785 TAGTGGTGGGAGAAGGAAGAAGG - Intergenic
1136501060 16:30669851-30669873 CAGCCTCTAGAGAAGGGAGAGGG + Exonic
1138088248 16:54153558-54153580 AAGTGTCTGGACAAAGAGGAAGG + Intergenic
1138234499 16:55370558-55370580 CAGCCGCTGGAGAAGGAGGAAGG - Intergenic
1138459184 16:57138002-57138024 CAAGGTCAGGAGAAGGCAGAAGG - Intronic
1139480917 16:67230223-67230245 CTCTGTCTGGAGAAAGAAGAAGG + Exonic
1140213405 16:72988385-72988407 CAGTGGCTGGAGAAGGATCTTGG - Intronic
1140696874 16:77543421-77543443 CCCTGTCTGTAGAAGGAGGAAGG + Intergenic
1140980836 16:80107551-80107573 CAGAGACTGGGAAAGGAAGAGGG + Intergenic
1142023939 16:87802218-87802240 CAGTGTGTGCAGATGGCAGATGG - Intergenic
1142038657 16:87878458-87878480 CAGTGGCTGGAGTGTGAAGATGG + Intergenic
1142233926 16:88912570-88912592 GAGTGGCTGGAGAAGAAAAATGG - Intronic
1143003383 17:3810268-3810290 CAGTGGCTGAAGAACGGAGAGGG + Intergenic
1143016872 17:3895466-3895488 GTGTGTCTGGAGAAAGAAGGGGG + Intergenic
1143818247 17:9537386-9537408 CTGTGACTGGAGAAGAATGAGGG - Intronic
1143881786 17:10035500-10035522 CAGTGCCAGGGGAAGGGAGATGG - Intronic
1144029154 17:11304224-11304246 CAGTGCCTGGAGTTGGACGAAGG + Intronic
1144398242 17:14867102-14867124 CTGTATCTGTAGCAGGAAGAGGG + Intergenic
1144413387 17:15022663-15022685 CCATGTCTGGAGAAGGGAAAAGG - Intergenic
1145309058 17:21691601-21691623 CAGTGCCTGGAGAGTGAAGCTGG + Intergenic
1145841176 17:27996181-27996203 CAGGGTCAGGAGCAGGTAGAAGG + Intergenic
1146058313 17:29591943-29591965 CAGGGTGTGGAGGAGGAAGGAGG + Intronic
1146646156 17:34578901-34578923 CTGTTGCTGGGGAAGGAAGACGG - Exonic
1146926387 17:36748787-36748809 TTGTTTCTGGAGAAGGAAGCTGG - Intergenic
1147133655 17:38423016-38423038 CAGTGACTAGGGGAGGAAGAAGG - Intergenic
1147144408 17:38476988-38477010 TAGGGTCTGGAGAGGGAAGGAGG + Intronic
1147392946 17:40121731-40121753 GAGGGTCTGGAGGGGGAAGAAGG - Intergenic
1147710517 17:42460382-42460404 CATTGTCAGTAGAAGGGAGAAGG + Intronic
1147788770 17:42999548-42999570 CAGTCTCAGGAGATGGGAGAGGG - Intronic
1147878948 17:43641814-43641836 CCCTGGCTGGGGAAGGAAGAGGG + Exonic
1147981933 17:44280157-44280179 CAGGGTCAGGGGAAGGAAGAGGG - Intergenic
1149114081 17:53070629-53070651 CAGAGACTGCAGAAGGAAAATGG - Intergenic
1149490460 17:57081216-57081238 AAGTGTCTGTGAAAGGAAGAAGG - Intergenic
1149553932 17:57559769-57559791 CAGTGTCTGCAGAAGGGCCAAGG + Intronic
1150164096 17:62924931-62924953 CAGTGTCTGAACCAGTAAGAGGG + Intergenic
1151264400 17:72943112-72943134 GAGTGTCTTGAGGTGGAAGAAGG + Intronic
1151345212 17:73497263-73497285 CAGTGTCTTGGGAGGAAAGAGGG - Intronic
1151397262 17:73831747-73831769 CAGAGGCTGTAGAAGGCAGACGG - Intergenic
1151601744 17:75110178-75110200 ACCTGTCTGGAGAGGGAAGAGGG - Exonic
1151897040 17:76987443-76987465 CACTCTCTGATGAAGGAAGATGG + Intergenic
1152007864 17:77693871-77693893 AGGTGCCTGGAGAAGGAGGAGGG + Intergenic
1152031204 17:77844581-77844603 CAGGGGCTGGAGGAGGAGGAAGG + Intergenic
1152308404 17:79534708-79534730 CGGTGTCTGGAGAAGAAATCAGG + Intergenic
1152523689 17:80875451-80875473 CAGTGTGTGGTGAGGGAAGGGGG + Intronic
1152913208 17:83017193-83017215 CAGTGGCGGGAGGAGGAAGGGGG + Intronic
1152946271 17:83199151-83199173 GAGGGGCTGGAGGAGGAAGAGGG - Intergenic
1153339230 18:3957225-3957247 CTGAGTTTGGAGATGGAAGAAGG + Intronic
1154026161 18:10709253-10709275 CAGTGACTGGCGAGGGAAGATGG + Intronic
1154215872 18:12415756-12415778 CAGTGTCGGGAAGATGAAGAAGG - Intronic
1154527633 18:15309592-15309614 TAGTGTCGGGAGACGGAAGCTGG + Intergenic
1155075729 18:22352593-22352615 CAGAGGCTGGGGAAGGTAGAGGG - Intergenic
1155648694 18:28113922-28113944 CAGTATCTGGAGAAAGAAAAAGG + Intronic
1156445558 18:37234015-37234037 CATTGTCTGAGGAAGGAAGCAGG + Intergenic
1157496255 18:48159676-48159698 AAGTATTTGGAGAAGAAAGAGGG - Intronic
1160025755 18:75214435-75214457 CATTTTCTGGAAAAGAAAGAGGG + Intronic
1160057199 18:75494196-75494218 CAGTGTCTGAAGAGTGAAAAAGG + Intergenic
