ID: 960976455

View in Genome Browser
Species Human (GRCh38)
Location 3:123179516-123179538
Sequence TGAGCTCTGCGGAGGCCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960976451_960976455 -4 Left 960976451 3:123179497-123179519 CCAGAGGGAGGCCTTTCTCTGAG 0: 1
1: 0
2: 3
3: 9
4: 182
Right 960976455 3:123179516-123179538 TGAGCTCTGCGGAGGCCAGTAGG 0: 1
1: 0
2: 2
3: 9
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960976455 Original CRISPR TGAGCTCTGCGGAGGCCAGT AGG Intronic
900032388 1:381074-381096 GGAGCTCTGCAGAGGCAAGGAGG + Intergenic
900052938 1:609260-609282 GGAGCTCTGCAGAGGCAAGGAGG + Intergenic
900525532 1:3126599-3126621 TGAGCTCTGTGGTGGGCAGAGGG + Intronic
902722964 1:18316278-18316300 TGACCACTGCTGAGGCCAGAGGG + Intronic
905636990 1:39560487-39560509 TGAGATCTGCAGATCCCAGTTGG - Intergenic
905788147 1:40774344-40774366 TCAGGTCTGCGGAGGCCACAAGG + Intergenic
905918220 1:41700514-41700536 TGGGCTCTGGGGAGGACAGTGGG - Intronic
906702756 1:47871866-47871888 TGATCACTGCAGAGGCCATTTGG - Intronic
908576867 1:65469167-65469189 TGAGCTATGCTGAGTCCGGTGGG + Intronic
908948055 1:69523956-69523978 TGAGCTCTGGGGAGGTGAGAGGG + Intergenic
911067836 1:93807489-93807511 TGAGCTCTGCGGAAGGTGGTGGG + Intronic
912167425 1:107057267-107057289 AGAGCTCGGCGGAGGCCGGCAGG - Exonic
912524001 1:110267167-110267189 TGAGAGCTGAGGAGGCCACTGGG + Intronic
915141467 1:153771059-153771081 TTAGCTGTGCGGTGGCCAGCAGG - Intronic
915513544 1:156400241-156400263 TGAGCTCTACTGAGGTCAGCTGG - Intergenic
917153481 1:171969397-171969419 TGAGCTCTGAGGGAGGCAGTGGG + Intronic
917981421 1:180271956-180271978 AGAGCTCTGCAGAGGACTGTGGG + Exonic
919484568 1:198130684-198130706 TGAGCTGAGCGGAGGCGATTGGG - Intergenic
922176526 1:223202035-223202057 TGACCTTTGAGGAGTCCAGTAGG + Intergenic
923030147 1:230243289-230243311 TGAGGCCTGCAGAGGCGAGTTGG - Exonic
1067793589 10:49305165-49305187 TGAGCTCTAAGGAGACCTGTGGG + Intronic
1069841970 10:71345645-71345667 TGAGGCCTGTGAAGGCCAGTTGG - Intronic
1069878204 10:71576044-71576066 AGGGCTCTGTGGAGGCCAGTCGG - Intronic
1070821463 10:79357899-79357921 CAAGCTCTGTGGAGGCCAGTGGG + Intergenic
1076607969 10:131701661-131701683 TGAGCCCAGTGGAGCCCAGTGGG + Intergenic
1077045981 11:545332-545354 TGAGCCGTGCGGGGGCCAGAAGG - Intronic
1077085581 11:748231-748253 TGAGCCCTGCGGTGCCCAGTGGG + Intronic
1077273828 11:1694095-1694117 TGACCTCTGCAGAGCCCAGCAGG + Intergenic
1077405399 11:2380243-2380265 TGGGCTCTGGGGAGGCTGGTGGG + Intronic
1077481280 11:2815795-2815817 GGAGCTCTGGGGAGGCCAGCAGG - Intronic
