ID: 960981533

View in Genome Browser
Species Human (GRCh38)
Location 3:123232548-123232570
Sequence CTGGCCCTTTACTGTTTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 312}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960981533_960981537 14 Left 960981533 3:123232548-123232570 CCAAAAAAACAGTAAAGGGCCAG 0: 1
1: 0
2: 1
3: 33
4: 312
Right 960981537 3:123232585-123232607 ACCTGTAATCCCACCACTTTGGG 0: 615
1: 80457
2: 321136
3: 243106
4: 142130
960981533_960981536 13 Left 960981533 3:123232548-123232570 CCAAAAAAACAGTAAAGGGCCAG 0: 1
1: 0
2: 1
3: 33
4: 312
Right 960981536 3:123232584-123232606 CACCTGTAATCCCACCACTTTGG 0: 598
1: 76344
2: 216768
3: 254686
4: 200866
960981533_960981539 17 Left 960981533 3:123232548-123232570 CCAAAAAAACAGTAAAGGGCCAG 0: 1
1: 0
2: 1
3: 33
4: 312
Right 960981539 3:123232588-123232610 TGTAATCCCACCACTTTGGGAGG 0: 2343
1: 312754
2: 267635
3: 146233
4: 128732
960981533_960981543 27 Left 960981533 3:123232548-123232570 CCAAAAAAACAGTAAAGGGCCAG 0: 1
1: 0
2: 1
3: 33
4: 312
Right 960981543 3:123232598-123232620 CCACTTTGGGAGGCCGAAGCAGG 0: 26
1: 3560
2: 103074
3: 246975
4: 240320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960981533 Original CRISPR CTGGCCCTTTACTGTTTTTT TGG (reversed) Intronic
900540117 1:3198366-3198388 CTGGGCCTTTCCTGTCGTTTGGG + Intronic
901814006 1:11783751-11783773 CTGGTCGTTTACTGTTTTGTGGG + Intronic
902182083 1:14696992-14697014 CTGGCCCTTTTCTTTTTCATAGG - Intronic
902416922 1:16245312-16245334 CTGGCCCTTTATTTATTTGTTGG + Intergenic
904176280 1:28631526-28631548 CTGCCCATTTTCTTTTTTTTTGG - Intronic
904503784 1:30934285-30934307 GTGGTCCTTTACTGTTTATATGG - Intronic
905678367 1:39846691-39846713 TTGGCCCTGTACTGTGTCTTTGG - Intronic
907207430 1:52785742-52785764 CCGGCCCTTAACTTTTTTTTAGG + Intronic
907417951 1:54327303-54327325 TTGGCCCTTACCTGTTTTTTTGG - Intronic
907707372 1:56844545-56844567 CTGGACCTCTCCTGTTTTCTAGG + Intergenic
910929946 1:92433383-92433405 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
911035764 1:93545408-93545430 CTGTGCCTTTACTCTTGTTTTGG - Intronic
911390377 1:97233602-97233624 CTGCCCCTTTCCTGGTTCTTTGG + Intronic
911707509 1:101030891-101030913 GTGTCCCTTTAAGGTTTTTTAGG + Intergenic
914521613 1:148422505-148422527 CTGGCTTTTTAATTTTTTTTAGG + Intergenic
914647025 1:149662986-149663008 CTGGCTTTTTAATTTTTTTTAGG + Intergenic
914672733 1:149883934-149883956 CTGGACCCTTCCTGTGTTTTAGG - Intronic
918342802 1:183581332-183581354 CTGGCCCCACCCTGTTTTTTTGG - Intronic
918357274 1:183717021-183717043 GTGGCAGTTTACTGTATTTTAGG + Intronic
918973095 1:191445397-191445419 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
919271745 1:195357558-195357580 CTGGTCCTGGACTTTTTTTTTGG - Intergenic
919332567 1:196190184-196190206 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
922037513 1:221863559-221863581 CTGCCCCTTTACTTTTCTCTGGG - Intergenic
923239737 1:232071582-232071604 CTGGTCCTGGACTGTTTTGTTGG + Intergenic
923764996 1:236884892-236884914 CTGGCCTTTGACTGGTTTCTGGG - Intronic
923823146 1:237469602-237469624 CTGGCTCTTTAGTGGTTTTCAGG - Intronic
924157314 1:241192124-241192146 CTGGCCCTTTCCTGATCATTTGG + Intronic