1160506633 18:79430855-79430877 GAGTTTCTGGGGAAGGGAGAGGG - Intronic
1160676607 19:394531-394553 GAGAGGATGGAGAAGGAAGATGG + Intergenic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1161958257 19:7508048-7508070 CAGTGTCTGACCAAGGAGGATGG - Intronic
1162409882 19:10499347-10499369 CAGTGTCAGGAGAAGGACCAGGG - Intronic
1163541801 19:17915900-17915922 CTTTCTCTGGAGAGGGAAGAGGG - Intergenic
1164790248 19:30971453-30971475 GAGAGTCTGGAGAAGGAGGTGGG - Intergenic
1164968568 19:32509915-32509937 CAATGTCAGGGGAAGGAAGCTGG + Intergenic
1165140432 19:33696650-33696672 CACGGTCTGGGGAAGGGAGATGG - Intronic
1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG + Intronic
1165591275 19:36972405-36972427 AAGGGACTGGAGAAGGATGAGGG - Intronic
1166461734 19:42993663-42993685 CAGCGTCCGGAGAAGGGAGGTGG + Intronic
1166800786 19:45455858-45455880 GAGTGTCTGCAGGAGGGAGAGGG + Intronic
1167706935 19:51086674-51086696 CAGTGTGTGGAGAGGGTAGGAGG + Intergenic
1167707431 19:51089993-51090015 CATTGTTTCGGGAAGGAAGAAGG + Intergenic
1168301828 19:55409113-55409135 CAGCTTCTGAAGAAGGAATAAGG + Intergenic
1168422280 19:56212417-56212439 CTGTGTCTGGAGAAGGATGTTGG - Intergenic
1168471524 19:56644046-56644068 CAGTGAATGGAGGAGGAAGAAGG - Intronic
925620467 2:5787270-5787292 CAGGGACTGGAGCAGGCAGATGG + Intergenic
925774698 2:7323340-7323362 CAGTGTTTGAAAAAGGAAGAAGG - Intergenic
926056985 2:9779411-9779433 CAGAGTCTCCGGAAGGAAGATGG + Intergenic
926186489 2:10694928-10694950 CACTGGCTGGAAAAGGAAGGAGG - Intergenic
927041416 2:19234413-19234435 CAGTGCTTGGAGAAGGGGGAAGG + Intergenic
927138531 2:20114448-20114470 CCGCCTCTGGAGAAGGATGATGG - Intergenic
928171582 2:29007813-29007835 CAGGGTCTGGAGGGGTAAGAAGG - Intronic
928182184 2:29076139-29076161 CACTGTCTGCAGGAGGGAGAGGG + Intergenic
928260087 2:29758632-29758654 CAGTGCCTGGGGAGGGAGGAGGG - Intronic
929685841 2:44033461-44033483 CAGTGGCTGGAAAAGGAACTAGG - Intergenic
930229523 2:48828480-48828502 CAGAGTCTTGAGAGGGAACATGG + Intergenic
930250442 2:49028722-49028744 CAGTGTATGGAGAAGCACAATGG - Intronic
931052215 2:58428076-58428098 CAGTTTCTGGAAGAGGAGGAGGG - Intergenic
931168293 2:59775157-59775179 AAGTGTTTGGAAAGGGAAGAAGG - Intergenic
931235579 2:60410205-60410227 CAGTGTCTGAAGGATGCAGAAGG + Intergenic
931306403 2:61033649-61033671 GAGTGTCAGGAGGAGGAACAGGG + Intronic
931808987 2:65835631-65835653 CAGTGTCTTGGGAAAGAAGAAGG + Intergenic
932733025 2:74233758-74233780 CAGTGTCTGTAAAACTAAGAAGG + Intronic
932794340 2:74681607-74681629 CAGGGACTGGAGAAACAAGAAGG - Exonic
933395622 2:81727433-81727455 AATAGTCTGGAGAAAGAAGATGG - Intergenic
933901388 2:86852909-86852931 AAGTGCCTGGGGAAGGAAGGAGG + Intronic
934562189 2:95319194-95319216 CAGAGTCTGCAGGAGGAAGGCGG + Intronic
935396486 2:102615096-102615118 CAGTATCTGGAGCAGGATGTAGG + Intergenic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
935779162 2:106496328-106496350 AAGTGCCTGGGGAAGGAAGGAGG - Intergenic
936073949 2:109389909-109389931 CAGATTCAGGAGAAGGCAGATGG - Intronic
936528866 2:113261183-113261205 CAGTTTCTGGAGAGGAAACAGGG + Intronic
937629046 2:124078796-124078818 GAGTGTCTGGAGAGGGATGCAGG + Intronic
937777748 2:125800220-125800242 GAGTATGTTGAGAAGGAAGAGGG - Intergenic
937864473 2:126738547-126738569 CAGTGCCTGGAAAAGGAGTATGG + Intergenic
937927613 2:127179228-127179250 CAGACTCTGGAGATGGAGGAAGG - Intergenic
938526727 2:132141049-132141071 TAGTGTCGGGAGACGGAAGCTGG + Intergenic
938663011 2:133506519-133506541 CAGTGTGAGGAGAATGAAGTGGG + Intronic
938971467 2:136437122-136437144 CAGTCACTGGGGGAGGAAGATGG + Intergenic
939959615 2:148554747-148554769 AAGTGCCTGAAGAAGTAAGAGGG - Intergenic
940124252 2:150306688-150306710 CAGTATCTGGAGAAGGAGATAGG - Intergenic
941684208 2:168430992-168431014 CAGAATCTGGAAAATGAAGAGGG - Intergenic
941983389 2:171485350-171485372 CAGTTCCTGGGGAAGGAAGGAGG - Intergenic
