ID: 960973458

View in Genome Browser
Species Human (GRCh38)
Location 3:123155258-123155280
Sequence ACTTACTTGGAGGAGAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 284}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960973458 Original CRISPR ACTTACTTGGAGGAGAGGGA TGG Intronic
900926799 1:5711102-5711124 ACTTCAGTGGAGGAGAGAGAAGG + Intergenic
902066806 1:13695027-13695049 AAGTTCTTGGAGGAGAGGGGTGG + Intergenic
902655492 1:17865211-17865233 ACTTAAGTGGAGAAGAGGCAAGG + Intergenic
903935664 1:26893176-26893198 CCTTTCTTGGAGGAGGAGGAGGG - Intronic
904310017 1:29622815-29622837 ACTTCTTTGGAGGAGGAGGAGGG + Intergenic
906157780 1:43623989-43624011 ACTACCTTGGAGGAGAGGGATGG + Intergenic
906523600 1:46481161-46481183 ACTTACGGAGAGGAGGGGGAGGG + Intergenic
906642221 1:47448343-47448365 ACCCCCTTGGAGGAGAGGAAGGG + Intergenic
907125144 1:52043143-52043165 AATGAGTTGGAGGTGAGGGACGG - Intronic
908704345 1:66934827-66934849 ATTTTATTGGAGGAGAGGGATGG + Intronic
909979803 1:82085304-82085326 ACTGAGTAGGAGGAGAGAGAGGG + Intergenic
912483464 1:110004243-110004265 AGTTTCTTGGGGGAGAGGGAGGG - Intronic
912555751 1:110514781-110514803 ACTCACTTGGGCGAGAGGGGTGG + Intergenic
913575119 1:120164430-120164452 ACTTACTAGAAGAGGAGGGAAGG - Intronic
914465210 1:147922183-147922205 CCTCACTTGGAGGGGAGTGAGGG - Intergenic
914557424 1:148780071-148780093 ACTTACTAGAAGAGGAGGGAAGG - Intergenic
914615410 1:149350159-149350181 ACTTACTAGAAGAGGAGGGAAGG + Intergenic
915167665 1:153957711-153957733 GCCTCCTTGGAGGAGAGGTAGGG - Intronic
915554973 1:156656317-156656339 ACATGCTTGGAGGAGGAGGAAGG + Exonic
915602921 1:156933490-156933512 ACTGCTTTGGAGGAGAGGTAAGG + Intergenic
917051966 1:170934692-170934714 AGGTACTTGGGGGAGAGGGAGGG + Intergenic
918940420 1:190988558-190988580 GGTTACTTGGAGAAGAGGGAAGG - Intergenic
918987639 1:191653770-191653792 ACGTAGTTGGAGAAGAGGAAGGG + Intergenic
920349049 1:205325545-205325567 CCTTTCTTGGAGGGGAGGTAGGG - Intergenic
920712223 1:208306217-208306239 ACTTGCCTGGAGCAGAGTGAGGG + Intergenic
921980137 1:221248071-221248093 AATTCCTTGGAGGAGAGGATGGG - Intergenic
923961717 1:239092240-239092262 ACTAGCTTGGAGGAGAGAGACGG + Intergenic
924083231 1:240420961-240420983 ACCTCCATGGAGGAGAGGGAAGG + Intronic
1068124964 10:52827917-52827939 ACTTAAGGGAAGGAGAGGGAAGG + Intergenic
1069453071 10:68532770-68532792 AAATACTTGGAGGGGAGAGAAGG - Intergenic
1069511519 10:69046157-69046179 ACCTACTTGGAGTGGAGGGGAGG + Intergenic
1071569691 10:86690231-86690253 ACCCACTGGGAGGGGAGGGAAGG - Intronic
1072438029 10:95431195-95431217 GCTTTCTTGAAGGAAAGGGAGGG - Intronic
1073128132 10:101165370-101165392 ACTTACTAGGAGGTGGGGGAGGG - Intergenic
1074228199 10:111508120-111508142 ACTTACTTTGTGGAAAAGGAAGG - Intergenic