1078064113 11:8066699-8066721 TGAGCTCTGAAGAGGGCAGGAGG - Intronic
1078549346 11:12269649-12269671 TCAGCTCTGCTGAGGGCCGTGGG + Intergenic
1081573426 11:44305191-44305213 TTAGCTCTGAGGAGGAAAGTTGG - Intronic
1082660464 11:55903575-55903597 TGAGCTCAGCTGAGGGCAGACGG - Intergenic
1083952878 11:65966520-65966542 TGAGGTATTCGGAGGCCAGCCGG - Exonic
1084072324 11:66744600-66744622 TGAGCGCCGCGGGTGCCAGTGGG - Intronic
1085028899 11:73257921-73257943 TGACCTCTCCTGGGGCCAGTGGG + Intergenic
1085304074 11:75475382-75475404 TAAGCTCTGCGGGGGCTGGTAGG - Intronic
1089582260 11:119488848-119488870 TGAGGTCTGCAGAGGCCTGAAGG - Intergenic
1091070059 11:132554553-132554575 TGAGCTTTGCTGAGGACAGTGGG + Intronic
1100696604 12:97100669-97100691 TGACCTCTTTGGAGGGCAGTGGG + Intergenic
1101295232 12:103416360-103416382 TGAGCTCTGCCCAGTGCAGTGGG - Intronic
1113595484 13:111528785-111528807 TGAGCTGTCCAGAGGCCAGGTGG - Intergenic
1114587277 14:23826326-23826348 TGAGGTCTGGGGAAGCCAGGAGG - Intergenic
1116886253 14:50224376-50224398 TGGGCTCTGGGGAGGTCAGAAGG + Intronic
1121219854 14:92277225-92277247 TGTGCTGTGGGGAGGGCAGTTGG + Intergenic
1122284369 14:100642087-100642109 GGAGCTGTCCAGAGGCCAGTGGG - Intergenic
1122961187 14:105094213-105094235 TGAGGTCTGCAGGGGCCAGCAGG + Intergenic
1123026366 14:105426109-105426131 TGAGCTCTGTGGGTGCCATTAGG + Intronic
1124180107 15:27465178-27465200 TGGGCTCTGCTGAGGCAAGTGGG - Intronic
1125331801 15:38589829-38589851 TCAGTTCTGGGAAGGCCAGTCGG - Intergenic
1125524924 15:40368677-40368699 TGACCTCTGCTGCGGCCACTCGG + Exonic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1128112739 15:65086845-65086867 TGAACTCTGAGGAGAGCAGTGGG - Intergenic
1132745469 16:1434478-1434500 AGGGCCCTGCGGAGGCCAGGAGG - Exonic
1134707184 16:16310786-16310808 GGGGCTCTGCGGACGCCAGCGGG + Intergenic
1134960357 16:18401339-18401361 GGGGCTCTGCGGACGCCAGCGGG - Intergenic
1136588190 16:31201440-31201462 TGAGCTCTGCACATGCCAGCAGG + Intergenic
1137582246 16:49640591-49640613 TCAGCGCTGCGGGGGCCAGGGGG - Intronic
1138420092 16:56893172-56893194 TGAGCTCAGGGGAGCCCAGAGGG + Intronic
1139957193 16:70698675-70698697 AGAGCTCTGTGGAGGTCAGCAGG + Exonic
1140655486 16:77135138-77135160 TGAGCTCTGGGGAGGCAAGGGGG + Intergenic
1140771457 16:78208103-78208125 AGAGCACTGCTGAGGCCAGATGG - Intronic
1142733245 17:1877372-1877394 TCAGCTCTGCGGAGGGCAGTGGG + Intronic
1142733253 17:1877415-1877437 TCAGCTCTGCGGAGGGCAGTGGG + Intronic
1143763829 17:9124409-9124431 TGAACTCTGAGCAGGCCTGTGGG + Intronic