942536418 2:176969100-176969122 CAGTGTCTGGGAAAGGATGGAGG + Intergenic
942994920 2:182249380-182249402 CAGTATCTGGAGGGGGAAGAGGG + Intronic
943101041 2:183486900-183486922 CAGGGTCCAGAGAAGGCAGAGGG + Intergenic
943733709 2:191330736-191330758 GAGTCTGTGGAGGAGGAAGATGG + Intronic
944315244 2:198277733-198277755 CAGGATCTGGAGCAGGAGGAGGG - Intronic
944354015 2:198763569-198763591 GAGTGTGTGCAGAAGGGAGATGG - Intergenic
944647836 2:201797366-201797388 AATTGTATGGAGAAGGAAAATGG + Intronic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
946098111 2:217292861-217292883 CAGTGTCTGGGTAAGAAAGTGGG + Intronic
946212629 2:218159750-218159772 CTGTTTCTGGAGAATGGAGAAGG + Intergenic
946325617 2:218983357-218983379 CAGTGGCTGAAAAAGTAAGAGGG - Intronic
947205484 2:227657296-227657318 CAGCGTTTGGAGAAGGAAGAAGG + Intergenic
947483042 2:230520800-230520822 TAGGGTCAGGAGAAGGAAGAGGG + Intronic
948692937 2:239718431-239718453 CAGGGCCAGGAGAAGGGAGATGG - Intergenic
948781513 2:240324479-240324501 CAGGGCCTGGAGGAGGCAGAAGG - Intergenic
948928885 2:241117506-241117528 GAGTGTCAGGAGGAGGGAGAAGG + Intronic
1168797705 20:622538-622560 GTGTGGCTGGAGAAGGGAGAGGG - Intergenic
1168930079 20:1614632-1614654 CAGTTCCTAGAGAAGGAAGTAGG - Intronic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169571844 20:6914767-6914789 TTGTTGCTGGAGAAGGAAGAGGG + Intergenic
1169692317 20:8345520-8345542 CAGTGCCTGGACCAGAAAGAGGG - Intronic
1169867236 20:10215266-10215288 CAGTATGGTGAGAAGGAAGAAGG - Intergenic
1170235977 20:14105693-14105715 CACTGTCTGGGGTTGGAAGAGGG - Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170397691 20:15945910-15945932 GTGTGTCTAGAGAAGGCAGAGGG + Intronic
1170412631 20:16107573-16107595 CAGCATGTGGAAAAGGAAGAAGG + Intergenic
1170552544 20:17490088-17490110 GAAAGTCTGGAGGAGGAAGAAGG - Intergenic
1170641253 20:18155366-18155388 TAGTGGCTGGAGAAGGGGGATGG - Intronic
1171322699 20:24260415-24260437 CAGTATGGGGAGAAGAAAGATGG - Intergenic
1172626139 20:36348209-36348231 CAGTTACTGAAGAAGGAAGGAGG + Intronic
1173227191 20:41168842-41168864 CAGAATGTGGAGAAGCAAGAGGG + Exonic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1173798424 20:45878909-45878931 CAGGGGCTGGGGGAGGAAGAGGG - Exonic
1174365474 20:50053840-50053862 GAGTTTCCGGAAAAGGAAGAGGG - Intergenic
1174758180 20:53180622-53180644 CAGTGTTAGGAGAAGGATGTTGG - Intronic
1175202063 20:57284852-57284874 CAGTCTCTGGTGATGGAAGCAGG - Intergenic
1175352580 20:58335657-58335679 CAATGGCTGGAAAAGGAAGGTGG + Intronic
1175628763 20:60513269-60513291 CATTGACTGGAAAGGGAAGAGGG - Intergenic
1176372487 21:6070725-6070747 AAGAGTTTTGAGAAGGAAGAGGG + Intergenic
1176780492 21:13188547-13188569 CACTGTTTGGCGAAGGGAGAAGG - Intergenic
1177276447 21:18918527-18918549 CAATGTCTGGAAAAGGGAGTGGG - Intergenic
1178990056 21:37345674-37345696 CAGTGTCATGAGAAGCAAAAAGG + Intergenic
1179750989 21:43467520-43467542 AAGAGTTTTGAGAAGGAAGAGGG - Intergenic
1180142912 21:45903148-45903170 CAGTGTCTGGTGGAGGCATATGG + Intronic
1180434697 22:15289081-15289103 TAGTGTCGGGAGACGGAAGCTGG - Intergenic
1180634955 22:17256873-17256895 CTGTCTCTGGAGAAGGAAACAGG + Intergenic
1181128643 22:20716560-20716582 CACAGCCTGGAGCAGGAAGAAGG - Intronic
1181984368 22:26789391-26789413 CAGTGTCTGGAGGATGAGGGTGG - Intergenic
1182303338 22:29351128-29351150 CCTTGGCTGGAGAAGGAAAAGGG - Intronic
1183023696 22:35047963-35047985 CAGGGTGAGGAAAAGGAAGAGGG + Intergenic
1183106952 22:35621883-35621905 GAGTGGCTGGAGACCGAAGATGG - Intronic
1183270801 22:36861463-36861485 CAGTGTCTGGAGAGGAATGCAGG + Intronic
1183580626 22:38724141-38724163 CAATGCCTGGAGAAGCAAAAAGG - Intronic
1183864629 22:40694451-40694473 CAGCTTCCAGAGAAGGAAGATGG - Intergenic
1184288591 22:43486260-43486282 CAGTGTCTGGGGAAGGACTCGGG + Intronic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1184680567 22:46070630-46070652 CAGTGCCGGGAGATGTAAGAGGG - Intronic