1075540742 10:123311627-123311649 TTTTACTTAGAGGAGAGGAAGGG - Intergenic
1076767518 10:132644639-132644661 GCTTCCTTGGAGGAGCGGAAAGG - Intronic
1077949635 11:6942228-6942250 ACTGGCTTGAAGGAGAGGAAAGG + Intronic
1078072566 11:8126658-8126680 CCTTACATGGAGGACTGGGAAGG - Exonic
1080142682 11:28941699-28941721 AGTTACTCAGAGGAGAGGAAGGG - Intergenic
1083340780 11:61957177-61957199 ACAGACTTGGAGAAGAGGGAGGG - Intronic
1083544721 11:63539608-63539630 CCTTACTTGGAGGAGCCAGATGG - Exonic
1084034955 11:66504020-66504042 CCTTATTTGTAGGAGAGGAATGG + Intronic
1084461644 11:69299571-69299593 ACTGGCTGGGAGGAGAGGCAGGG + Intronic
1084690910 11:70726037-70726059 GCTTACATGGAGGAGAGAGCTGG - Intronic
1085059977 11:73436756-73436778 ACTCATTTTGAGGAGAGGCAGGG - Intronic
1085766540 11:79288064-79288086 TCTTCCTTGAAGGAGAAGGATGG + Intronic
1085979310 11:81703716-81703738 AGTTACTTGCATGACAGGGAAGG - Intergenic
1086186960 11:84030080-84030102 ATTTATTTGGGGGAGACGGAAGG - Intronic
1086232450 11:84586856-84586878 ACTTTTTTGGAGGATGGGGATGG - Intronic
1088137700 11:106577891-106577913 ACTACCATGGAGGATAGGGAAGG + Intergenic
1088799376 11:113291323-113291345 ACTTGCGTGGAGGAGAGCAAAGG - Intergenic
1090402809 11:126459756-126459778 TATTACATGGAGGAGAGGGTGGG + Intronic
1090672466 11:128958421-128958443 GGTTACTTGCAGGAGAGGAAGGG - Intergenic
1090914912 11:131154861-131154883 CCTGACTTGCAGGCGAGGGAAGG + Intergenic
1091609819 12:1996445-1996467 GCTTGCATAGAGGAGAGGGAAGG - Intronic
1091918510 12:4286428-4286450 ACTAACCTGGAGGAGAGGTGGGG + Intronic
1092004807 12:5060357-5060379 ACACACTGGGAAGAGAGGGAGGG + Intergenic
1093709346 12:22312131-22312153 GTTTATTTAGAGGAGAGGGAGGG - Intronic
1094342950 12:29433086-29433108 ACTTCGATGGAGGACAGGGAAGG - Intronic
1095511690 12:42957841-42957863 ATTCACTGAGAGGAGAGGGAAGG - Intergenic
1096771036 12:53936253-53936275 AGCGACTTGGAGGAGTGGGAAGG - Intergenic
1096994188 12:55828891-55828913 AGTGATTTGGAGGAGAGGGGAGG - Intronic
1097590894 12:61573940-61573962 ACTCACATGGAGGAGGTGGAAGG - Intergenic
1099147353 12:79063559-79063581 ACATAAGTGGAGGAGGGGGAAGG + Intronic
1100599923 12:96104413-96104435 ACTGACTTGCAGGAGAGAGTGGG - Intergenic
1100936659 12:99677421-99677443 ACTTTTTTGGAGGAGAGGAAAGG + Intronic
1101502603 12:105318078-105318100 AATTGCTTGGAAAAGAGGGAGGG - Intronic
1103164247 12:118756673-118756695 AGTTAATTGGAGAAGATGGATGG - Intergenic
1103973482 12:124687066-124687088 ACTCACTGGCAGGACAGGGAGGG - Intergenic
1103979277 12:124726090-124726112 ACCAACATGGAGGAGAGGGCAGG - Intergenic
1104369825 12:128214886-128214908 ACCTACTCTGAGGGGAGGGATGG - Intergenic
1106077158 13:26470506-26470528 ACCTACTTTTAGGGGAGGGAAGG - Intergenic
1106542913 13:30705858-30705880 AGTCACCTGGAGGAGAGGGCTGG + Intergenic
1107676575 13:42803930-42803952 ACCTACTTGCAAGAGAGGCAGGG - Intergenic