924595553 1:245441962-245441984 CTGGCCCTTTGATGGCTTTTGGG + Intronic
1065331195 10:24602116-24602138 CTGACATTTTACTGTTTTCTTGG - Intronic
1065536500 10:26719958-26719980 CTGATCGTTTACTGTTTTTTTGG + Intronic
1065663666 10:28034833-28034855 CTGCCCCTATTCTGTTCTTTTGG + Intergenic
1066800805 10:39187590-39187612 CTGACACTTAAATGTTTTTTTGG - Intergenic
1068788826 10:61005507-61005529 CTGGTCCTGGACTGTTTTGTTGG + Intergenic
1069072312 10:64001847-64001869 CTGGCCTTCTGCTTTTTTTTTGG - Intergenic
1070376239 10:75833787-75833809 CTGTCCCATCACTGTATTTTGGG - Intronic
1072374213 10:94797611-94797633 CTGGTCCTGAACTTTTTTTTTGG + Intronic
1073257497 10:102162654-102162676 GTGACCCTTTACTATGTTTTGGG - Exonic
1074021715 10:109591407-109591429 CTGCCTCTTTACAGTTTTTATGG + Intergenic
1075300627 10:121320516-121320538 ATGTACCTTTACTGTTTGTTGGG + Intergenic
1075786587 10:125054024-125054046 ATGGCCCTCTACTGTTTTGTGGG - Intronic
1075963656 10:126591064-126591086 CTGGTCCTGGGCTGTTTTTTTGG - Intronic
1076025303 10:127107255-127107277 ATGGCCCTTTACTAATATTTAGG - Intronic
1077766627 11:5165173-5165195 CTGCCCCTTCACTGCTTTTCTGG - Intronic
1077781149 11:5330993-5331015 ATGGCCCATGACTGTTTTATTGG - Intronic
1078053965 11:7991983-7992005 CTGGGCCTCTTCTGTTTATTGGG + Intronic
1078871182 11:15346455-15346477 TTGGACCTAAACTGTTTTTTGGG - Intergenic
1079176001 11:18141138-18141160 CCGGCCCATGACTATTTTTTAGG + Intronic
1081194058 11:40139752-40139774 CTGGTGCTTTTCTGTTTTATAGG + Intronic
1081388014 11:42495994-42496016 CTGGCCCATTATTCCTTTTTTGG - Intergenic
1081390007 11:42518154-42518176 CTGGTCCTGGACTTTTTTTTTGG - Intergenic
1083801590 11:65049180-65049202 CTGGCTGATTACTGTATTTTTGG + Intronic
1084655291 11:70511669-70511691 CAGGCACATTACTCTTTTTTTGG - Intronic
1086717952 11:90086219-90086241 CTGGACCGTTCCTGTATTTTTGG - Intergenic
1086962369 11:92991584-92991606 CTGGCCCTTGACTGTTATCTGGG - Intergenic
1088242701 11:107787986-107788008 CTGGCCCTCTTGTGTTTTTATGG - Intergenic
1088413523 11:109563989-109564011 CTGGTCCTGTACTTTTTTATTGG + Intergenic
1088832318 11:113547828-113547850 CTGGCCCTTTGTTGTCTTTGTGG + Intergenic
1091873534 12:3915002-3915024 CTGTCCCATTACTGTATATTGGG - Intergenic
1096192187 12:49626997-49627019 GTGGCCCCCTACTGTTTTGTAGG + Intronic
1098510295 12:71304936-71304958 CTAGCCCTTTAATGTATTTGTGG + Intronic
1099312066 12:81038740-81038762 CTTGCCCCTTACTGATTTCTGGG - Intronic
1099694467 12:86000023-86000045 CTGTCACTTTAAAGTTTTTTCGG - Intronic
1100333524 12:93608148-93608170 CTGGCCCTTTTTTTGTTTTTTGG + Intergenic
1103759537 12:123238344-123238366 TTGGCCCTTAACTGTTTATTAGG + Intronic
1104023523 12:125009732-125009754 CAGCCTCTATACTGTTTTTTAGG + Intronic
1104558367 12:129822363-129822385 CTGGTCCTTTGCTGGTTTTGTGG - Intronic
1106824925 13:33509935-33509957 CTGGCCCTTCACTGCTTTCTGGG - Intergenic
1108080077 13:46726459-46726481 CTGTCCCTTTCCTGGTTATTTGG - Intronic
1110227734 13:73137336-73137358 CTGGCTCTTTCTTATTTTTTAGG + Intergenic
1110978242 13:81867017-81867039 CTACCCCTTTTCTGCTTTTTTGG + Intergenic
1111779138 13:92699048-92699070 CTGGTCCTAGACTTTTTTTTTGG + Intronic
1111871630 13:93840089-93840111 CTGGTCCTGTACTTTTTTTGTGG + Intronic
1112770797 13:102792783-102792805 CTGACACTTTAATTTTTTTTGGG + Intronic