1185064193 22:48622523-48622545 TGGTGTCGGGAGGAGGAAGAGGG + Intronic
1185086155 22:48742159-48742181 CTGTGCCTGGTGAAGGATGAGGG - Intronic
1185086170 22:48742202-48742224 CTGTGCCTGGTGAAGGATGAGGG - Intronic
1185086185 22:48742245-48742267 CTGTGCCTGGTGAAGGATGAGGG - Intronic
1185091582 22:48778615-48778637 CTGTGCCTGGAGCATGAAGAAGG - Intronic
1185415846 22:50709807-50709829 CAGAGTCTGGGGGAGGATGAAGG + Intergenic
949115960 3:323707-323729 CAATTTCTTGAGAAGGCAGATGG - Intronic
949649774 3:6143671-6143693 CAGTGTCTGGAAAAGGAGATGGG + Intergenic
950047139 3:9955467-9955489 CAGAGTCTGCAGAAGGATGCTGG - Intergenic
950822484 3:15775900-15775922 CAGTCTCTGGAGAAAGAAGAGGG - Intronic
952646458 3:35664756-35664778 AAGTGCCTGGAGGAGGCAGAAGG + Intronic
953027261 3:39152468-39152490 CAAGATGTGGAGAAGGAAGAGGG + Intronic
953263150 3:41359463-41359485 GTGTGTCGGGAGAAGCAAGAGGG + Intronic
954272173 3:49518544-49518566 CAGGGTCAGGAGAATAAAGAAGG + Intronic
956097442 3:65732123-65732145 CAGTCTCTGCATAAAGAAGAGGG + Intronic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
957144045 3:76398576-76398598 CAGTGTGTGAAAATGGAAGAGGG - Intronic
958489944 3:94759772-94759794 CATATTCTGGAAAAGGAAGATGG + Intergenic
958921737 3:100114297-100114319 CACTGCCCGGAGAGGGAAGAGGG - Exonic
959784102 3:110272679-110272701 CAGGGTGTGGGGCAGGAAGAGGG - Intergenic
960194068 3:114743420-114743442 AAATGTCTGTAGTAGGAAGAAGG + Intronic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
962187930 3:133279641-133279663 CAGTGCCTGGACATGGTAGATGG + Intronic
962198504 3:133382533-133382555 CTGTGTCTGGCTACGGAAGAGGG + Intronic
962731110 3:138284414-138284436 CAGTGTCTGGAAAAGAACAAAGG - Exonic
963951818 3:151210345-151210367 CTGTTTCTGGACAAAGAAGACGG + Intronic
964502665 3:157365943-157365965 CAGTCTCTGGGGAGGGGAGAGGG - Intronic
964722208 3:159778797-159778819 CTGTCTCTGGAGAAGACAGATGG + Intronic
964762000 3:160143026-160143048 CAGGGGCTGGAGAAGGAAGAGGG + Intergenic
966333846 3:178846205-178846227 CATTGTCCGTATAAGGAAGAAGG + Intergenic
966757582 3:183385902-183385924 CAGTGTCCAAAGCAGGAAGAAGG - Intronic
966935779 3:184707973-184707995 CAGTGTCTGAAGAAAGAAGATGG + Intergenic
966940061 3:184740664-184740686 CTGTGTTTGGGGGAGGAAGAGGG - Intergenic
967098529 3:186196902-186196924 CACAGGCTGGAGAGGGAAGATGG + Intronic
967367370 3:188702415-188702437 CAGTGTTCTGAGACGGAAGAAGG - Intronic
967522769 3:190454132-190454154 AAGTGTGTGGAAAAGCAAGAAGG + Intergenic
968234706 3:197024732-197024754 CAGCTGCTGGGGAAGGAAGAGGG - Intronic
968830441 4:2930871-2930893 CAGCTTCTGCAGGAGGAAGAAGG + Exonic
969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG + Intronic
970754579 4:19409717-19409739 CAGTCTCAGGAGAAGAAAGCTGG - Intergenic
971323359 4:25623307-25623329 CAGCCTCTGGAGGAGGAGGAGGG - Intergenic
971426667 4:26522778-26522800 AATTGTCTGGAAAAGGAAGGAGG - Intergenic
971756779 4:30717788-30717810 TATGGTCTGGAGAGGGAAGAGGG + Intergenic
972048425 4:34697561-34697583 TACAGTTTGGAGAAGGAAGATGG + Intergenic
972590323 4:40479879-40479901 CAGTGCCTGGTGAAGGACAAGGG - Intronic
974292168 4:59947411-59947433 CATTTTCTGGGGAAGGAGGAGGG - Intergenic
974589108 4:63920162-63920184 CACTGCCTGGAGTTGGAAGAGGG + Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975931022 4:79522735-79522757 CAGAGCCTGGAGAGGGGAGAAGG + Intergenic
976681137 4:87757427-87757449 GAGTGTGAGGAGAAGGAAAAGGG + Intergenic
978177902 4:105756293-105756315 CATTCTCTGGAGAGGGGAGAGGG - Intronic
978352881 4:107838892-107838914 CAGTGGCTACAGAAGGCAGATGG - Intronic
978591905 4:110332923-110332945 CAATAACTGGAGAAGGCAGAGGG - Intergenic
978740934 4:112137165-112137187 CAGGATCTGGAGAAGTAAGGTGG - Intergenic
978816003 4:112906428-112906450 CAGCGTCTGGATAGGGAAGTTGG + Intronic
979980172 4:127245321-127245343 CAGAGTCTGGGAAAGGAAGAGGG + Intergenic