1108837961 13:54574830-54574852 ATTTATTAAGAGGAGAGGGAGGG - Intergenic
1109181596 13:59220145-59220167 ACAGACGAGGAGGAGAGGGAGGG + Intergenic
1109812950 13:67539641-67539663 ATCTACTTGGAGTAGAAGGATGG + Intergenic
1111469908 13:88666649-88666671 ACATAATTGGAAGAGAGGAAAGG - Intergenic
1114318454 14:21526856-21526878 ACTTCTTTTGTGGAGAGGGATGG - Intronic
1114949684 14:27733968-27733990 ACTGGATTTGAGGAGAGGGATGG + Intergenic
1115029327 14:28775129-28775151 TCTTACTTGCAGGGGAGGGCGGG - Intronic
1116876116 14:50113781-50113803 ACTTACTTGGGGGCGGGGGGGGG + Intronic
1117042915 14:51783908-51783930 ACTCATTTGGAGAAGATGGACGG + Intergenic
1117049733 14:51848113-51848135 GCTGACTTGGATGTGAGGGAAGG - Intronic
1117178062 14:53165476-53165498 AGCTACTTGGAGGACAGGCAGGG - Intergenic
1118781175 14:69008934-69008956 CCTCACTTGGAGGAGAGAGATGG + Intergenic
1120960774 14:90122726-90122748 ACTAACTTGGAGGAGACCAAAGG + Intronic
1121400924 14:93676394-93676416 ACTGACTTGGAGGAGAGGGCAGG + Intronic
1121685020 14:95829445-95829467 ACTTCCTAGCAGGGGAGGGAGGG + Intergenic
1121688732 14:95859113-95859135 ATTTACCTGGAGGAATGGGACGG - Intergenic
1121985165 14:98498369-98498391 ACTCACTGGAAGGAGAGGGCAGG + Intergenic
1124553790 15:30707601-30707623 ATATCCTTGGAGGGGAGGGAAGG + Intronic
1124677458 15:31698071-31698093 ATATCCTTGGAGGGGAGGGAAGG - Intronic
1125378076 15:39054821-39054843 AGTTATTTGGAGGAGAAGGGGGG + Intergenic
1126306185 15:47260725-47260747 TATTTCTTGGAGGGGAGGGATGG + Intronic
1127217067 15:56834388-56834410 ACTAAGTTGGGGGAAAGGGAAGG + Intronic
1127299480 15:57638856-57638878 AATTACTTGGAGGGGAGGACGGG - Intronic
1127332727 15:57954767-57954789 ATCTCCTTGGAAGAGAGGGAGGG + Exonic
1128562328 15:68677140-68677162 GATGGCTTGGAGGAGAGGGAGGG - Intronic
1128787211 15:70406675-70406697 AGTTAGTTGCAGGAGAGGGGTGG - Intergenic
1129072740 15:72964537-72964559 ACTCAGTTGGAGAACAGGGAAGG - Intergenic
1130562873 15:84972224-84972246 AATTGGTTGGAGGAAAGGGATGG + Intergenic
1131430336 15:92383038-92383060 ACTTTCTTGGGGGAGGAGGAGGG - Intergenic
1135743457 16:24996575-24996597 CCTTGCTTGGGGTAGAGGGAGGG - Intronic
1139707440 16:68751082-68751104 ACTGGCTTGGAGGAAGGGGAAGG - Intronic
1140555329 16:75915263-75915285 ACTTTCTTCTAGGTGAGGGATGG - Intergenic
1141175239 16:81714176-81714198 TTTTACTTGGAGGTGGGGGATGG - Intergenic
1141978077 16:87531481-87531503 ACCTTGTTGGAGGAGAGGCATGG + Intergenic
1143014728 17:3885590-3885612 ACTCACTTGGAGGAGGCAGATGG - Exonic
1143312831 17:6007391-6007413 ACCTAATTGAAGGAGATGGAAGG - Intronic
1143691973 17:8575823-8575845 ACTACCTGGGAGGAGAAGGAGGG - Intronic
1146369456 17:32256276-32256298 ACTCACTTGGAGGAGGGTGGTGG - Intergenic
1146404525 17:32525819-32525841 GCTAACATGGAGGAGAGGCAGGG + Intronic