1112837251 13:103531131-103531153 TTGGCCCTTTGGTGTTTATTGGG - Intergenic
1113599187 13:111556176-111556198 CTGGGCCTTGACTCATTTTTAGG + Intergenic
1114291808 14:21294647-21294669 CTGTCCATTTACTGTTTTCTGGG + Intronic
1115184248 14:30666923-30666945 CTGGTCCTGGACTTTTTTTTTGG - Intronic
1115511652 14:34143474-34143496 CTGGTCCTGGACTTTTTTTTTGG - Intronic
1115625544 14:35188350-35188372 CTGGCTCTTTTTTGTATTTTTGG + Intronic
1117614882 14:57524094-57524116 CTGGTCCTGGACTTTTTTTTGGG + Intergenic
1118212530 14:63778809-63778831 CTGGCCCATTATTATTTTTTTGG + Intergenic
1119417657 14:74484819-74484841 ATGGCCCTTCACAGTTTCTTAGG + Intronic
1119794080 14:77380044-77380066 CTGCTCTTTAACTGTTTTTTTGG - Intronic
1120322019 14:82975626-82975648 CTAGCACTTTCCTGTTTTCTGGG - Intergenic
1121202012 14:92125644-92125666 CTGGCCCCTTTCTGTTCATTAGG + Intronic
1121203154 14:92137739-92137761 CTTTCCCTTTACTGATATTTCGG - Intronic
1121891646 14:97598962-97598984 CTGGGCCTGGACTGTTTTGTAGG - Intergenic
1122955368 14:105067910-105067932 CTGGCCATTCAGGGTTTTTTAGG - Intergenic
1202829274 14_GL000009v2_random:8741-8763 CTGGCCCTTGGCTGGTGTTTAGG - Intergenic
1123432872 15:20233290-20233312 CTGGCTCTTTTTTTTTTTTTTGG - Intergenic
1123438937 15:20275922-20275944 ATGTCCCTTTAATGTTTCTTAGG + Intergenic
1123906547 15:24927117-24927139 CTCCCCCTTTTCTTTTTTTTTGG + Intronic
1125825480 15:42672799-42672821 CTGGCCCAGTAATGTTTTTAGGG - Intronic
1129014625 15:72455590-72455612 CTGGCCTTTAACTGTTTGGTAGG + Intergenic
1131461230 15:92618975-92618997 CTGATCCTTTGCTGCTTTTTTGG - Exonic
1131558351 15:93418437-93418459 CTGGCTCTCTACTGTCTTTCTGG - Intergenic
1131628549 15:94150585-94150607 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
1131882888 15:96877508-96877530 CCGGCCATTTACAGTTCTTTTGG + Intergenic
1132134172 15:99316994-99317016 CTGGGCCTTTTTTTTTTTTTTGG + Intronic
1133177869 16:4029448-4029470 CTGGCCTCTTACTGATTTTGAGG - Intronic
1133824977 16:9270299-9270321 CTGGCCCTTTACTGATTTACTGG + Intergenic
1137471382 16:48762233-48762255 CTGGTCCTGGACTTTTTTTTTGG - Intergenic
1137575192 16:49594954-49594976 CTGGGCCTTGTCTGTGTTTTGGG - Intronic
1138042914 16:53693756-53693778 CTGGCCCTTTAATGAGTTTAGGG + Intronic
1139933405 16:70548565-70548587 CTGGCCCAACACTGTTTTTGAGG + Intronic
1141845715 16:86607540-86607562 CAGGCACTTTACTGTGTGTTGGG - Intergenic
1142014007 16:87734047-87734069 CCGGCCCTCTTGTGTTTTTTAGG - Intronic
1142422242 16:89978869-89978891 CTGGCCCTTTTACCTTTTTTTGG - Intergenic
1144121639 17:12160037-12160059 CTGGCCATTTTTTTTTTTTTAGG + Intergenic
1148971030 17:51481843-51481865 ATGCCCCTTTTCTGCTTTTTTGG + Intergenic
1149031051 17:52082596-52082618 CTGTCCCTTGACTGTGATTTTGG - Intronic
1152874236 17:82777048-82777070 TTGGCCTTTTCCTTTTTTTTTGG + Intronic
1154111966 18:11577953-11577975 CTGACATCTTACTGTTTTTTTGG - Intergenic
1154405083 18:14083611-14083633 CTGGCCCTGTAGTGTTGATTTGG - Intronic
1156167398 18:34438907-34438929 ATGGCCCTTGGCTGTTTCTTTGG - Intergenic
1156931308 18:42647287-42647309 CTGGCTCTATTCTGTTCTTTGGG + Intergenic
1157240355 18:46003518-46003540 CTGCCCCTTTTCTGGTCTTTTGG + Intronic
1157729601 18:49991999-49992021 CTTGTCCTTTACTGTATCTTTGG + Intronic