1144326591 17:14188053-14188075 CAAGTTCTGTGGAGGCCAGTTGG - Intronic
1144475469 17:15584919-15584941 CAAGTTCTGTGGAGGCCAGTTGG - Intronic
1144663947 17:17089623-17089645 TGAGCTCTGGGGAGTTCAGCAGG + Intronic
1145809541 17:27756226-27756248 GGAGCTCAGCGGCGGCCACTGGG - Intergenic
1146488095 17:33260378-33260400 TTAACTCTGCAGGGGCCAGTTGG + Intronic
1147155053 17:38540415-38540437 TGAGCTCTACGGTGGCCGGCGGG - Intronic
1150458928 17:65330785-65330807 GGAGCTGTGGGGTGGCCAGTCGG - Intergenic
1150819674 17:68425177-68425199 TGTGCTCTGTGGAGGGCAGCAGG - Intronic
1151499260 17:74478436-74478458 TGAGCTCAGAGGAGGGCAGCTGG - Intronic
1151562671 17:74878965-74878987 TGACCTCTGACCAGGCCAGTTGG + Intronic
1152947539 17:83206040-83206062 GGAGCTCTGCAGAGGCAAGGAGG - Intergenic
1155142446 18:23055259-23055281 TGAGATCCACGGAGGCCAGCTGG - Intergenic
1155683990 18:28524330-28524352 GGAGCTCAGCGGAGCCCAGAGGG + Intergenic
1157085725 18:44578814-44578836 TGGGCTATGAAGAGGCCAGTAGG + Intergenic
1160576419 18:79856839-79856861 TGAGCCCTGGGGAGGCCGGCAGG + Intergenic
1161054825 19:2185241-2185263 CGAGCTCTGATGTGGCCAGTGGG + Intronic
1162962087 19:14134374-14134396 TGTGCTTTGGGTAGGCCAGTGGG - Intronic
1163306635 19:16483797-16483819 TGTGCTCTGGGGAGGGCATTTGG + Intronic
1164506313 19:28864083-28864105 TGAGCTCTGCGTCAGGCAGTGGG + Intergenic
1165145074 19:33725505-33725527 TGAGCTCAGGGCAGGGCAGTGGG - Intronic
1166137646 19:40786961-40786983 TGAGCTCTGTGGAGCCAGGTGGG + Exonic
1166283724 19:41810956-41810978 AGAGCTCAGCCGATGCCAGTAGG - Intronic
925486400 2:4337159-4337181 TGAGGTATGCTGAGCCCAGTTGG - Intergenic
925986358 2:9218358-9218380 TCAGCTCTAAGGAGGCCAATTGG - Intronic
926735846 2:16072807-16072829 TGAGCACAGCAGAGGTCAGTGGG + Intergenic
927807944 2:26164781-26164803 TGACCTCTGAGGTGGCCAGCTGG + Intergenic
928089860 2:28367409-28367431 TGTGCTCTGCGAAGACCATTTGG - Intergenic
929816731 2:45238415-45238437 TGTACTCTGCTGGGGCCAGTAGG - Intergenic
933586376 2:84183797-84183819 AGAGCTGTGCTGATGCCAGTAGG - Intergenic
935596261 2:104880388-104880410 TGAGCTCAGCTGGGGCCAGCTGG + Intergenic
937410183 2:121668097-121668119 TGTGCTCTGTGGAGACCTGTGGG + Intergenic
938208397 2:129443209-129443231 TTAGTTCTGCAGAGGCCAGCAGG - Intergenic
946155300 2:217803129-217803151 GGAGCTCTGCTGAGGTCAGAGGG + Exonic
946301995 2:218829828-218829850 TTAGCACTATGGAGGCCAGTTGG - Intronic
947448547 2:230183524-230183546 AGGGCTCTGGGGAGCCCAGTGGG + Intronic
1170592772 20:17783521-17783543 TGAGATCTGGTGAGGCCAGGAGG - Intergenic