981033730 4:140151182-140151204 GAGTGGCTGGAGGAGGAGGAAGG + Intronic
981244704 4:142521628-142521650 TAATCTCTGAAGAAGGAAGAAGG - Intronic
981521145 4:145663643-145663665 CAGTGAATGGAGAAGGGAGTGGG + Intergenic
981743071 4:148023392-148023414 CTTTGTCTGGAGCTGGAAGATGG + Exonic
982336275 4:154242565-154242587 CAGTGTCTGGCTAAAGAAAATGG + Intronic
982935205 4:161465069-161465091 TAGTGTCTTGAGAAGAAAGTGGG - Intronic
982998824 4:162386573-162386595 CAGTATCTGGAGGAGCAAGGAGG - Intergenic
983490629 4:168385187-168385209 CAATTTCTGGGGAAGGGAGAAGG + Intronic
983506493 4:168558545-168558567 CAGAGTTCGGAGAGGGAAGAAGG - Intronic
983620052 4:169751525-169751547 CCGTGAATAGAGAAGGAAGATGG - Intronic
983873625 4:172851051-172851073 CATTCTCTGGAGAAGGAAGGGGG - Intronic
984674894 4:182535619-182535641 CAGTCTCTGGAGTAGTAGGACGG - Intronic
984944113 4:184957872-184957894 GAGGATCTGGAGAAGCAAGAAGG + Intergenic
985477436 5:86190-86212 CAACATCTGGAGAAGGAAGTGGG - Intergenic
986043857 5:4019028-4019050 AATTGTCAGGAGAAGGAGGAAGG + Intergenic
986285269 5:6354367-6354389 GAGGGTCTGGACATGGAAGAAGG + Intergenic
986307090 5:6524083-6524105 CAGTGTGTGGCGGAGGGAGAGGG - Intergenic
986782718 5:11081816-11081838 CAGGGGCTGGAGAAGGGGGATGG + Intronic
988497687 5:31758737-31758759 CAAACTCTGGAGAATGAAGATGG - Intronic
988658979 5:33243582-33243604 CAGTATGTGGAGAAGAAAGAAGG - Intergenic
989729285 5:44629038-44629060 CAGTGGGTGGAGCAGTAAGAAGG - Intergenic
990516945 5:56539208-56539230 CATGGGGTGGAGAAGGAAGAGGG + Intronic
990808477 5:59694721-59694743 CAATGTCTTGAGAAGGACCATGG + Intronic
990832406 5:59974425-59974447 CAGTCTCTGGAGTATGGAGAAGG - Intronic
990919029 5:60942612-60942634 TAGTTTCTAGAGAAGGAAGAGGG + Intronic
990925228 5:61014159-61014181 CAATCTCTGGAGAGGGGAGAGGG + Intronic
991520410 5:67490861-67490883 CACTGTCTGGAGTTGGGAGATGG - Intergenic
991673947 5:69074530-69074552 CAGGCTCTGGGCAAGGAAGAGGG + Intergenic
991674336 5:69076252-69076274 GAGTGTCTGGAGAAGGAAGCAGG - Intergenic
994076707 5:95659941-95659963 CAGTGTTCAAAGAAGGAAGAGGG - Intronic
994087004 5:95770001-95770023 CAGTGTTTGGAGAAGGGGGTAGG + Intronic
994292272 5:98042004-98042026 AAGTATCAGGAGATGGAAGATGG + Intergenic
994804530 5:104427711-104427733 CAGTTTTTGGAGGAGGAAGTGGG + Intergenic
995315014 5:110759814-110759836 CAGGGTCAGAAGTAGGAAGATGG + Intronic
997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG + Intronic
997620849 5:135292717-135292739 CAATATCTGCAGAAGGCAGATGG + Intronic
997632541 5:135379721-135379743 CACTGAAAGGAGAAGGAAGAAGG - Intronic
998565575 5:143213326-143213348 GAGTGTGGGGAGGAGGAAGAAGG - Intronic
998735571 5:145136096-145136118 CAGAGACTGGAGAGGGTAGAGGG - Intergenic
998781548 5:145662434-145662456 CAGTGTAGGGAGAAAGAAAAGGG + Intronic
999690648 5:154143278-154143300 CAGTGTCAGGAGAAGGCTGTGGG - Intronic
1000291275 5:159873742-159873764 CACTGTCTAGAGATGGAAGGAGG - Intergenic
1000722881 5:164730334-164730356 CATTGTCTAGAGGAGGCAGAGGG + Intergenic
1001341142 5:170846622-170846644 CAGAGTCTGGGAAAGGAAGTTGG - Intergenic
1001801502 5:174548234-174548256 GAGGGTGAGGAGAAGGAAGAAGG - Intergenic
1001868154 5:175123802-175123824 CAGTGTCTTCTGAAGGAAGGAGG + Intergenic
1001961861 5:175884399-175884421 CAGTGTCTGGGGAATGAATGAGG - Intergenic
1003513207 6:6798852-6798874 CTGTGGCTGGCAAAGGAAGATGG + Intergenic
1004475602 6:15968322-15968344 CTGGGGCTGCAGAAGGAAGATGG + Intergenic
1004578379 6:16922523-16922545 CAGTGGCAGGAGATGGGAGAGGG + Intergenic
1005316105 6:24604268-24604290 CAATGGCTGCAGATGGAAGATGG - Intronic
1005354397 6:24968645-24968667 CAGTATCTGGACTAGGATGAGGG + Intronic
1005989694 6:30895383-30895405 CGCTGTCGGGAGAAGGAGGAGGG - Exonic
1006147215 6:31966866-31966888 CAGTGTGTGGAGCAGGAGGTTGG + Intronic
1006945766 6:37783615-37783637 CGGTGTCTGGAGGAGGATGAAGG - Intergenic
1006982434 6:38157281-38157303 AAGTGCCTGGAGCAGGAAGATGG + Intergenic