1158802633 18:60930670-60930692 ATGGCCATGAACTGTTTTTTGGG + Intergenic
1158934669 18:62353766-62353788 CTGGCCCCTTCCAGTTTTTCTGG - Intronic
1161624410 19:5317741-5317763 CTGGCCCCTTACTAATTTCTAGG - Intronic
1163085156 19:14974058-14974080 CTGGTTCGGTACTGTTTTTTAGG - Intronic
1165671016 19:37679158-37679180 CTGGCCCTTGACTGGCTCTTGGG + Intronic
1167351378 19:48977086-48977108 CTGGGCCTTGACTTTCTTTTGGG + Intronic
1167640247 19:50677743-50677765 CTGGCCCTGTGCTGTTTGATGGG - Intronic
1202643419 1_KI270706v1_random:119048-119070 CTGGCCCTTGGCTGGTGTTTAGG + Intergenic
925444797 2:3918647-3918669 CTGGCCTATTCCTGTCTTTTAGG + Intergenic
925885776 2:8392671-8392693 CTTGCCCTTTGGTGTTTTCTGGG + Intergenic
926504463 2:13695471-13695493 TTGGCTCTTTATTGTTTTTAGGG + Intergenic
926915714 2:17890048-17890070 CTGGTCCTGGACTGTTTTTTTGG + Intronic
929130071 2:38558904-38558926 CAGGCCATTTACTGTTTTCCGGG + Intergenic
930159742 2:48142757-48142779 CTGGTCCTAGACTTTTTTTTTGG + Intergenic
930338308 2:50079211-50079233 CTGGCCCTTGGAAGTTTTTTCGG + Intronic
931098060 2:58964546-58964568 CTGGGCCTTAACTGTTCTCTCGG + Intergenic
931217465 2:60260048-60260070 CTGGCCCTTTGCACATTTTTAGG + Intergenic
931611756 2:64108865-64108887 CTGTCCCTTTCTTGTTTCTTTGG - Intronic
932115910 2:69046826-69046848 TGGACCCTTTACTGTTTTATAGG - Intronic
932787635 2:74621291-74621313 CTGGTGCTTTTTTGTTTTTTGGG - Intronic
933077162 2:77943650-77943672 CTGCCCCATTATTGTTTTTTGGG - Intergenic
934499314 2:94842552-94842574 CTGGCCCTTGGCTGGTGTTTAGG + Intergenic
935007396 2:99092786-99092808 CTGGTCCTTGACTTTTTTTGTGG - Intronic
936274622 2:111083748-111083770 CTGGCCCTTTCCTGGCTCTTGGG - Intronic
936288453 2:111199756-111199778 CTGGCTCTTTGCTATTTATTGGG - Intergenic
936563284 2:113560717-113560739 CCTGCCCTCTACTGTCTTTTGGG - Intergenic
938286899 2:130126726-130126748 CTGGTCCTTTACTATGTTTTAGG - Intronic
938428696 2:131212147-131212169 CTGGTCCTTTACTATGTTTTAGG + Intronic
938469598 2:131546164-131546186 CTGGTCCCTTACTGTGTTTTAGG + Intergenic
939394663 2:141613102-141613124 CTGGCCTGTTTTTGTTTTTTAGG + Intronic
939461818 2:142506042-142506064 CTGGTCCTTGACTGTTCTCTGGG + Intergenic
940281409 2:151993500-151993522 CTGGCACTATCCTGTTTTTCTGG - Intronic
941582134 2:167311886-167311908 CTGCCTCTTTCCTGTTTTTCTGG - Intergenic
942718536 2:178922835-178922857 ATGGCCCCTTACAGTTTCTTTGG - Intronic
942796686 2:179829146-179829168 TTGGTCTTTTACTGTATTTTGGG - Intronic
943188803 2:184649830-184649852 CTGGGCCTTTTTTTTTTTTTTGG - Intronic
944046401 2:195416179-195416201 CTGGCCCATTTCTCTTATTTTGG - Intergenic
945318936 2:208399333-208399355 CTGGCCCTTGGCTGGTTTCTGGG + Intronic
946655043 2:221937315-221937337 TGGGCCCTTTATTCTTTTTTTGG + Intergenic
946679641 2:222199868-222199890 CTTGCCCACTACTGCTTTTTTGG - Exonic
948042817 2:234917110-234917132 CAGGCACTTTACTGTGTGTTTGG - Intergenic
1169285181 20:4301762-4301784 CTGGGCTTATACTGTTGTTTTGG + Intergenic
1170661203 20:18342246-18342268 CTGTGCATTTACTTTTTTTTTGG + Intergenic
1170735934 20:19014234-19014256 CTGGCCCTATTCTGTGCTTTGGG - Intergenic
1171890538 20:30709254-30709276 CTGGCCCTTGGCTGGTGTTTAGG + Intergenic
1174597762 20:51698225-51698247 CTGGCCCAGTCATGTTTTTTGGG - Intronic