1146424295 17:32721788-32721810 ACTTAATTGGCACAGAGGGAAGG - Intronic
1146672713 17:34752796-34752818 ACTGACATGAAGGAGAGGGAAGG - Intergenic
1146728650 17:35175488-35175510 ACCTAAATGCAGGAGAGGGAAGG + Intronic
1147212816 17:38881959-38881981 ACTTGTTTGGGGGAGAGGCAGGG + Intronic
1148425952 17:47596182-47596204 ACTTAGTTGCAGAAGAGGGGTGG + Intronic
1148823055 17:50371883-50371905 ATTTACTTTGAGGAGGAGGATGG - Intronic
1151349930 17:73525683-73525705 AATTACTTCTAGGATAGGGATGG - Intronic
1151351342 17:73533798-73533820 ACTTCCTTGAAGGAGCTGGAGGG - Intronic
1151363582 17:73603238-73603260 CCCTACTTGGTGGAGAGTGAGGG + Intronic
1152614127 17:81330138-81330160 TCTTACCTGGAGCAGAGGGGCGG + Exonic
1153127161 18:1808463-1808485 TCTCACTGGGAGGAGAGGGTGGG + Intergenic
1154067976 18:11127048-11127070 GTTTAGTTGGAGGAGAGAGAAGG + Intronic
1155618496 18:27748459-27748481 ACTTAGGAGGAAGAGAGGGAGGG - Intergenic
1155985438 18:32225998-32226020 ATTTTGTTGGGGGAGAGGGAAGG + Intronic
1156960047 18:43016564-43016586 ACTTACCTGGGGCAGAGGGTGGG - Intronic
1157581408 18:48776207-48776229 ACTGCCTTGTAGGAGAGGGTAGG + Intronic
1158123324 18:54074674-54074696 ACTTACATGGAGAAGAGGTGAGG - Intergenic
1158608261 18:58915418-58915440 CCTTAGGTGGAGTAGAGGGATGG + Intronic
1158700601 18:59742437-59742459 GATTAATTGGAGGAGAGGGGAGG - Intergenic
1161238107 19:3207897-3207919 ACTTCCTTGGAGGAGAGCTTGGG + Exonic
1161300922 19:3542951-3542973 TCTTGCCTGGAGAAGAGGGAGGG - Intronic
1164867847 19:31619670-31619692 ACTTACTTGGCGGGGAGCAAGGG + Intergenic
1165699790 19:37928892-37928914 AGTGGCTTGAAGGAGAGGGATGG - Intronic
1166963692 19:46515180-46515202 CCTGGCTCGGAGGAGAGGGAGGG - Intronic
1167129006 19:47572521-47572543 AGTTACTTAAAGGAGGGGGAGGG + Intergenic
1167210814 19:48133113-48133135 AGTGAGTTAGAGGAGAGGGAAGG + Intronic
925658724 2:6179946-6179968 ATTTACTTGGGGAAAAGGGAGGG + Intergenic
925898566 2:8492269-8492291 ACATTCTTGGAGGAAAGGCAGGG + Intergenic
926581624 2:14635789-14635811 AAGGAGTTGGAGGAGAGGGAGGG + Exonic
928213469 2:29341393-29341415 CCATACATGGAGGAGAGTGATGG + Intronic
929229749 2:39547338-39547360 ACTAATATGGAGGACAGGGAAGG + Intergenic
929891700 2:45923790-45923812 GCTTTCTAGGAGCAGAGGGAAGG + Intronic
930129997 2:47840283-47840305 ACTTGCTGAGAGGAGTGGGAAGG + Intronic
931497810 2:62829357-62829379 ACTTACGTGGAAGAGTGGGAGGG - Intronic
933517895 2:83329663-83329685 ACTTTCTTGAAGGGGAGAGATGG - Intergenic
933750625 2:85600408-85600430 ACTTGCTGCGAGGAGGGGGAAGG + Exonic
933802656 2:85975616-85975638 ACTCACTTGGTGGGGAGAGAAGG - Intergenic
935196132 2:100818173-100818195 ACTTGCCTGGAGGAAAAGGACGG + Intergenic
935375086 2:102387547-102387569 ACTTTGGTGGAGGAAAGGGATGG - Intronic
936718155 2:115214790-115214812 ACTCAGTTGGAAGAGAGGTATGG - Intronic
936971815 2:118183781-118183803 ACTTGTGTGCAGGAGAGGGAGGG + Intergenic