1172974274 20:38894647-38894669 TGACCTCTGCGAAAGCCAGCAGG - Intronic
1173311262 20:41898020-41898042 CTAGCTCTGCAGAGGACAGTGGG - Intergenic
1176014666 20:62924495-62924517 TCAGTTCTGTGGAGCCCAGTAGG - Intronic
1176666201 21:9689735-9689757 TGAGATTTGCTGTGGCCAGTGGG + Intergenic
1179198043 21:39183826-39183848 TGAGCCCTGCGGGCGCCAGGAGG + Exonic
1180717166 22:17879606-17879628 TGGCCTCGTCGGAGGCCAGTGGG - Intronic
1181165103 22:20979149-20979171 TGACCTCTGGGGAGACCAGGAGG + Intronic
1183384559 22:37507610-37507632 GGAGCTCAGATGAGGCCAGTGGG + Intronic
1185346199 22:50311884-50311906 TAAGGTCTGCAGAGGCCAGGTGG + Exonic
949772525 3:7594624-7594646 TGAATACTGCGGAGGCCTGTCGG - Intronic
958108927 3:89114506-89114528 TCAGCCCTCTGGAGGCCAGTGGG + Intronic
959254900 3:103996770-103996792 TGAGCTCTGATGAAGCCAGCTGG + Intergenic
960617541 3:119609542-119609564 ACAGCTCTTCGGAGGCCAGCTGG + Exonic
960773748 3:121225498-121225520 GGAGCTGTACGGAGGCCAATGGG + Intronic
960976455 3:123179516-123179538 TGAGCTCTGCGGAGGCCAGTAGG + Intronic
961370094 3:126423648-126423670 GGTGCTATGCGGTGGCCAGTGGG + Intronic
969582953 4:8076421-8076443 TGGCCTCTGCGGCAGCCAGTGGG + Intronic
969612721 4:8236208-8236230 TGAGCTCTGAGGAGGGCGCTGGG + Intronic
969652717 4:8477481-8477503 GGAGCTCTGCTGAGGCCTCTGGG + Intronic
970192258 4:13528090-13528112 TGAGCTCTCCGGAGGCTGGCGGG - Intergenic
970549710 4:17166994-17167016 TGAGAGCTGCGGGGGCCTGTAGG - Intergenic
978473990 4:109105091-109105113 TGATCACTGTGGAGGCTAGTTGG + Intronic
980013608 4:127623312-127623334 GGAGCTGTGCGGGGGCCAGACGG + Intronic
985408822 4:189662601-189662623 TGAGATTTGCTGTGGCCAGTGGG - Intergenic
986157186 5:5188130-5188152 TGAGCTTTCAGGATGCCAGTGGG + Intronic
987087889 5:14487150-14487172 AGACCTTTGCGGAAGCCAGTTGG + Intronic
988581854 5:32475375-32475397 TGTGCTCTGTGGACTCCAGTGGG + Intergenic
993221165 5:85099006-85099028 TGAGCTCTGTGGAAACCAATGGG + Intergenic
998560233 5:143164818-143164840 TGAGGTGTGCCAAGGCCAGTGGG - Intronic
999147086 5:149403599-149403621 TCAGCTCAGAGGTGGCCAGTTGG - Intronic
1001233653 5:170011239-170011261 TGAGCACTGCAGAGAACAGTTGG + Intronic
1001681604 5:173561907-173561929 TGAGTTCTTCTGAAGCCAGTGGG + Intergenic
1002294685 5:178223850-178223872 TGAGCTGTGGGGAGGCCTGACGG - Intronic
1002741432 5:181437794-181437816 GGAGCTCTGCAGAGGCAAGGAGG - Intergenic
1003933767 6:10954637-10954659 TGAGCTGTGAGGAGGCAAGATGG + Intronic
1005727721 6:28665900-28665922 TGAGATCTGTGGAGGCCAAAGGG - Intergenic
1015201965 6:130592843-130592865 TGAGCTCAGAGAAGGCGAGTAGG + Intergenic