1174615275 20:51830550-51830572 CTGGGACTTTTCTGTATTTTCGG - Intergenic
1174877319 20:54241531-54241553 CTGGTCCTGGACTTTTTTTTTGG - Intergenic
1175111658 20:56652771-56652793 CTGGCCCTTTTTTTTTTTTGAGG + Intergenic
1175207965 20:57326557-57326579 TTGGCCCTCTACTGTGTTTCTGG + Intergenic
1176608458 21:8853581-8853603 CTGGCCCTTGGCTGGTGTTTAGG - Intergenic
1177864929 21:26500905-26500927 CTGTCCCACTACTGTTTTATAGG - Intronic
1178259509 21:31085937-31085959 CTTCCCCTTTACTATTTTTAAGG - Intergenic
1180572731 22:16743705-16743727 CTGGTCCTGAACTTTTTTTTTGG - Intergenic
1180666474 22:17516897-17516919 CTGGTTGTTTATTGTTTTTTCGG + Intronic
1181002939 22:19996312-19996334 GTGGCCCTTTTTTTTTTTTTTGG - Intronic
1181623872 22:24108970-24108992 GTGAACCTTTACTGTTTGTTAGG + Intronic
1181660070 22:24339944-24339966 CTGGCTGTTTTCTGTGTTTTTGG + Intronic
1181785769 22:25225507-25225529 CTGGGTCTTTACAGATTTTTTGG + Intronic
1183021162 22:35027573-35027595 CTGGTCCTGGGCTGTTTTTTTGG + Intergenic
950947672 3:16966638-16966660 CTGGTCCTGGACTTTTTTTTTGG + Intronic
950976059 3:17246877-17246899 CTGGCCCTTGACTGATTCCTGGG + Intronic
951005922 3:17615507-17615529 CTGGTCCTGGACTTTTTTTTTGG + Intronic
952265398 3:31780836-31780858 CTAGTCCTAGACTGTTTTTTGGG - Intronic
953038215 3:39231759-39231781 CTGTCCCTTTCCTGTTCCTTTGG + Intergenic
953305021 3:41821172-41821194 TTGTCCCTTTACTCTTGTTTGGG + Intronic
954348960 3:50026377-50026399 CCGGCCCTTTTTTTTTTTTTTGG + Intronic
954567511 3:51610939-51610961 CTGGCCCTTTAGTGATTCTGAGG + Intronic
956295057 3:67703375-67703397 CTGGCCAATTTCTGTTTTTCGGG + Intergenic
956764797 3:72475459-72475481 GAGGCCTTTTACTGTTTTTTCGG + Intergenic
958257135 3:91338036-91338058 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
958998694 3:100936599-100936621 CTGGTCCTGGACTTTTTTTTTGG + Intronic
960981533 3:123232548-123232570 CTGGCCCTTTACTGTTTTTTTGG - Intronic
963050830 3:141141668-141141690 CTGGTCCTTGACTTTTTTTTTGG + Intronic
964244534 3:154635999-154636021 CTTGCCCTTTAATGATTTTTAGG - Intergenic
964332564 3:155620224-155620246 CTGGCCTTTTTTTCTTTTTTGGG - Intronic
964550834 3:157882858-157882880 CTGGTCCTGGACTCTTTTTTTGG - Intergenic
964566191 3:158055674-158055696 ATGGCCCTTTTTTTTTTTTTTGG - Intergenic
965034427 3:163419309-163419331 CTGGCTCTTTTTTGTATTTTTGG + Intergenic
965887686 3:173468468-173468490 CTGGCCCATTACTATGTTCTGGG + Intronic
966510190 3:180753390-180753412 CTTACCCTTTACTGTTTTTCTGG + Intronic
966607318 3:181834369-181834391 CTGCCCCTTTCCTGGTTCTTCGG + Intergenic
966897979 3:184460090-184460112 CTGGCTCTTTTTTTTTTTTTAGG + Intronic
968017938 3:195356378-195356400 CCTGCCTTTTACTGTTATTTAGG - Intronic
968793575 4:2687000-2687022 CAGGCCCTTTACTGTATCCTGGG + Intronic
972310310 4:37875925-37875947 TTGGCCCTTTACTCTTCTTTAGG - Intergenic
973564236 4:52167834-52167856 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
973803162 4:54498331-54498353 CCAGCACTTCACTGTTTTTTGGG - Intergenic
974145765 4:57945302-57945324 CTGGGGCTTTATTCTTTTTTGGG + Intergenic
974650273 4:64746095-64746117 CTGGTCCTTTGCTTTTTTTTTGG + Intergenic
975773798 4:77760699-77760721 CTTTCCTTTTACTGTCTTTTTGG - Intronic
976689672 4:87855619-87855641 CTGCCCCTTTCCTGTTCCTTTGG - Intergenic