938422980 2:131158599-131158621 ACTTTTTTGGAGCAGGGGGAAGG - Intronic
938757261 2:134392351-134392373 ATTTATTTTGAGGAGAGAGATGG + Intronic
938819751 2:134945058-134945080 ACTTTCCTGGTGGGGAGGGAAGG - Intronic
939522331 2:143246651-143246673 ATATCCTTGGAGGAGAGGGCAGG + Intronic
941069765 2:160942764-160942786 ACTGACTTGGGAGATAGGGATGG + Intergenic
942305998 2:174608175-174608197 ACTGACTTGGAAAAGAGGCAGGG + Intronic
942736922 2:179125096-179125118 AGTTAGTTGGAGGTGAGGGAGGG - Intronic
945246617 2:207723304-207723326 AATTACTTGGAAGAGAGAAAAGG + Intronic
945286720 2:208089821-208089843 GCCCACTTGGAGGAGAGTGAAGG + Intergenic
945682587 2:212932024-212932046 ACTTGATAGGAGGAGATGGAGGG - Intergenic
945867330 2:215190982-215191004 ACCTACTTGGAGAAGAGTGTGGG + Intergenic
946645803 2:221832508-221832530 ACTAAGTTGGATGGGAGGGATGG - Intergenic
948013938 2:234672590-234672612 ACTCACCTTGCGGAGAGGGAAGG - Intergenic
948197848 2:236108376-236108398 ACTGACAAGGAGGAGAGGAAGGG - Intronic
948354846 2:237369947-237369969 AGCTACTTGGAGGATAAGGAGGG - Intronic
1170388715 20:15849278-15849300 TCTTTCTTGCAGGAGTGGGAGGG + Intronic
1172214153 20:33223135-33223157 GCTGTCTTGGAGGAGGGGGATGG + Intronic
1172709736 20:36912278-36912300 ATTTAGTTGGAGGAAAAGGAGGG - Intronic
1173174349 20:40753095-40753117 ACTTGCTTTGAGGAAAGGGATGG + Intergenic
1173462312 20:43253124-43253146 ATTTTCTTGGAGGTGAGGGTGGG + Intergenic
1174319410 20:49729173-49729195 ACTTACATGTTGGAGAGGGCAGG - Intergenic
1175050574 20:56151781-56151803 TCCTACTTGGAGGTGAGGGTGGG + Intergenic
1175203440 20:57293029-57293051 ACTTAGTGGGAAGGGAGGGAGGG - Intergenic
1176020162 20:62958676-62958698 CTGGACTTGGAGGAGAGGGAGGG - Intronic
1176365743 21:6031826-6031848 AGTTACTTGGCTGAGAGGGAGGG + Intergenic
1176728784 21:10468729-10468751 ACCTACTTGGAGGAAGGGGTAGG - Intergenic
1177040651 21:16106012-16106034 TTTTGCTAGGAGGAGAGGGATGG - Intergenic
1178694304 21:34779960-34779982 ACATGCTGGGAGGAGGGGGAAGG - Intergenic
1179152570 21:38821568-38821590 ACTTCCTGCGGGGAGAGGGAGGG - Exonic
1179757773 21:43506719-43506741 AGTTACTTGGCTGAGAGGGAGGG - Intergenic
1181551973 22:23644774-23644796 TGTTACTGGGACGAGAGGGAAGG - Intergenic
1182450229 22:30415741-30415763 ATTTGCTGGCAGGAGAGGGAAGG - Exonic
1182453377 22:30434275-30434297 TCTTACCTAGAGGTGAGGGATGG - Intergenic
1184581448 22:45420617-45420639 AGTTAGTTGGAGGAGAAAGATGG - Intronic
950133540 3:10564372-10564394 ACTTAGCTGGAGAATAGGGATGG - Intronic
950473333 3:13199770-13199792 ATTTGCCTGGAGCAGAGGGAAGG - Intergenic
950696670 3:14706048-14706070 CCTTTCTTGGAGGAGAGGACGGG + Intronic
951806146 3:26646363-26646385 ACTTGCTTGAAGGAGAGTCAGGG + Intronic
951867824 3:27327164-27327186 ACTTAGGTGGAGGGGAGGGATGG - Intronic