1007153013 6:39713476-39713498 CAGTGGCTGGAGGAGAAAGTGGG + Intronic
1007811836 6:44491759-44491781 CCATCTCTGGAGAAGGGAGAGGG + Intergenic
1008042974 6:46821472-46821494 GTGTGTGTGTAGAAGGAAGAAGG + Intronic
1008885675 6:56430010-56430032 CAGGGTCTGGAGCAGGAAAGGGG - Intergenic
1008966908 6:57322043-57322065 CAGTGGTTGGAGAAGGAAGGTGG + Intronic
1010142743 6:72630354-72630376 CACTGACTGAAGAAGGAATAGGG - Intronic
1010737123 6:79455476-79455498 CAGGTGCAGGAGAAGGAAGAGGG + Intergenic
1010744725 6:79547568-79547590 CAGTCTCTGGCGGAGGGAGAGGG - Intergenic
1012096640 6:94970862-94970884 GTGTATGTGGAGAAGGAAGAGGG + Intergenic
1012786960 6:103642638-103642660 CAGAGTCTCAAGAAGAAAGAAGG + Intergenic
1012809777 6:103942421-103942443 CAGTGTCTTTAGAAGAGAGATGG + Intergenic
1013395442 6:109733128-109733150 CAGTTTCCTGAGAAGGAATATGG + Intronic
1013813977 6:114075717-114075739 CAGTATCTGAAGAAGAAAGGAGG - Intronic
1013853472 6:114543079-114543101 CAGGGGCTGGAGAAGGGGGATGG - Intergenic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1015498527 6:133906519-133906541 CAGGGTCTGGATATTGAAGAGGG + Intergenic
1015555768 6:134459842-134459864 CAGTGAGTGCAGAAGGAAGCGGG - Intergenic
1015966237 6:138697281-138697303 AAGTGACTGCAGATGGAAGAGGG - Intergenic
1016026135 6:139288796-139288818 AATGGCCTGGAGAAGGAAGATGG - Exonic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1016912942 6:149216720-149216742 TAGTGGCCGGAGAAGGCAGAAGG - Intergenic
1017071068 6:150576039-150576061 CAGTGTCTACACGAGGAAGATGG + Intergenic
1017846662 6:158264476-158264498 CATTTTCTGGAGAGGGAAAATGG - Intronic
1017988214 6:159463201-159463223 CTGTGGCTGGCGAAGGTAGACGG - Intergenic
1018309241 6:162491474-162491496 CAGTGGCTGGAGCATGAAGGTGG - Intronic
1018719676 6:166563219-166563241 GTGTCTCTGGAGAAGGAAGATGG + Intronic
1019398945 7:840090-840112 CTTTCTCTCGAGAAGGAAGACGG + Intronic
1020005050 7:4778504-4778526 TGGAGTCTGGAGAAGGAAGGCGG + Intronic
1021146325 7:17093514-17093536 TAGTCTCTGCAGGAGGAAGAAGG + Intergenic
1021566899 7:22025030-22025052 CAGTGTCTAGTGTAGGATGATGG + Intergenic
1021767144 7:23961337-23961359 CTTTGGCTGGAGTAGGAAGATGG + Intergenic
1021849296 7:24791896-24791918 TAGTGTTGGGAGAAGGAAGCTGG + Intergenic
1022437161 7:30399310-30399332 CAGAGGCTGGAGGAGGAGGAGGG + Intronic
1023352981 7:39338765-39338787 CAATTTCTGCAGAAGGAAGCTGG - Intronic
1023557783 7:41441246-41441268 CAGTGGCTGGAGTAAGAAGCAGG + Intergenic
1023824692 7:44001100-44001122 CCTTGGCTGGAAAAGGAAGAGGG + Exonic
1023968794 7:44977188-44977210 CTGAGAGTGGAGAAGGAAGAAGG + Intronic
1024204209 7:47141615-47141637 CAGTATCAGGGGCAGGAAGAGGG - Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024839701 7:53571652-53571674 CAGACCCAGGAGAAGGAAGAGGG - Intergenic
1026088242 7:67279852-67279874 CCTTGGCTGGAAAAGGAAGAAGG + Intergenic
1026484777 7:70808452-70808474 TAGACACTGGAGAAGGAAGAAGG + Intergenic
1026747842 7:73026797-73026819 CCTTGGCTGGAAAAGGAAGAGGG - Intergenic
1026751492 7:73054936-73054958 CCTTGGCTGGAAAAGGAAGAGGG - Intergenic
1026755141 7:73083050-73083072 CCTTGGCTGGAAAAGGAAGAGGG - Intergenic
1027034048 7:74912091-74912113 CCTTGGCTGGAAAAGGAAGAGGG - Intergenic
1027088615 7:75282402-75282424 CCTTGGCTGGAAAAGGAAGAGGG + Intergenic
1027092258 7:75310330-75310352 CCTTGGCTGGAAAAGGAAGAGGG + Intergenic
1027095901 7:75338297-75338319 CCTTGGCTGGAAAAGGAAGAGGG + Intergenic
1027117842 7:75495190-75495212 CCTTGGCTGGAAAAGGAAGAGGG + Intergenic
1027273964 7:76540290-76540312 CCTTGGCTGGAAAAGGAAGAAGG - Intergenic
1027323440 7:77029395-77029417 CCTTGGCTGGAAAAGGAAGAGGG - Intergenic
1027327409 7:77059342-77059364 CCTTGGCTGGAAAAGGAAGAAGG - Intergenic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1027856237 7:83515186-83515208 CAGTGCCTGGAGCAGTGAGAAGG - Intronic
1028496337 7:91464847-91464869 CTGTGTCTAGAGAAAGAAAATGG - Intergenic
1029160832 7:98550645-98550667 CATGGTCTGGAGGAGGAGGAAGG + Intergenic