977946783 4:102922926-102922948 CTGGTCCTGGACTTTTTTTTTGG - Intronic
979526559 4:121723908-121723930 ATGGCCTTTTACTGTTTTTTTGG - Intergenic
981625454 4:146749154-146749176 CTGGCCTTTTTTTTTTTTTTTGG - Intronic
981853784 4:149262885-149262907 CTGGCCCTTTCCTAGTCTTTTGG + Intergenic
982351572 4:154421241-154421263 CTGACCTTTTACTTTTTGTTAGG - Intronic
982465211 4:155722092-155722114 ATGCCCCGTTACTGTCTTTTTGG + Exonic
983182923 4:164669678-164669700 CTGGTCCTGGACTTTTTTTTTGG - Intergenic
983444940 4:167838110-167838132 CTGGTCCTTTATAGTTTTTGAGG - Intergenic
984549217 4:181140861-181140883 TGGGCCCTTTACTCTTTTTCTGG - Intergenic
1202770791 4_GL000008v2_random:204962-204984 CTGGCCCTTGGCTGGTGTTTAGG + Intergenic
986522041 5:8630197-8630219 CTGGACATTTTTTGTTTTTTAGG - Intergenic
986951597 5:13093181-13093203 GTGGCCTTTTACTCTTTTTTTGG - Intergenic
987637395 5:20562683-20562705 CTGGACCTTTATTCTTTTATTGG + Intronic
987837114 5:23175952-23175974 CTGGCCCTGGGCTTTTTTTTTGG + Intergenic
987936138 5:24466932-24466954 ATGGCCCATGAATGTTTTTTGGG + Intergenic
987962249 5:24824871-24824893 CTGGGGCTTCACTGTTTTATTGG + Intergenic
988663877 5:33303399-33303421 CTGTCACTGTTCTGTTTTTTTGG - Intergenic
988966920 5:36428509-36428531 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
989432332 5:41370557-41370579 CTTGCCCTTTTATCTTTTTTGGG + Intronic
989498586 5:42138820-42138842 CTGGGCCCTTACAGTGTTTTGGG - Intergenic
989501368 5:42171970-42171992 CTGGACCATTCATGTTTTTTAGG + Intergenic
990176525 5:53114319-53114341 CTGGCCCTTTACTCTTGCCTAGG - Intergenic
993151131 5:84163181-84163203 CTGGTCATTTTCTGTTTTTCAGG - Intronic
993299820 5:86194561-86194583 CTCACCCTTTTCTCTTTTTTTGG + Intergenic
993733120 5:91445786-91445808 CAGGCCCTTTTCTGTTTATGGGG + Intergenic
994997204 5:107079024-107079046 CTCCCCCTTTCCTCTTTTTTTGG - Intergenic
996380561 5:122858907-122858929 CTGGCCAATTATTGTATTTTTGG + Intronic
997249045 5:132374757-132374779 CTGGCCATTTTTTTTTTTTTTGG - Intronic
997431078 5:133841677-133841699 CTGGCCCTGTGCTGTGTGTTGGG - Intergenic
997694906 5:135852861-135852883 GTGGCCCTTTCCTGGTTTGTGGG + Intronic
998083962 5:139300973-139300995 CTGGCTCTTTTTTGTATTTTTGG + Intronic
998704684 5:144745114-144745136 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
999674316 5:153983609-153983631 CTTCCCATTTACTGTATTTTAGG + Intergenic
1000706054 5:164513381-164513403 GTGGCCCTTTACTCTTTCTCTGG + Intergenic
1000879788 5:166683953-166683975 CTAGCCCTTTTCTGGTTGTTTGG + Intergenic
1001397473 5:171427696-171427718 CTGGCCCTGGACTGGTTTTGAGG + Intronic
1001985017 5:176066529-176066551 CTGGCCCTTGGCTGTTGTTTAGG - Intronic
1002231850 5:177771606-177771628 CTGGCCCTTGGCTGTTGTTTAGG + Intronic
1002263491 5:178012147-178012169 CTGGCCCTTGGCTGTTGTTTAGG - Intronic
1002384532 5:178856414-178856436 CTGTCCCTTTCCTGGTCTTTTGG + Intergenic
1004639971 6:17505690-17505712 CAGGACCTTTGCTGTTTCTTTGG + Intronic
1005897981 6:30194691-30194713 CTGGCTATTTTCTGTATTTTTGG - Intronic
1006255718 6:32830449-32830471 CAGGCCCTTAACTCTTTTTCTGG - Intronic
1007183720 6:39949725-39949747 CTGGCCTCTTACTGTTCTTATGG - Intergenic
1007546343 6:42697629-42697651 CAGGCCTTTCACTGTGTTTTTGG + Exonic
1007721957 6:43890506-43890528 CTGGCCCTTCACTGTCTCTAGGG - Intergenic