951873943 3:27399544-27399566 ACTTACTGGGAGGCTAAGGAGGG - Intronic
955409320 3:58645669-58645691 AGGTACTTGGGGGAGAAGGAGGG + Intronic
955921038 3:63955475-63955497 ACTTACTTGGAGGGAAGGAGAGG + Intronic
956626227 3:71269504-71269526 ACTTACTTAGAAGAGTGGGGAGG - Intronic
956668149 3:71661258-71661280 ACGTTTCTGGAGGAGAGGGAAGG + Intergenic
956958650 3:74372201-74372223 GCTAATTTGGAGGAGGGGGAAGG - Intronic
957853218 3:85838561-85838583 ACTTTTTTGGAGGAGAGGGGAGG + Intronic
959791679 3:110369080-110369102 CCTCACTTGGAGGAGAGTTAGGG + Intergenic
960717133 3:120586900-120586922 ACTTACTTGGAAGTGAAGAAAGG + Intergenic
960973458 3:123155258-123155280 ACTTACTTGGAGGAGAGGGATGG + Intronic
961130459 3:124461720-124461742 AGATACTTGTAGGAAAGGGAAGG + Intronic
964426124 3:156555335-156555357 ACCCACCTGGAGGAGAGAGAAGG + Intergenic
964734202 3:159899752-159899774 ACTTATTTGGAGGAGGGAGTGGG - Intergenic
964949321 3:162268398-162268420 GCTTACTTGAGGGAGAGGGTTGG + Intergenic
965668338 3:171120023-171120045 AGTTATTTGGGGGAGAAGGAAGG + Intronic
966355262 3:179072352-179072374 ACTTTCGTGTAGGGGAGGGAAGG - Intergenic
967293274 3:187942566-187942588 ACTGTGGTGGAGGAGAGGGATGG - Intergenic
967978274 3:195047521-195047543 AGTGCCTTGGAGGAGAGAGATGG - Intergenic
968487268 4:868680-868702 GCTTCCCTGCAGGAGAGGGAGGG + Exonic
968813773 4:2811460-2811482 AAGTTCTGGGAGGAGAGGGAGGG + Intronic
968981221 4:3850666-3850688 ACTTTCCTGGAGGTGAGGGTGGG + Intergenic
971622316 4:28871266-28871288 ACATACTTAAAAGAGAGGGAAGG - Intergenic
972263633 4:37437605-37437627 AATTACATGAAGGAAAGGGATGG + Intronic
973105012 4:46324717-46324739 GCTTATTTGATGGAGAGGGAGGG - Intronic
973731041 4:53822548-53822570 ACCTTTTTGGAGCAGAGGGAGGG - Intronic
973817976 4:54635885-54635907 AGTCACTTGGAAGAAAGGGATGG - Intergenic
976337732 4:83909995-83910017 CCTTGCTTGGAGTAGAGGGTTGG + Intergenic
980269064 4:130560574-130560596 GCTTACTTGGAGAAAAGAGAAGG - Intergenic
981028368 4:140098868-140098890 ACTTATTTTGAGGTGGGGGAGGG + Intronic
981272163 4:142857772-142857794 AGTTAGTGGGAGGAGAGGAAAGG - Intergenic
981911104 4:149982496-149982518 TCAGACTAGGAGGAGAGGGAAGG - Intergenic
982093407 4:151899152-151899174 ACTGACTTGGAGGAAATGGTGGG - Intergenic
982434525 4:155368716-155368738 AGTCACATGGAGGAGAAGGATGG - Exonic
983560509 4:169097025-169097047 GTTTCCTTGGAGAAGAGGGAGGG - Intronic
986759604 5:10868200-10868222 ACTCTCTTGCAGGAGATGGAAGG + Intergenic
987278828 5:16391306-16391328 ACTAACTTAGAGGAGAGAAAAGG - Intergenic
987529091 5:19093944-19093966 ACTTCTTTGGAGGACAGAGAAGG + Intergenic
988349765 5:30086803-30086825 ACTTACTTGGATGAAAGATATGG + Intergenic
988428595 5:31092850-31092872 AATTAATTGGAGGAGAGGATAGG - Intergenic
988870371 5:35383128-35383150 TCTGACTTGGAGGAGAGCAATGG - Intergenic