1016801590 6:148174396-148174418 TGAGCTCTGCGGAGGCTCAATGG - Intergenic
1018393825 6:163361822-163361844 TGACCTGTGCACAGGCCAGTGGG - Intergenic
1019246566 6:170713559-170713581 GGAGCTCTGCAGAGGCAAGGAGG - Intergenic
1022098746 7:27156886-27156908 TGGGGTCTGCGGACGCCAGGCGG + Intronic
1022763604 7:33384139-33384161 TGAGCTTATCGGAGGCCATTTGG + Intronic
1023464181 7:40435608-40435630 TGAGCTCTGGGGAGGGTAGGTGG - Intronic
1024062581 7:45709956-45709978 GCAGCTGTCCGGAGGCCAGTTGG + Intronic
1024527994 7:50365122-50365144 GGAGCTCTGTGGATGCCAGGTGG - Intronic
1024867229 7:53917941-53917963 AGAGCTCTAAGGAGGCCAATGGG - Intergenic
1024967849 7:55040179-55040201 TGGGCTCTGTGGAGGTCAGAAGG + Intronic
1033619928 7:143052806-143052828 TGAGCTCGGGAGAGGACAGTGGG - Exonic
1034228651 7:149501842-149501864 GGAGTTCAGCAGAGGCCAGTCGG - Intergenic
1035501573 8:94402-94424 GGAGCTCTGCAGAGGCAAGGAGG + Intergenic
1035530132 8:344831-344853 TGAGCTGGGGGAAGGCCAGTGGG - Intergenic
1035670337 8:1412176-1412198 GGGGCTCTGCAGAGGGCAGTGGG - Intergenic
1040389523 8:46937836-46937858 TGAGCTTAGGTGAGGCCAGTAGG + Intergenic
1041413369 8:57581197-57581219 TGAGCTCTGGGCTGGCAAGTTGG - Intergenic
1048546740 8:135394658-135394680 TGCGCTTTGCTGTGGCCAGTGGG + Intergenic
1050682788 9:8133538-8133560 TCAGCTTTACGAAGGCCAGTGGG - Intergenic
1055693488 9:78858382-78858404 GGAGCTCAGAGGAGGCCAATTGG + Intergenic
1057096490 9:92315018-92315040 CGGCCTCTGCGGAGGCCAGTGGG + Exonic
1057179781 9:93023465-93023487 TCTGCTCTGCAGAGGCCAGGTGG - Intronic
1057212901 9:93210225-93210247 TGAGATTTGGGGAGGACAGTGGG + Intronic
1058419944 9:104824046-104824068 TGAGCTCTGTGGTAGCCACTTGG + Intronic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1061411516 9:130424672-130424694 TGAGCTCTCCTGGGGGCAGTGGG + Intronic
1061564186 9:131426680-131426702 TGAGCTCTGGGGAGGGCTGCTGG + Intronic
1061719179 9:132541236-132541258 TGAGCTCTGAGGAGGGCGGCTGG - Intronic
1061873965 9:133534855-133534877 CGAGCGCTGCGGAGGGCAGACGG - Intronic
1203607343 Un_KI270748v1:69010-69032 GGAGCTCTGCAGAGGCAAGGAGG - Intergenic
1203659897 Un_KI270753v1:32026-32048 TGAGATTTGCTGTGGCCAGTGGG - Intergenic
1186510357 X:10125680-10125702 TGAGCACTGCAGAGGTCATTGGG - Intronic
1187364463 X:18655128-18655150 TGAGCTCTTAGGAGGCTGGTAGG + Intronic
1192139502 X:68635636-68635658 TTATCTCTGAGGAGGGCAGTGGG + Intergenic
1196456687 X:115895969-115895991 CGAGCTCTCTGGAGGCCTGTGGG - Intergenic
1200090913 X:153635539-153635561 TGGGCTCTGGGGAGGCGGGTGGG + Intergenic