1008101299 6:47393972-47393994 ATTGCCCTTTGCTTTTTTTTTGG - Intergenic
1008379013 6:50821905-50821927 CTGTCTCTTTGCTGTCTTTTTGG - Intronic
1008799060 6:55344056-55344078 CTGGTCCTGGACTTTTTTTTTGG - Intronic
1009416156 6:63418788-63418810 CTGCCCCTTTCCTGGTTTTTTGG - Intergenic
1010482476 6:76372049-76372071 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
1011335249 6:86252770-86252792 CTTGCTCTTTTCTTTTTTTTGGG - Intergenic
1011360279 6:86516523-86516545 CTGGCCCCTAACTGATGTTTTGG - Intergenic
1012137803 6:95580252-95580274 CTGGCTCTTTGCTGTTTCATTGG - Intronic
1012545125 6:100410799-100410821 CTGCCTCTTTATTGTTCTTTTGG - Intronic
1012687129 6:102266101-102266123 CTGGCCCTGGGCTTTTTTTTTGG - Intergenic
1013247123 6:108297482-108297504 CTATCCCTTTCCTGTTTTTTTGG + Intronic
1014367980 6:120568570-120568592 CTAGCCCCTTATTCTTTTTTTGG - Intergenic
1015131052 6:129809644-129809666 CTGGTCCTGGACTTTTTTTTGGG + Intergenic
1015273203 6:131358311-131358333 CTGCCCCTTTTCTGGTTCTTTGG - Intergenic
1016686805 6:146891111-146891133 ATGGCCCTTTTCTGCTCTTTGGG - Intergenic
1016883899 6:148940188-148940210 CTGACCTGTTACTGTCTTTTTGG - Intronic
1017575771 6:155801001-155801023 CTATCCATTTACTTTTTTTTTGG - Intergenic
1017908242 6:158771407-158771429 GTGGCCCTGTTCTGTTTTGTAGG - Exonic
1020000989 7:4755456-4755478 CTGGCCCTCTTCTGTTTTAAGGG - Intronic
1020414906 7:7934483-7934505 CTGACCCTTTCCTGGTTCTTTGG + Intronic
1021446941 7:20744023-20744045 CTGTGCTTTTTCTGTTTTTTGGG + Intronic
1023404903 7:39822982-39823004 CTGGCCCTTGGCTGGTGTTTGGG - Intergenic
1023495163 7:40787712-40787734 CTGCCCCTTTCCTGGTTCTTTGG - Intronic
1024352151 7:48377192-48377214 CTGGCCTTTTTTTTTTTTTTTGG - Intronic
1025857631 7:65296900-65296922 CTGGCCCTGGACTTTTTTTTGGG + Intergenic
1026484485 7:70806607-70806629 CTGGCCCTTCACTGAACTTTTGG + Intergenic
1027775970 7:82464783-82464805 CTGGCTCTTTATTTTTTTTATGG - Intergenic
1029067497 7:97866418-97866440 CAGTCCCTTTGCTGTTCTTTTGG - Intronic
1029710617 7:102297260-102297282 CTGGCCCGCTACATTTTTTTTGG - Intronic
1030050020 7:105529676-105529698 CTGGCCCCTAACTGTATTTTTGG - Intergenic
1030154444 7:106439087-106439109 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
1030622857 7:111810698-111810720 CTGGCCCTTAATTATTTCTTTGG - Intronic
1031883653 7:127223338-127223360 CTGCCCCTTTCCTGGTTCTTTGG - Intronic
1033471898 7:141657846-141657868 CTGGCACTTTAATTTGTTTTTGG - Exonic
1033651703 7:143348652-143348674 CTGCCCCCATACTGTTTTTTTGG - Intronic
1034153892 7:148938627-148938649 CTGCCTCTTTACTGTTTTATTGG - Intergenic
1035190432 7:157162817-157162839 CTGGACCTTTAATTTTATTTTGG + Intronic
1036139552 8:6194589-6194611 CTGGTCCTGGACTTTTTTTTTGG - Intergenic
1038082986 8:24161164-24161186 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
1042687191 8:71455276-71455298 CTGGTCCTGGACTTTTTTTTTGG - Intronic
1042856692 8:73274445-73274467 CTGGCCATTTCATCTTTTTTAGG + Intergenic
1046652719 8:116856038-116856060 CTTGCTTTTTTCTGTTTTTTTGG - Intronic
1046977961 8:120303861-120303883 CTGGCCCTGGGCTTTTTTTTTGG + Intronic
1047219088 8:122904205-122904227 CTGCCCCTTTCCTGATTCTTTGG - Intronic
1048554403 8:135459848-135459870 GTTGCCATTTAGTGTTTTTTAGG + Intronic