989764022 5:45057715-45057737 ACTTAAATGGAGGAGGAGGATGG - Intergenic
990317248 5:54594824-54594846 GATTACTAGAAGGAGAGGGAGGG - Intergenic
992024362 5:72655983-72656005 TATTTCTTGGAGGGGAGGGAGGG - Intergenic
992489430 5:77227868-77227890 ACTTAGTTGGAGGAGTTGAAAGG + Intronic
993493186 5:88577263-88577285 ACTTGCTTGGACTAGAGGGATGG - Intergenic
993523481 5:88934819-88934841 ACTGAGATGGAGGAGAGAGATGG - Intergenic
993598483 5:89889613-89889635 ATTTACATTAAGGAGAGGGAAGG + Intergenic
994588483 5:101742672-101742694 GCCTACTTGAAGGTGAGGGAGGG - Intergenic
996445614 5:123546299-123546321 ACATACTTGGGGCAGAAGGAAGG - Intronic
998463312 5:142324838-142324860 ACTTACTTTGAGGAGCTGCAGGG + Exonic
998621270 5:143796712-143796734 ACTTACAAGGATGAGAGGGGAGG + Intergenic
1003284115 6:4719414-4719436 AAGTACTTAGAGGGGAGGGAAGG - Intronic
1006201100 6:32291876-32291898 ACTAATTTGGGGGACAGGGAGGG - Intronic
1008004114 6:46391834-46391856 ACTGAGGTGGAGGAGAGGAAAGG + Intronic
1008061383 6:47000892-47000914 GCATTCTTGGAGGAGAGAGAAGG - Intronic
1008533853 6:52491276-52491298 ACTGACATGGGAGAGAGGGATGG + Intronic
1008646381 6:53519032-53519054 GCTTACTAGGAGGTGAGTGAGGG - Intronic
1009319911 6:62274792-62274814 ATTTAGTTTGAGGAGGGGGAAGG - Intronic
1009808661 6:68634802-68634824 ACTCACTGGGAGGCGAGGCAGGG - Intergenic
1010287228 6:74093150-74093172 ACCTACATGGAGGAGAGGGGAGG + Intergenic
1011465457 6:87651308-87651330 ACTTGCTTGGAGGGGAAAGACGG - Intronic
1011543739 6:88462468-88462490 GATTACTAGGAGGGGAGGGAGGG + Intergenic
1013042320 6:106448158-106448180 ACTTGGTTGGAGGTGAGGCAAGG - Intergenic
1013751679 6:113414546-113414568 TCTCATTTGGAGGAGAGTGAGGG - Intergenic
1013758051 6:113483963-113483985 TCTCATTTGGAGGAGAGTGAGGG + Intergenic
1014997965 6:128176012-128176034 AATTAGCTGGAGGAGAGAGATGG + Intronic
1016684689 6:146867904-146867926 ACCTACTTGAGGGTGAGGGATGG - Intergenic
1018154783 6:160975506-160975528 CCTTTCTGGGAGGAGAAGGAAGG - Intergenic
1019763543 7:2832190-2832212 AGTCACTTGGAGGAGAGGGGAGG - Intronic
1020349413 7:7201747-7201769 ACTTCCTCGGGGGAGGGGGAGGG - Intronic
1022820723 7:33957995-33958017 AATTACTTTGAGGAGACGGAGGG + Intronic
1023046002 7:36210670-36210692 GTTTTCTAGGAGGAGAGGGAAGG - Intronic
1023572055 7:41582505-41582527 TCTTACTAGGAGAAGAGGCATGG - Intergenic
1026283807 7:68945541-68945563 TGTTTCTTGGAGGAGAGGGGAGG + Intergenic
1028745730 7:94324272-94324294 ACTTACTTGGAAGGAAGGAAGGG - Intergenic
1031020591 7:116623300-116623322 AGTTACTTGAAGGACAGGGAAGG + Intergenic
1031532345 7:122889949-122889971 CCTTAATTAGAGGAGAGGCAAGG - Intergenic
1031988603 7:128180573-128180595 ACTTACATGGAGGAAAGTGAAGG + Intergenic
1032281421 7:130505475-130505497 ACGTCATTCGAGGAGAGGGAAGG - Exonic
1032311774 7:130794177-130794199 ACCTATTTGGAGCAGAAGGAAGG - Intergenic