1029189225 7:98760063-98760085 CAGTGGCTGGAGTAGGTAGGGGG + Intergenic
1029257520 7:99279600-99279622 GAGCGGCTGGAGGAGGAAGAGGG + Intergenic
1029413867 7:100431084-100431106 CGATGTCGGGAGGAGGAAGATGG - Exonic
1029629631 7:101742394-101742416 CCGTGTTTGGAGAAGGAGGGGGG + Intergenic
1029719656 7:102354865-102354887 CCTTGGCTGGAAAAGGAAGAGGG - Intergenic
1029752958 7:102554393-102554415 CCTTGGCTGGAAAAGGAAGAGGG + Exonic
1029770909 7:102653485-102653507 CCTTGGCTGGAAAAGGAAGAGGG + Exonic
1030618087 7:111759562-111759584 CAGTTTCAGGAAAAGGCAGAGGG + Intronic
1030981928 7:116196363-116196385 CAAGATGTGGAGAAGGAAGATGG - Intergenic
1031077319 7:117225464-117225486 GACTGTGTGGGGAAGGAAGATGG + Intronic
1031436604 7:121739510-121739532 CAGTGTCTGAACAAAGAAGTTGG - Intergenic
1031894648 7:127335288-127335310 CAGAGGCTGGGGAAGGAATAGGG + Intergenic
1033442725 7:141395061-141395083 CAGTGTCTGGACAAGGCAATTGG - Intronic
1033579721 7:142721065-142721087 CAGTGTCTCTAGAGAGAAGAAGG + Intergenic
1033889226 7:145988304-145988326 TTGTGTGTGGAGAAGAAAGAGGG - Intergenic
1034468510 7:151243682-151243704 CAGTGCCAAGAGGAGGAAGATGG - Exonic
1034555888 7:151850129-151850151 CAGTGTCTGCAGAAAGAAGCGGG + Intronic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035181135 7:157090477-157090499 CCCTGGCTGGAGGAGGAAGAGGG + Intergenic
1035479208 7:159168658-159168680 CAGGGGCTGGGGAAGGAGGAAGG + Intergenic
1036089828 8:5653404-5653426 CAGTGTCTGAGGAAAGGAGAGGG + Intergenic
1036096218 8:5727167-5727189 CAGTGTCTGGAAGAGGATGAAGG + Intergenic
1036476970 8:9102393-9102415 CAGTGTTTGGAGAACAAAGGAGG + Intronic
1036945718 8:13092635-13092657 CAGGGTGTTGAGATGGAAGAGGG + Exonic
1037289591 8:17336658-17336680 AAGTCTCTGGAGAAGGAGCAAGG + Intronic
1037782838 8:21882491-21882513 AAGTGTTTGGAGGAGGAGGAGGG - Intergenic
1038046264 8:23767969-23767991 AAGTGTGTGGGGAAGGAAGTAGG + Intergenic
1038115426 8:24548606-24548628 CAGTATCTGCAGAAAGAATAAGG - Intergenic
1038281857 8:26172974-26172996 AAGTGTCTTGAAAATGAAGATGG - Intergenic
1041206174 8:55500021-55500043 CAAGCTCTAGAGAAGGAAGATGG - Intronic
1041322124 8:56624162-56624184 CAGTGTCTGAAGAGGTAGGAGGG - Intergenic
1041445628 8:57948462-57948484 CAGTGTCTGAACAAGAAAGGTGG + Intergenic
1041456631 8:58067459-58067481 CAGTGGATGGAGGAGGAAGGAGG - Intronic
1042411606 8:68473027-68473049 CATTGTATGAAGGAGGAAGAAGG - Intronic
1043785644 8:84396499-84396521 CAGTGTCTGGAACATGAACAAGG - Intronic
1044244660 8:89928501-89928523 TGGTGTCTGGGGAAGGAACAGGG + Intergenic
1044493550 8:92849283-92849305 CAGAGTCTGAGGAAGGAAGAAGG + Intergenic
1044694078 8:94905557-94905579 CAGTGGCTGGGGAAGGACCAGGG - Intronic
1044938020 8:97311820-97311842 CAGTGTCTGCAGAAGGAGAAAGG - Intergenic
1045316196 8:101045801-101045823 CAGTGTCTAGAGAAGCCACAGGG + Intergenic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1045981165 8:108189685-108189707 CAGTTTATTGAGAAGGAAGCAGG - Intergenic
1047132741 8:122039088-122039110 CAGAGTGTTGAGAAGGAAGCGGG - Intergenic
1047742019 8:127814199-127814221 AAGGGGCTGGAGAAGGAGGATGG - Intergenic
1048020708 8:130536521-130536543 CTGTTTCTGGAGAAATAAGATGG - Intergenic
1048067504 8:130985031-130985053 AAGTGTTTGGAGGAGGAAGAGGG + Intronic
1048183208 8:132215073-132215095 CCCTGGCTGGAGAAGGCAGATGG + Intronic
1048469205 8:134692160-134692182 CATTTTCTAGAAAAGGAAGATGG + Intronic
1048639775 8:136342352-136342374 CAGAGGCTGGAAAAGGAAGTTGG - Intergenic
1048914711 8:139171032-139171054 CAGTGTCTGCAGGAGCCAGAAGG - Intergenic
1049037230 8:140086230-140086252 CAGAGTATGGAGGATGAAGAAGG + Intronic
1050491344 9:6191277-6191299 CAGGGTCTGGGGTGGGAAGAAGG - Intergenic
1050711845 9:8474324-8474346 CAGAGTTTGGAGAAAAAAGAAGG - Intronic
1050712601 9:8482746-8482768 AAGTGGCAAGAGAAGGAAGAAGG - Intronic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051475795 9:17507823-17507845 CTGTGTCTGCTGAAGAAAGAAGG - Intergenic