1049889449 9:54971-54993 CCTGCCCTCTACTGTCTTTTGGG + Intergenic
1049917265 9:330093-330115 CAGGGTCTTTACTGTATTTTAGG + Intronic
1050793205 9:9501109-9501131 CTTGCTTTTTATTGTTTTTTTGG - Intronic
1051123479 9:13777371-13777393 CTGGCCAACTACTGTTTGTTGGG - Intergenic
1051615534 9:19002262-19002284 CTGGTCCTGGACTTTTTTTTTGG - Intronic
1052008527 9:23379417-23379439 CCAGCCCTTTGCTGTCTTTTAGG + Intergenic
1052638422 9:31132441-31132463 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
1053442622 9:38128553-38128575 CTGCCCCATGACTGTGTTTTGGG + Intergenic
1053657845 9:40237985-40238007 CTGGCCCTTGGCTGGTGTTTAGG - Intronic
1053730934 9:41056241-41056263 CCTGCCCTCTACTGTCTTTTGGG + Intergenic
1053908213 9:42867261-42867283 CTGGCCCTTAGCTGGTGTTTAGG - Intergenic
1054358351 9:64086937-64086959 CTGGCCCTTGGCTGCTGTTTAGG - Intergenic
1054369968 9:64384257-64384279 CTGGCCCTTGGCTGGTGTTTAGG - Intronic
1054526751 9:66138240-66138262 CTGGCCCTTGGCTGGTGTTTAGG + Intronic
1054677597 9:67874011-67874033 CTGGCCCTTGGCTGGTGTTTAGG - Intronic
1054697578 9:68375849-68375871 CCTGCCCTCTACTGTCTTTTGGG - Intronic
1055075039 9:72205368-72205390 CTGTCCCTTTACTGTAATTAGGG + Intronic
1055468583 9:76589912-76589934 CTGCCCCTTCACTGTTTTGGAGG + Intergenic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1057535048 9:95893574-95893596 CTGGCCCTTAACTTTCTTTGTGG + Intronic
1059579644 9:115530497-115530519 CTTGCCCTTCCCTCTTTTTTTGG - Intergenic
1060247404 9:121957953-121957975 CTGGCCCCTCACTTTTTTTGAGG - Intronic
1060678669 9:125541488-125541510 CTGGTTCTTTACTCTTGTTTTGG - Intronic
1062036454 9:134384712-134384734 CTGGCCCTTTTCTGTCTTCCAGG + Intronic
1203703859 Un_KI270742v1:18791-18813 CTGGCCCTTGGCTGGTGTTTAGG - Intergenic
1203560161 Un_KI270744v1:47031-47053 CTGGCCCTTGGCTGGTGTTTAGG + Intergenic
1186856159 X:13628185-13628207 TTGGCCCTTGACTGGTTCTTAGG - Intronic
1187942572 X:24396092-24396114 CTGGCACTTTCCTGAGTTTTGGG + Intergenic
1188377514 X:29450334-29450356 CTGGCCCTTTACAGATAGTTGGG - Intronic
1188718508 X:33493737-33493759 CTTGACATTTTCTGTTTTTTAGG + Intergenic
1189565289 X:42235276-42235298 CTGTCCCTTTAGTGTTAATTAGG - Intergenic
1190457706 X:50641910-50641932 CTGGCCCCTTACTCTTTCTAGGG + Intronic
1192812243 X:74557682-74557704 CTGCCCCTTTCCTGGTTATTTGG - Intergenic
1192966215 X:76179914-76179936 CTGGTCCTTGACTTTTTTTTTGG + Intergenic
1193556903 X:82965286-82965308 CTGACTCTTTAGTGTTTTCTAGG + Intergenic
1193703109 X:84787961-84787983 CTGGCCCTTGGCTTATTTTTCGG + Intergenic
1194937021 X:99962540-99962562 CTGGGCCTATTCTGTTTTTGTGG - Intergenic
1195386109 X:104314735-104314757 CTGGCCCTCTCCTGATTTTCTGG - Intergenic
1195474206 X:105265524-105265546 CAGGCCCTTAACTGTTCTTCAGG + Intronic
1195603929 X:106780602-106780624 CTGGCTATTTACTGTGATTTGGG - Intronic
1197487946 X:127076952-127076974 CTGGCCATTTACTAATTTTCTGG - Intergenic
1198146858 X:133866718-133866740 CTGGCTTTTTTCTTTTTTTTTGG + Intronic
1198492107 X:137152098-137152120 CTGCCCCTTTCCTGCTCTTTTGG + Intergenic
1199090751 X:143689503-143689525 TGAGCCCTTTACTGTCTTTTTGG + Intergenic
1200062998 X:153491898-153491920 CTGGCCCTCTACAGCCTTTTGGG + Intronic
1201157225 Y:11142277-11142299 CAGTCCCTTTGCTGTTTCTTTGG + Intergenic