1032495471 7:132358453-132358475 AGTAATTTGGAGGAGAGGGTTGG + Intronic
1034601314 7:152259188-152259210 ACCTACTTGGAGGAAGGGGTAGG + Intronic
1035341492 7:158165421-158165443 CCTCTCTTGGAGGAGAAGGACGG - Intronic
1036197088 8:6728156-6728178 ATTAACTTGGAGGAGAGGAGTGG - Intronic
1036386391 8:8285426-8285448 CCTTACTTCGAGCAGAGAGAGGG - Intergenic
1038087798 8:24219006-24219028 ACTTACTTGGAAGAAAGGGAGGG + Intergenic
1039631345 8:39114870-39114892 ACTTACTTGAAGGTGGAGGATGG - Intronic
1039712221 8:40067372-40067394 ACTAACTGGAAGGAAAGGGATGG - Intergenic
1039766005 8:40628713-40628735 ACTAACTTGGAGCAGAGAGATGG + Intronic
1039952910 8:42185632-42185654 GTTTACTTGGAGGTGAAGGATGG + Intronic
1040355662 8:46616061-46616083 ACTAAATTGGAGGGGAAGGAGGG + Intergenic
1041058110 8:54008535-54008557 AGTTACTTGGGGGTAAGGGACGG + Intronic
1042019436 8:64355376-64355398 GTTTGCTTGGAGGTGAGGGAAGG - Intergenic
1042529714 8:69802641-69802663 TCTTACTGGGAGTTGAGGGAGGG - Intronic
1045286993 8:100800475-100800497 AGTGGCATGGAGGAGAGGGATGG - Intergenic
1045902669 8:107302843-107302865 AAATACTGTGAGGAGAGGGAGGG - Intronic
1046115669 8:109780311-109780333 ACTGAGTAGGAGGAGAGAGAGGG - Intergenic
1047123424 8:121931888-121931910 ACATACTGGGAGGAAACGGAGGG + Intergenic
1048027192 8:130597552-130597574 GCTTAGTTGGAGGATAGGGGTGG + Intergenic
1049255993 8:141614191-141614213 TCTTCCTTGGAGCAGGGGGAGGG + Intergenic
1049429116 8:142551007-142551029 GCTTTATTGGAGGAGAGGGATGG + Intergenic
1050182570 9:2936071-2936093 TCTTATTTGGAGTAGGGGGATGG - Intergenic
1051790235 9:20793890-20793912 TCTTATTTAGTGGAGAGGGAAGG + Intronic
1051893017 9:21962286-21962308 ACTTACGGGGAAGAGATGGAGGG - Intronic
1055577061 9:77670984-77671006 ACTTAGTCGGGAGAGAGGGAAGG + Intergenic
1057107427 9:92432915-92432937 AGTTAATTGGAGGAAAGGGCAGG + Intronic
1057840700 9:98483688-98483710 AGTAAGTGGGAGGAGAGGGAAGG - Intronic
1059259576 9:112962868-112962890 ACTTATTGTGGGGAGAGGGAAGG - Intergenic
1062472883 9:136713946-136713968 AGCCACTTGGAGGATAGGGAAGG - Intronic
1186510161 X:10124651-10124673 ACTTCCTTGACGGTGAGGGAGGG - Intronic
1189000942 X:36944949-36944971 CCATACTTGGAGGAGGGGTAGGG - Intergenic
1189126321 X:38451161-38451183 TATTACTTAGAGGAGGGGGAAGG - Intronic
1192379894 X:70604649-70604671 TATTACTTGGAGAGGAGGGAAGG + Intronic
1193556785 X:82963573-82963595 ACTTTCTGGGAAGAGTGGGAGGG - Intergenic
1193584658 X:83306293-83306315 ACTGAGTTGGAGAAGAGGCAGGG - Intergenic
1196185818 X:112743831-112743853 ACATACATTGAGAAGAGGGAAGG - Intergenic
1198487298 X:137100485-137100507 ACTTTTTTGGGGGAGAGGCAGGG + Intergenic
1198936557 X:141906224-141906246 ACTAAAGTGGAGGAGAAGGAGGG - Exonic
1199851149 X:151725585-151725607 TCTTACTTGGGGGTGGGGGAGGG + Intergenic
1201012984 Y:9567557-9567579 ACTGAGTTGGTAGAGAGGGAGGG + Intergenic