1051903636 9:22069824-22069846 CAGAGACTGGGGAAGCAAGAAGG - Intergenic
1052619251 9:30884014-30884036 CAGTGTCTGGTGATGGAGCATGG - Intergenic
1053152552 9:35752158-35752180 CTGTTACTGGAGAAGGGAGAGGG + Intronic
1053218476 9:36292429-36292451 CAATGTTAGGAGAAGGATGAAGG - Intronic
1053277492 9:36794438-36794460 CAGTGTGTGGAGGAGGCAGGAGG - Intergenic
1053705429 9:40748406-40748428 TAGTGTCAGGAGAAGGAAGCTGG + Intergenic
1054415504 9:64872013-64872035 TAGTGTCAGGAGAAGGAAGCTGG + Intergenic
1054952283 9:70866126-70866148 CAGTGTCTGGAGAAAAATCATGG - Intronic
1055404757 9:75962869-75962891 CAGTGTCTTATGAAGCAAGAGGG - Intronic
1055425064 9:76186631-76186653 CACTGTATGGAGAAGGAATGAGG - Intronic
1056040835 9:82665374-82665396 CAGTGTTTGAAGAAGGAAATGGG - Intergenic
1056089054 9:83186568-83186590 CAGTGTTTGCAGCAGGCAGAAGG - Intergenic
1056179126 9:84064543-84064565 CAGTTTCTGGTGAGGGCAGATGG + Intergenic
1056379055 9:86040957-86040979 AAGTGCCTGAAGCAGGAAGAGGG - Intronic
1056385358 9:86092362-86092384 CAGAGTCAGGAGAAGGAAAGAGG - Intronic
1056551629 9:87657891-87657913 AAGTTTCAGGAGAAGGGAGATGG + Intronic
1057536480 9:95913662-95913684 CAGGGACTGGAGATGGAAGCAGG - Intronic
1057757618 9:97850351-97850373 CAGTTTCTTGAGAAGGAACATGG - Intergenic
1058273703 9:103009714-103009736 CAGAGTCTGGAAAAGGTAGTGGG - Intronic
1058358986 9:104119765-104119787 CAGTGTCAGACGATGGAAGATGG + Intronic
1059764664 9:117372292-117372314 CAGAGGGTGAAGAAGGAAGAAGG + Intronic
1059970121 9:119658631-119658653 AGGTGTATGGAGAAGGAAGGAGG + Intergenic
1060799424 9:126534318-126534340 CAGTGACAGAAGTAGGAAGAAGG + Intergenic
1060819762 9:126654546-126654568 CAGGGGCTGGAGCAGGTAGAAGG + Intronic
1060912142 9:127359513-127359535 CACAGTTTTGAGAAGGAAGAAGG - Intronic
1061001387 9:127904821-127904843 CAGAGGCTGGAGAGGGCAGACGG + Intronic
1062160970 9:135079643-135079665 CAGAGGCTGCAGCAGGAAGAAGG + Intronic
1186245618 X:7613454-7613476 CAGGGGCTGGAGGTGGAAGAAGG - Intergenic
1186497840 X:10026034-10026056 GGGTGTAGGGAGAAGGAAGAGGG - Intronic
1186664572 X:11704357-11704379 CAGTGTTTGGGGAAGGAAATCGG + Intergenic
1186714730 X:12239529-12239551 CATTATCTAGAGAAGGGAGAGGG + Intronic
1186889002 X:13941725-13941747 CAGTGTGTGGAGGAGGACGGAGG - Intergenic
1187184995 X:16976079-16976101 CAGGGGCTGGAGAAGGAATTGGG - Intronic
1188094961 X:26009947-26009969 CAATGTCTTGAGAAGGCAGTGGG - Intergenic
1188964705 X:36537002-36537024 CAGTGTCTGGAGATTGTACAGGG - Intergenic
1189362237 X:40361872-40361894 CAGTGGCTGCAGGAGGAAGTGGG + Intergenic
1189529288 X:41862626-41862648 AAGTGGCTGGAAAAGGAAAAGGG + Intronic
1190756805 X:53408463-53408485 CAGTGTCTAGAGAAGTGATAGGG + Intronic
1192614783 X:72608375-72608397 CACTATCTGGAGTTGGAAGAGGG + Intronic
1193986869 X:88253077-88253099 CACTGTCTGGAGTTGGAGGAGGG + Intergenic
1194831223 X:98624549-98624571 AAGTGCCTGGAGAGAGAAGAAGG + Intergenic
1195540060 X:106053296-106053318 CAGAGGCTGCAGAAGGAAGGGGG + Intergenic
1195755234 X:108193092-108193114 CAGTCTTTGGAGAAGGTAAAGGG + Intronic
1196774610 X:119326929-119326951 CAGTGTTTGGCCAAGGCAGAGGG - Intergenic
1196889107 X:120275240-120275262 CAGAGTCTGGGGAGGGAAGCTGG + Intronic
1197332022 X:125164879-125164901 AAGTTTCTGGAAAAGGAATATGG + Intergenic
1197761373 X:130030701-130030723 GAGTGTCTGGGGGAGGAACAGGG - Intronic
1197868373 X:131042439-131042461 CAGAGTCTGGAGAAAGAGGATGG + Intergenic
1198556625 X:137800018-137800040 CAATGTCTGGAGATGGAGGAGGG - Intergenic
1198993152 X:142539690-142539712 AAGTGTCTGTCGAAGGATGAAGG - Intergenic
1199665763 X:150095310-150095332 CAGAGTCTGGAGAAGAGACAGGG + Intergenic
1199684618 X:150255141-150255163 CTGTCTCTGGAGAGGGAAAAGGG - Intergenic
1200253218 X:154564741-154564763 CAGTGCCGGGTGGAGGAAGAGGG - Exonic
1200264549 X:154639674-154639696 CAGTGCCGGGTGGAGGAAGAGGG + Intergenic
1200554824 Y:4624096-4624118 CAGAGTCTGGAGAGGGTAGTGGG - Intergenic